A Botybirnavirus Isolated from Alternaria tenuissima Confers Hypervirulence and Decreased Sensitivity of Its Host Fungus to Difenoconazole
Abstract
:1. Introduction
2. Materials and Methods
2.1. Fungal Strains
2.2. Extraction and Purification of RNA
2.3. Synthesis and Molecular Cloning of Complementary DNA (cDNA)
2.4. Analysis of Sequences and Phylogenetic Tree Construction
2.5. Elimination of AaBRV1-AT1 from Strain TJ-NH-51S-4
2.6. Vertical and Horizontal Transmission Assays
2.7. Effect of AaBRV1-AT1 on the Phenotype of Its Host Fungus
2.8. cDNA Library Preparation and Transcriptomic Analyses
2.9. Validation of RNA-seq Data Using Reverse Transcription-Quantitative PCR
3. Results
3.1. Characterization of AaBRV1 in A. tenuissima Strain TJ-NH-51S-4
3.2. Effect of AaBRV1-AT1 on the Phenotype of Its Host Fungus A. tenuissima
3.3. Vertical and Horizontal Transmission of AaBRV1-AT1
3.4. Differentially Expressed Genes (DEGs)
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ghabrial, S.A.; Caston, J.R.; Jiang, D.; Nibert, M.L.; Suzuki, N. 50-plus years of fungal viruses. Virology 2015, 479, 356–368. [Google Scholar] [CrossRef] [PubMed]
- Xie, J.; Jiang, D. New insights into mycoviruses and exploration for the biological control of crop fungal diseases. Annu. Rev. Phytopathol. 2014, 52, 45–68. [Google Scholar] [CrossRef] [PubMed]
- Wu, M.; Jin, F.; Zhang, J.; Yang, L.; Jiang, D.; Li, G. Characterization of a novel bipartite double-stranded RNA mycovirus conferring hypovirulence in the phytopathogenic fungus Botrytis Porri. J. Virol. 2012, 86, 6605–6619. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Wang, Q.; Cheng, J.; Fu, Y.; Jiang, D.; Xie, J. Molecular characterization of a bipartite double-stranded RNA virus and its satellite-like RNA co-infecting the phytopathogenic fungus Sclerotinia sclerotiorum. Front. Microbiol. 2015, 6, 406. [Google Scholar] [CrossRef]
- Ran, H.; Liu, L.; Li, B.; Cheng, J.; Fu, Y.; Jiang, D.; Xie, J. Co-infection of a hypovirulent isolate of Sclerotinia sclerotiorum with a new botybirnavirus and a strain of a mitovirus. Virol. J. 2016, 13, 92. [Google Scholar] [CrossRef]
- Wang, H.; Li, C.; Cai, L.; Fang, S.; Zheng, L.; Yan, F.; Zhang, S.; Liu, Y. The complete genomic sequence of a novel botybirnavirus isolated from a phytopathogenic Bipolaris maydis. Virus Genes 2018, 54, 733–736. [Google Scholar] [CrossRef]
- Zhai, L.; Yang, M.; Zhang, M.; Hong, N.; Wang, G. Characterization of a botybirnavirus conferring hypovirulence in the phytopathogenic fungus Botryosphaeria dothidea. Viruses 2019, 11, 266. [Google Scholar] [CrossRef]
- Marzano, S.Y.L.; Domier, L.L. Novel mycoviruses discovered from metatranscriptomics survey of soybean phyllosphere phytobiomes. Virus Res. 2016, 213, 332–342. [Google Scholar] [CrossRef]
- Xiang, J.; Fu, M.; Hong, N.; Zhai, L.; Xiao, F.; Wang, G. Characterization of a novel botybirnavirus isolated from a phytopathogenic Alternaria fungus. Arch. Virol. 2017, 162, 3907–3911. [Google Scholar] [CrossRef]
- Ma, G.; Liang, Z.; Hua, H.; Zhou, T.; Wu, X. Complete genome sequence of a new botybirnavirus isolated from a phytopathogenic Alternaria alternata in China. Arch. Virol. 2019, 164, 1225–1228. [Google Scholar] [CrossRef]
- Abdoulaye, A.H.; Foda, M.F.; Kotta-Loizou, I. Viruses infecting the plant pathogenic fungus Rhizoctonia solani. Viruses 2019, 11, 1113. [Google Scholar] [CrossRef] [PubMed]
- Li, P.; Bhattacharjee, P.; Wang, S.; Zhang, L.; Ahmed, I.; Guo, L. Mycoviruses in Fusarium species: An update. Front. Cell. Infect. Microbiol. 2019, 9, 257. [Google Scholar] [CrossRef] [PubMed]
- Nuss, D. Hypovirulence: Mycoviruses at the fungal-plant interface. Nat. Rev. Microbiol. 2005, 3, 632–642. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Xie, J.; Fu, Y.; Cheng, J.; Qu, Z.; Zhao, Z.; Cheng, S.; Chen, T.; Li, B.; Wang, Q.; et al. A 2-kb mycovirus converts a pathogenic fungus into a beneficial endophyte for brassica protection and yield enhancement. Mol. Plant 2020, 13, 1420–1433. [Google Scholar] [CrossRef]
- Zhou, L.; Li, X.; Kotta-Loizou, I.; Dong, K.; Li, S.; Ni, D.; Hong, N.; Wang, G.; Xu, W. A mycovirus modulates the endophytic and pathogenic traits of a plant associated fungus. ISME J. 2021, 15, 1893–1906. [Google Scholar] [CrossRef]
- Jian, J.; Lakshman, D.K.; Tavantzis, S.M. Association of distinct double-stranded RNAs with enhanced or diminished virulence in Rhizoctonia solani infecting potato. Mol. Plant Microbe Interact. 1997, 10, 1002–1009. [Google Scholar] [CrossRef]
- Kanhayuwa, L.; Kotta-Loizou, I.; Ozkan, S.; Gunning, A.P.; Coutts, R.H.A. A novel mycovirus from Aspergillus fumigatus contains four unique dsRNAs as its genome and is infectious as dsRNA. Proc. Natl. Acad. Sci. USA 2015, 112, 9100–9105. [Google Scholar] [CrossRef]
- Ozkan, S.; Coutts, R.H.A. Aspergillus fumigatus mycovirus causes mild hypervirulent effect on pathogenicity when tested on Galleria mellonella. Fungal Genet. Biol. 2015, 76, 20–26. [Google Scholar] [CrossRef]
- Okada, R.; Ichinose, S.; Takeshita, K.; Urayama, S.I.; Fukuhara, T.; Komatsu, K.; Arie, T.; Ishihara, A.; Egusa, M.; Kodama, M.; et al. Molecular characterization of a novel mycovirus in Alternaria alternata manifesting two-sided effects: Downregulation of host growth and up-regulation of host plant pathogenicity. Virology 2018, 519, 23–32. [Google Scholar] [CrossRef]
- Lau, S.K.P.; Lo, G.C.S.; Chow, F.W.N.; Fan, R.Y.Y.; Cai, J.J.; Yuen, K.Y.; Woo, P.C.Y. Novel partitivirus enhances virulence of and causes aberrant gene expression in Talaromyces marneffei. MBio 2018, 9, e00947-18. [Google Scholar] [CrossRef] [Green Version]
- Thomma, B.P. Alternaria spp.: From general saprophyte to specific parasite. Mol. Plant Pathol. 2003, 4, 225–236. [Google Scholar] [CrossRef] [PubMed]
- Ma, G.; Bao, S.; Zhao, J.; Sui, Y.; Wu, X. Morphological and molecular characterization of Alternaria species causing leaf blight on watermelon in China. Plant Dis. 2021, 105, 60–70. [Google Scholar] [CrossRef] [PubMed]
- Fonseka, D.L.; Gudmestad, N.C. Spatial and temporal sensitivity of Alternaria species associated with potato foliar diseases to demethylation inhibiting and anilino-pyrimidine fungicides. Plant Dis. 2016, 100, 1848–1857. [Google Scholar] [CrossRef] [PubMed]
- Sun, C.; Li, F.; Wei, M.; Xiang, Z.; Chen, C.; Xu, D. Detection and biological characteristics of Alternaria alternata resistant to difenoconazole from Paris polyphylla var. chinensis, an indigenous medicinal herb. Plant Dis. 2021, 105, 1546–1554. [Google Scholar] [CrossRef]
- Leroux, P.; Albertini, C.; Gautier, A.; Gredt, M.; Walker, A.S. Mutations in the CYP51 gene correlated with changes in sensitivity to sterol 14 alpha-demethylation inhibitors in field isolates of Mycosphaerella graminicola. Pest Manag. Sci. 2010, 63, 688–698. [Google Scholar] [CrossRef]
- Leroux, P.; Walker, A.S. Multiple mechanisms account for resistance to sterol 14α-demethylation inhibitors in field isolates of Mycosphaerella graminicola. Pest Manag. Sci. 2011, 67, 44–59. [Google Scholar] [CrossRef]
- Moye-Rowley, W.S. Multiple mechanisms contribute to the development of clinically significant azole resistance in Aspergillus fumigatus. Front. Microbiol. 2015, 6, 70. [Google Scholar] [CrossRef]
- Omrane, S.; Audeon, C.; Ignace, A.; Duplaix, C.; Aouini, L.; Kema, G.; Walker, A.S.; Fillinger, S. Plasticity of the MFS1 promoter leads to multidrug resistance in the wheat pathogen Zymoseptoria tritici. Msphere 2017, 2, e00393-17. [Google Scholar] [CrossRef]
- Niu, Y.; Yuan, Y.; Mao, J.; Yang, Z.; Cao, Q.; Zhang, T.; Wang, S.; Liu, D. Characterization of two novel mycoviruses from Penicillium digitatum and the related fungicide resistance analysis. Sci. Rep. 2018, 8, 5513. [Google Scholar] [CrossRef]
- Wang, S.; Yang, Z.; Zhang, T.; Li, N.; Cao, Q.; Li, G.; Yuan, Y.; Liu, D. Molecular characterization of a chrysovirus isolated from the citrus pathogen Penicillium crustosum and related fungicide resistance analysis. Front. Cell. Infect. Microbiol. 2019, 9, 156. [Google Scholar] [CrossRef]
- Ma, G.; Zhang, X.; Hua, H.; Zhou, T.; Wu, X. Molecular and biological characterization of a novel strain of Alternaria alternata chrysovirus 1 identified from the pathogen Alternaria tenuissima causing watermelon leaf blight. Virus Res. 2020, 280, 197904. [Google Scholar] [CrossRef] [PubMed]
- Qu, Z.; Fu, Y.; Lin, Y.; Zhao, Z.; Zhang, X.; Cheng, J.; Xie, J.; Chen, T.; Li, B.; Jiang, D. Transcriptional responses of Sclerotinia sclerotiorum to the infection by SsHADV-1. J. Fungi 2021, 7, 493. [Google Scholar] [CrossRef] [PubMed]
- Allen, T.D.; Dawe, A.L.; Nuss, D.L. Use of cDNA microarrays to monitor transcriptional responses of the chestnut blight fungus Cryphonectria parasitica to infection by virulence-attenuating hypoviruses. Eukaryot. Cell 2003, 2, 1253–1265. [Google Scholar] [CrossRef] [PubMed]
- Zhu, W.; Wei, W.; Fu, Y.; Cheng, J.; Xie, J.; Li, G.; Yi, X.; Kang, Z.; Dickman, M.; Jiang, D. A secretory protein of necrotrophic fungus Sclerotinia sclerotiorum that suppresses host resistance. PLoS ONE 2013, 8, e53901. [Google Scholar] [CrossRef]
- Lee, K.M.; Cho, W.K.; Yu, J.; Son, M.; Choi, H.; Min, K.; Lee, Y.W.; Kim, K.H. A comparison of transcriptional patterns and mycological phenotypes following infection of Fusarium graminearum by four mycoviruses. PLoS ONE 2014, 6, e100989. [Google Scholar] [CrossRef]
- Vainio, E.J.; Jurvansuu, J.; Hyder, R.; Kashif, M.; Piri, T.; Tuomivirta, T.; Anna, P.; Xu, P.; Salla, M.; Dina, N.; et al. Heterobasidion partitivirus 13 mediates severe growth debilitation and major alterations in the gene expression of a fungal forest pathogen. J. Virol. 2018, 92, e01744-17. [Google Scholar] [CrossRef]
- Özkan, S.; Mohorianu, I.; Xu, P.; Dalmay, T.; Coutts, R.H.A. Profiles and functional analysis of small RNAs derived from Aspergillus fumigatus infected with double-stranded RNA mycovirus. BMC Genomics 2017, 18, 416. [Google Scholar] [CrossRef]
- Morris, T.J.; Dodds, J.A. Isolation and analysis of double stranded RNA from virus-infected plant and fungal tissue. Phytopathology 1979, 69, 854–858. [Google Scholar] [CrossRef]
- Thompson, J.D.; Gibson, T.J.; Plewniak, F.; Jeanmougin, F.; Higgins, D.G. The CLUSTAL_X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997, 25, 4876–4882. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [Green Version]
- Kamaruzzaman, M.; He, G.; Wu, M.; Zhang, J.; Yang, L.; Chen, W.; Li, G. A novel partitivirus in the hypovirulent isolate QT5-19 of the plant pathogenic fungus Botrytis cinerea. Viruses 2019, 11, 24. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Bian, R.; Liu, Q.; Yang, L.; Pang, T.; Salaipeth, L.; Andika, I.B.; Kondo, H.; Sun, L. Identification of a novel hypovirulence-inducing hypovirus from Alternaria alternata. Front. Microbiol. 2019, 10, 1076. [Google Scholar] [CrossRef] [PubMed]
- Leung, H.; Lehtinen, U.; Karjalainen, R.; Skinner, D.; Tooley, P.; Leong, S.; Ellingboe, A. Transformation of the rice blast fungus Magnaporthe grisea to hygromycin B resistance. Curr. Genet. 1990, 17, 409–411. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Zhang, Y.; Wan, X.; She, Y.; Li, M.; Xi, H.; Xie, J.; Wen, C. A novel ourmia-like mycovirus confers hypovirulence-associated traits on Fusarium oxysporum. Front. Microbiol. 2020, 11, 569869. [Google Scholar] [CrossRef]
- Avenot, H.F.; Michailides, T.J. Resistance to boscalid fungicide in Alternaria alternata isolates from pistachio in California. Plant Dis. 2007, 91, 1345–1350. [Google Scholar] [CrossRef] [PubMed]
- Pryor, B.M.; Michailides, T.J. Morphological, pathogenic, and molecular characterization of Alternaria isolates associated with Alternaria late blight of pistachio. Phytopathology 2002, 92, 406–416. [Google Scholar] [CrossRef] [PubMed]
- Zhong, S.; Joung, J.G.; Zheng, Y.; Chen, Y.; Liu, B.; Shao, Y.; Xiang, J.; Fei, Z.; Giovannoni, J.J. High-throughput illumina strand-specific RNA sequencing library preparation. Cold Spring Harb. Protoc. 2011, 8, 940–949. [Google Scholar] [CrossRef]
- Trapnell, C.; Pachter, L.; Salzberg, S.L. TopHat: Discovering splice junctions with RNA-Seq. Bioinformatics 2009, 25, 1105–1111. [Google Scholar] [CrossRef]
- Li, Y.; Li, S.; Liang, Z.; Cai, Q.; Zhou, T.; Zhao, C.; Wu, X. RNA-seq analysis of Rhizoctonia solani AG-4HGI strain BJ-1H infected by a new viral strain of Rhizoctonia solani partitivirus 2 reveals a potential mechanism for hypovirulence. Phytopathology 2022, 112, 1373–1385. [Google Scholar] [CrossRef]
- Anders, S.; Huber, W. Differential expression analysis for sequence count data. Genome Biol. 2010, 11, R106. [Google Scholar] [CrossRef] [Green Version]
- Lalitha, S. Primer premier 5. Biotechnol. Softw. Int. Rep. 2000, 1, 270–272. [Google Scholar] [CrossRef]
- Dossa, K.; Mmadi, M.A.; Zhou, R.; Zhou, Q.; Yang, M.; Cisse, N.; Diouf, D.; Wang, L.; Zhang, X. The contrasting response to drought and waterlogging is underpinned by divergent DNA methylation programs associated with transcript accumulation in sesame. Plant. Sci. 2018, 277, 207–217. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Kotta-Loizou, I. Mycoviruses and their role in fungal pathogenesis. Curr. Opin. Microbiol. 2021, 63, 10–18. [Google Scholar] [CrossRef] [PubMed]
- Ahn, I.P.; Lee, Y.H. A viral double-stranded RNA up regulates the fungal virulence of Nectria radicicola. Mol. Plant. Microbe Interact. 2001, 14, 496–507. [Google Scholar] [CrossRef] [PubMed]
- Kottaloizou, I.; Coutts, R.H.A. Studies on the virome of the entomopathogenic fungus Beauveria bassiana reveal novel dsRNA elements and mild hypervirulence. PLoS Pathog. 2017, 13, e1006183. [Google Scholar] [CrossRef]
- Xiao, X.; Cheng, J.; Tang, J.; Fu, Y.; Jiang, D.; Baker, T.S.; Ghabrial, S.A.; Xie, J. A novel partitivirus that confers hypovirulence on plant pathogenic fungi. J. Virol. 2014, 88, 10120–10133. [Google Scholar] [CrossRef]
- Philpott, C.C.; Protchenko, O. Response to iron deprivation in Saccharomyces cerevisiae. Eukaryot. Cell 2008, 7, 20–27. [Google Scholar] [CrossRef]
- Haas, H.; Eisendle, M.; Turgeon, B.G. Siderophores in fungal physiology and virulence. Annu. Rev. Phytopathol. 2008, 46, 149–187. [Google Scholar] [CrossRef]
- Domenico, I.; Ward, D.M.; Kaplan, J. Regulation of iron acquisition and storage: Consequences for iron-linked disorders. Nat. Rev. Mol. Cell Biol. 2008, 9, 72–81. [Google Scholar] [CrossRef]
- Dietl, A.M.; Misslinger, M.; Aguiar, M.M.; Ivashov, V.; Teis, D.; Pfister, J.; Decristoforo, C.; Hermann, M.; Sullivan, S.M.; Smith, L.R.; et al. The siderophore transporter Sit1 determines susceptibility to the antifungal VL-2397. Antimicrob. Agents Chemother. 2019, 63, e00807–e00819. [Google Scholar] [CrossRef] [PubMed]
- Teramoto, H.; Tanaka, H.; Wariishi, H. Degradation of 4-nitrophenol by the lignin-degrading basidiomycete Phanerochaete chrysosporium. Appl. Microbiol. Biotechnol. 2004, 66, 312–317. [Google Scholar] [CrossRef] [PubMed]
- Proctor, R.H.; Plattner, R.D.; Desjardins, A.E.; Busman, M.; Butchko, R.A.E. Fumonisin production in the maize pathogen Fusarium verticillioides: Genetic basis of naturally occurring chemical variation. J. Agric. Food Chem. 2006, 54, 2424–2430. [Google Scholar] [CrossRef] [PubMed]
- Desjardins, A.E.; Hohn, T.M. Mycotoxins in plant pathogenesis. Mol. Plant Microbe Interact. 2007, 20, 147–152. [Google Scholar] [CrossRef]
- Lu, W.; Feng, J.; Chen, X.; Bao, Y.; Wang, Y.; Wu, Q.; Ma, Y.; Zhu, D. Distinct regioselectivity of fungal P450 enzymes for steroidal hydroxylation. Appl. Environ. Microb. 2019, 85, e01182-19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Primer Name | Sequence (5′-3′) |
---|---|
RACE3 | CGATCGATCATGATGCAATGC |
RACE3RT | CGATCGATCATGATGCAATGCNNNNNN |
PC3-T7 Loop adapter | p-GGATCCCGGGAATTCGGTAATACGACTCA CTATATTTTTATAGTGAGTCGTATTA-OH |
PC2 | CCGAATTCCCGGGATCC |
AaBRV1-AT1-dsRNA1-3end | TAACAAGTTCAAAGCATCTGGAG |
AaBRV1-AT1-dsRNA1-5end | TGGGAGATTACAGGTGGCTTCA |
AaBRV1-AT1-dsRNA2-3end | CAGATTCAATGCCCACTGTAAG |
AaBRV1-AT1-dsRNA2-5end | AGATGTTGGGAGATTACAGGTGG |
AaBRV1-AT1-dsRNA1-Gap -1-F | AATCGTATGGAAGGGTAA |
AaBRV1-AT1-dsRNA1-Gap -1-R | TACTTGAAGTCGGTGGTG |
AaBRV1-AT1-dsRNA2-Gap -2-F | TGCGTAGTCCAGATTGCCG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liang, Z.; Hua, H.; Wu, C.; Zhou, T.; Wu, X. A Botybirnavirus Isolated from Alternaria tenuissima Confers Hypervirulence and Decreased Sensitivity of Its Host Fungus to Difenoconazole. Viruses 2022, 14, 2093. https://doi.org/10.3390/v14102093
Liang Z, Hua H, Wu C, Zhou T, Wu X. A Botybirnavirus Isolated from Alternaria tenuissima Confers Hypervirulence and Decreased Sensitivity of Its Host Fungus to Difenoconazole. Viruses. 2022; 14(10):2093. https://doi.org/10.3390/v14102093
Chicago/Turabian StyleLiang, Zhijian, Huihui Hua, Chunyan Wu, Tao Zhou, and Xuehong Wu. 2022. "A Botybirnavirus Isolated from Alternaria tenuissima Confers Hypervirulence and Decreased Sensitivity of Its Host Fungus to Difenoconazole" Viruses 14, no. 10: 2093. https://doi.org/10.3390/v14102093