The 96th Amino Acid of the Coat Protein of Cucumber Green Mottle Mosaic Virus Affects Virus Infectivity
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plants and Reagents
2.2. Construction of Mutants
2.3. Inoculation
2.4. Detection of Mutant Infectivity
3. Results
3.1. The Mutants V94A, V97, and T104A Show a Delay in Appearance of Symptoms
3.2. The 96th Amino Acid of CP Affects CGMMV Infectivity
3.3. The Relationship between the Accumulation of Mutant RNA and Symptoms in Host Plants
4. Discussion
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Ainsworth, G.C. Mosaic diseases of the cucumber. Ann. Appl. Biol. 1935, 22, 55–67. [Google Scholar] [CrossRef]
- Dombrovsky, A.; Trannguyen, L.T.T.; Jones, R.A.C. Cucumber green mottle mosaic virus: Rapidly increasing global distribution, etiology, epidemiology, and management. Annu. Rev. Phytopathol. 2017, 55, 231–256. [Google Scholar] [CrossRef] [PubMed]
- Lovisolo, O. Virus and viroid diseases of cucurbits. Acta Hortic. 1981, 33–82. [Google Scholar] [CrossRef]
- Okada, Y. Cucumber Green Mottle Mosaic Virus; Springer: New York, NY, USA, 1986; pp. 267–281. [Google Scholar]
- Zhou, L.L.; Wu, Y.H.; Zhao, X.X.; Li, L.M.; Cai, M.; Wang, L.; Wang, W.H. The biological characteristics of Cucumber green mottle mosaic virus and its effects on yield and quality of watermelon. J. Shenyang Agric. Univ. 2008, 39, 417–422. [Google Scholar]
- Li, J.X.; Liu, S.S.; Gu, Q.S. Transmission efficiency of Cucumber green mottle mosaic virus via seeds, soil, pruning and irrigation water. J. Phytopathol. 2016, 164, 300–309. [Google Scholar] [CrossRef]
- Liu, H.W.; Luo, L.X.; Li, J.Q.; Liu, P.F.; Chen, X.Y.; Hao, J.J. Pollen and seed transmission of Cucumber green mottle mosaic virus in cucumber. Plant Pathol. 2014, 63, 72–77. [Google Scholar] [CrossRef]
- Ali, A.; Hussain, A.; Ahmad, M. Occurrence and molecular characterization of Cucumber green mottle mosaic virus in cucurbit crops of KPK, Pakistan. Braz. J. Microbiol. 2014, 45, 1247–1253. [Google Scholar] [CrossRef] [PubMed]
- Park, G.S. Occurrence of two tobamovirus diseases in cucurbits and control measures in Korea. Plant Pathol. J. 2001, 17, 243–248. [Google Scholar]
- Fletcher, J.T.; George, A.J.; Green, D.E. Cucumber green mottle mosaic virus, its effect on yield and its control in the Lea Valley, England. Plant Pathol. 2010, 18, 16–22. [Google Scholar] [CrossRef]
- Duhyun, K.; Jungmyung, L. Seed treatment for Cucumber green mottle mosaic virus (CGMMV) in gourd (Lagenaria siceraria) seeds and its detection. Hortic. Environ. Biotechnol. 2000, 41, 626–633. [Google Scholar]
- Macias, W. Methods of disinfecting cucumber seeds that originate from plants infected by cucumber green mottle mosaic tobamovirus (CGMMV). Veg. Crops Res. Bull. 2000, 53, 75–82. [Google Scholar]
- Mandal, S.; Mandal, B.; Haq, Q.; Verma, A. Properties, diagnosis and management of Cucumber green mottle mosaic virus. Plant Viruses 2008, 2, 25–34. [Google Scholar]
- Liu, H.; Luo, L.; Zhu, C.; Liang, C.; Liu, P.; Li, J. Research progress in management of Cucumber green mottle mosaic virus. Plant Prot. 2016, 42, 29–37. [Google Scholar]
- Nishiguchi, M. Basic studies on attenuated viruses. J. Gen. Plant Pathol. 2007, 73, 418–420. [Google Scholar] [CrossRef]
- Ali, M.E.; Waliullah, S.; Nishiguchi, M. Molecular analysis of an attenuated strain of Cucumber green mottle mosaic virus using in vitro infectious cDNA clone: Pathogenicity and suppression of RNA silencing. J. Plant Biochem. Biotechnol. 2016, 25, 79–86. [Google Scholar] [CrossRef]
- Slavokhotova, A.A.; Istomina, E.A.; Andreeva, E.N.; Korostyleva, T.V.; Pukhalskij, V.A.; Shijan, A.N.; Odintsova, T.I. An attenuated strain of Cucumber green mottle mosaic virus as a biological control agent against pathogenic viral strains. Am. J. Plant Sci. 2016, 07, 724–732. [Google Scholar] [CrossRef]
- Liu, L.; Peng, B.; Zhang, Z.; Wu, Y.; Miras, M.; Aranda, M.A.; Gu, Q. Exploring different mutations at a single amino acid position of Cucumber green mottle mosaic virus replicase to attain stable symptom attenuation. Phytopathology 2017, 107, 1080–1086. [Google Scholar] [CrossRef] [PubMed]
- Ugaki, M.; Tomiyama, M.; Kakutani, T.; Hidaka, S.; Kiguchi, T.; Nagata, R.; Sato, T.; Motoyoshi, F.; Nishiguchi, M. The complete nucleotide sequence of Cucumber green mottle mosaic virus (SH strain) genomic RNA. J. Gen. Virol. 1991, 72 (Pt 7), 1487–1495. [Google Scholar] [CrossRef] [PubMed]
- Callaway, A.; Giesman-Cookmeyer, D.; Gillock, E.T.; Sit, T.L.; Lommel, S.A. The multifunctional capsid proteins of plant RNA viruses. Annu. Rev. Phytopathol. 2001, 39, 419–460. [Google Scholar] [CrossRef] [PubMed]
- Fukuda, M.; Ohno, T.; Okada, Y.; Otsuki, Y.; Takebe, I. Kinetics of biphasic reconstitution of Tobacco mosaic virus in vitro. Proc. Natl. Acad. Sci. USA 1978, 75, 1727–1730. [Google Scholar] [CrossRef] [PubMed]
- Fukuda, M.; Meshi, T.; Okada, Y.; Otsuki, Y.; Takebe, I. Correlation between particle multiplicity and location on virion RNA of the assembly initiation site for viruses of the Tobacco mosaic virus group. Proc. Natl. Acad. Sci. USA 1981, 78, 4231–4235. [Google Scholar] [CrossRef] [PubMed]
- Banerjee, N.; Wang, J.Y.; Zaitlin, M. A single nucleotide change in the coat protein gene of Tobacco mosaic virus is involved in the induction of severe chlorosis. Virology 1995, 207, 234–239. [Google Scholar] [CrossRef] [PubMed]
- Knorr, D.A.; Dawson, W.O. A point mutation in the Tobacco mosaic virus capsid protein gene induces hypersensitivity in nicotiana sylvestris. Proc. Natl. Acad. Sci. USA 1988, 85, 170–174. [Google Scholar] [CrossRef] [PubMed]
- Tsuda, S.; Kirita, M.; Watanabe, Y. Characterization of a pepper mild mottle tobamovirus strain capable of overcoming the L3 gene-mediated resistance, distinct from the resistance-breaking Italian isolate. Mol. Plant Microbe Interact. 1998, 11, 327–331. [Google Scholar] [CrossRef] [PubMed]
- Lebeurier, G.; Nicolaieff, A.; Richards, K.E. Inside-out model for self-assembly of Tobacco mosaic virus. Proc. Natl. Acad. Sci. USA 1977, 74, 149–153. [Google Scholar] [CrossRef] [PubMed]
- Lomonossoff, G.P.; Butler, P.J. Assembly of Tobacco Mosaic Virus: Elongation towards the 3′-Hydroxyl Terminus of the RNA; Quintessence Publishing Co.: Hanover Park, IL, USA, 1980; pp. 271–274. [Google Scholar]
- Culver, J.N. Tobacco mosaic virus assembly and disassembly: Determinants in pathogenicity and resistance. Annu. Rev. Phytopathol. 2002, 40, 287–308. [Google Scholar] [CrossRef] [PubMed]
- Dawson, W.O.; Bubrick, P.; Grantham, G.L. Modifications of the Tobacco mosaic virus coat protein gene affecting replication, movement, and symptomatology. Phytopathology 1988, 78, 783–789. [Google Scholar] [CrossRef]
- Simónbuela, L.; Garcíaarenal, F. Virus particles of cucumber green mottle mosaic tobamovirus move systemically in the phloem of infected cucumber plants. Mol. Plant Microbe Interact. 1999, 12, 112–118. [Google Scholar] [CrossRef] [PubMed]
- Sit, T.L.; Haikal, P.R.; Callaway, A.S.; Lommel, S.A. A single amino acid mutation in the Carnation ringspot virus capsid protein allows virion formation but prevents systemic infection. J. Virol. 2001, 75, 9538–9542. [Google Scholar] [CrossRef] [PubMed]
- Bendahmane, M.; Szecsi, J.; Chen, I.; Berg, R.H.; Beachy, R.N. Characterization of mutant Tobacco mosaic virus coat protein that interferes with virus cell-to-cell movement. Proc. Natl. Acad. Sci. USA 2002, 99, 3645–3650. [Google Scholar] [CrossRef] [PubMed]
- Pagán, I.; Firth, C.; Holmes, E.C. Phylogenetic analysis reveals rapid evolutionary dynamics in the plant RNA virus genus tobamovirus. J. Mol. Evol. 2010, 71, 298–307. [Google Scholar] [CrossRef] [PubMed]
- Domingo, E.; Holland, J.J. RNA virus mutations and fitness for survival. Annu. Rev. Microbiol. 1997, 51, 151–178. [Google Scholar] [CrossRef] [PubMed]
Mutants | Primers | Sequences (5′-3′) |
---|---|---|
E96K | E96K-X | AAGGTTGTAGATCCTAGCAATCCCA |
E96K-S | TAGGATCTACAACCTTAATGACCCTA | |
V94A-E96K | V94A-E96K-X | AAGGTTGTAGATCCTAGCAATCCCA |
V94A-E96K-S | TAGGATCTACAACCTTAATAGCCCTA | |
V97-E96K | V97-E96K-X | AAGGTAGATCCTAGCAATCCCACGA |
V97-E96K-S | TGCTAGGATCTACCTTAATGACCCTA | |
T104A-E96K | T104A-E96K-X | CGTAATAGGGTCATTAAGGTTGTAGA |
T104A-E96K-S | TAATGACCCTATTACGCGTATCCGT |
Plant | Mutants | 7 dpi | 14 dpi | 21 dpi | ||||||
---|---|---|---|---|---|---|---|---|---|---|
Symptoms | Y/N | ELISA | Symptoms | Y/N | ELISA | Symptoms | Y/N | ELISA | ||
N.B | V94A-E96K | M | 8/12 | + | M, Ma | 12/12 | + | M | 12/12 | + |
N.B | V94A | —— | 0/12 | + | Ma | 9/12 | + | M | 10/12 | + |
N.B | V97-E96K | M, Ma | 7/12 | + | M, Ma | 12/12 | + | M | 12/12 | + |
N.B | V97 | —— | 0/12 | − | —— | 0/12 | − | —— | 0/12 | + |
N.B | T104A-E96K | M | 5/12 | + | M, Ma | 12/12 | + | M | 12/12 | + |
N.B | T104A | —— | 0/12 | − | —— | 0/12 | − | M, Ma | 3/12 | + |
N.B | E96K | M, Ma | 11/12 | + | M, Ma | 12/12 | + | M | 12/12 | + |
N.B | E96A | —— | 0/12 | + | M, Ma | 12/12 | + | M | 12/12 | + |
N.B | WT | M, Ma | 6/12 | + | M, Ma | 12/12 | + | M | 12/12 | + |
N.B | CK | —— | 0/12 | − | —— | —— | − | —— | —— | − |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Z.; Liu, L.; Wu, H.; Liu, L.; Kang, B.; Peng, B.; Gu, Q. The 96th Amino Acid of the Coat Protein of Cucumber Green Mottle Mosaic Virus Affects Virus Infectivity. Viruses 2018, 10, 6. https://doi.org/10.3390/v10010006
Zhang Z, Liu L, Wu H, Liu L, Kang B, Peng B, Gu Q. The 96th Amino Acid of the Coat Protein of Cucumber Green Mottle Mosaic Virus Affects Virus Infectivity. Viruses. 2018; 10(1):6. https://doi.org/10.3390/v10010006
Chicago/Turabian StyleZhang, Zhenwei, Liming Liu, Huijie Wu, Lifeng Liu, Baoshan Kang, Bin Peng, and Qinsheng Gu. 2018. "The 96th Amino Acid of the Coat Protein of Cucumber Green Mottle Mosaic Virus Affects Virus Infectivity" Viruses 10, no. 1: 6. https://doi.org/10.3390/v10010006