Nevirapine Biotransformation Insights: An Integrated In Vitro Approach Unveils the Biocompetence and Glutathiolomic Profile of a Human Hepatocyte-Like Cell 3D Model
Abstract
:1. Introduction
2. Results
2.1. NVP Modulates Key Biotransformation Enzyme Activity in 2D and 3D HLC Cultures
2.2. HLC 3D Cultures Are More Efficient in Maintaining the Dynamics of Glutathione Pools
2.3. The Glutathiolomic Profile of 3D Cultures Is Altered upon NVP Exposure in a Time-Dependent Manner
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Nevirapine Cytotoxicity
4.3. Biotransformation Activity
4.4. Quantification of Nevirapine Metabolites
4.5. Gene Expression
4.6. Glutathiolomic Profiling
4.7. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Godoy, P.; Hewitt, N.J.; Albrecht, U.; Andersen, M.E.; Ansari, N.; Bhattacharya, S.; Bode, J.G.; Bolleyn, J.; Borner, C.; Böttger, J.; et al. Recent advances in 2D and 3D in vitro systems using primary hepatocytes, alternative hepatocyte sources and non-parenchymal liver cells and their use in investigating mechanisms of hepatotoxicity, cell signaling and ADME. Arch. Toxicol. 2013, 87, 1315–1530. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zuang, V.; Dura, A.; Bofill, D.A.; Barroso, J.F.V.; Leite, S.B.; Belz, S.; Berggren, E.; Bernasconi, C.; Bopp, S.; Bouhfid, M.; et al. EURL ECVAM Status Report on the Development, Validation and Regulatory Acceptance of Alternative Methods and Approaches (2018); Publications Office of the EU: Luxembourg, 2019. [Google Scholar]
- Vinken, M.; Hengstler, J.G. Characterization of hepatocyte-based in vitro systems for reliable toxicity testing. Arch. Toxicol. 2018, 92, 2981–2986. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cipriano, M.; Correia, J.C.; Camões, S.P.; Oliveira, N.G.; Cruz, P.; Cruz, H.; Castro, M.; Ruas, J.L.; Santos, J.M.; Miranda, J.P. The role of epigenetic modifiers in extended cultures of functional hepatocyte-like cells derived from human neonatal mesenchymal stem cells. Arch. Toxicol. 2017, 91, 2469–2489. [Google Scholar] [CrossRef]
- Cipriano, M.; Freyer, N.; Knöspel, F.; Oliveira, N.G.; Barcia, R.; Cruz, P.E.; Cruz, H.; Castro, M.; Santos, J.M.; Zeilinger, K.; et al. Self-assembled 3D spheroids and hollow-fibre bioreactors improve MSC-derived hepatocyte-like cell maturation in vitro. Arch. Toxicol. 2017, 91, 1815–1832. [Google Scholar] [CrossRef] [PubMed]
- Pinheiro, P.F.; Pereira, S.A.; Harjivan, S.G.; Martins, I.L.; Marinho, A.T.; Cipriano, M.; Jacob, C.C.; Oliveira, N.G.; Castro, M.F.; Marques, M.M.; et al. Hepatocyte spheroids as a competent in vitro system for drug biotransformation studies: Nevirapine as a bioactivation case study. Arch. Toxicol. 2017, 91, 1199–1211. [Google Scholar] [CrossRef] [PubMed]
- Marinho, A.T.; Miranda, J.P.; Caixas, U.; Charneira, C.; Gonçalves-Dias, C.; Marques, M.M.; Monteiro, E.C.; Antunes, A.M.M.; Pereira, S.A. Singularities of nevirapine metabolism: From sex-dependent differences to idiosyncratic toxicity. Drug Metab. Rev. 2019, 51, 76–90. [Google Scholar] [CrossRef]
- Marinho, A.T.; Dias, C.G.; Pinheiro, P.F.; Lemos, A.R.; Antunes, A.M.M.; Marques, M.M.; Monteiro, E.C.; Miranda, J.P.; Pereira, S.A. Nevirapine modulation of paraoxonase-1 in the liver: An in vitro three-model approach. Eur. J. Pharm. Sci. 2016, 82, 147–153. [Google Scholar] [CrossRef]
- Tostoes, R.M.; Leite, S.B.; Miranda, J.P.; Sousa, M.; Wang, D.I.; Carrondo, M.J.; Alves, P.M. Perfusion of 3D encapsulated hepatocytes--a synergistic effect enhancing long-term functionality in bioreactors. Biotechnol. Bioeng. 2011, 108, 41–49. [Google Scholar] [CrossRef]
- Miranda, J.P.; Leite, S.B.; Muller-Vieira, U.; Rodrigues, A.; Carrondo, M.J.T.; Alves, P.M. Towards an extended functional hepatocyte in vitro culture. Tissue Eng. Part. C Methods 2009, 15, 157–167. [Google Scholar] [CrossRef]
- Townsend, D.M.; Lushchak, V.I.; Cooper, A.J.L. A comparison of reversible versus irreversible protein glutathionylation. Adv. Cancer Res. 2014, 122, 177–198. [Google Scholar]
- Cooper, A.J.; Pinto, J.T.; Callery, P.S. Reversible and irreversible protein glutathionylation: Biological and clinical aspects. Exp. Opin. Drug Metab. Toxicol. 2011, 7, 891–910. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McGarry, D.J.; Chakravarty, P.; Wolf, C.R.; Henderson, C.J. Altered protein S-glutathionylation identifies a potential mechanism of resistance to acetaminophen-induced hepatotoxicity. J. Pharmacol. Exp. Ther. 2015, 355, 137–144. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Riska, P.S.; Joseph, D.P.; Dinallo, R.M.; Davidson, W.C.; Keirns, J.J.; Hattox, S.E. Biotransformation of nevirapine, a non-nucleoside HIV-1 reverse transcriptase inhibitor, in mice, rats, rabbits, dogs, monkeys, and chimpanzees. Drug Metab. Dispos. 1999, 27, 1434–1447. [Google Scholar] [PubMed]
- Sharma, A.M.; Li, Y.; Novalen, M.; Hayes, M.A.; Uetrecht, J. Bioactivation of nevirapine to a reactive quinone methide: Implications for liver injury. Chem. Res. Toxicol. 2012, 25, 1708–1719. [Google Scholar] [CrossRef] [PubMed]
- Erickson, D.A.; Mather, G.; Trager, W.F.; Levy, R.H.; Keirns, J.J. Characterization of the in vitro biotransformation of the HIV-1 reverse transcriptase inhibitor nevirapine by human hepatic cytochromes P-450. Drug Metab. Dispos. 1999, 27, 1488–1495. [Google Scholar] [PubMed]
- Castell, J.V.; Gómez-Lechón, M.J. In Vitro Methods in Pharmaceutical Research; Academic Press: Cambridge, MA, USA, 1997; pp. 140–141. ISBN 012163390X. [Google Scholar]
- Wikswo, J.P. The relevance and potential roles of microphysiological systems in biology and medicine. Exp. Biol. Med. 2014, 239, 1061–1072. [Google Scholar] [CrossRef]
- Tostoes, R.M.; Leite, S.B.; Serra, M.; Jensen, J.; Bjorquist, P.; Carrondo, M.J.; Brito, C.; Alves, P.M. Human liver cell spheroids in extended perfusion bioreactor culture for repeated-dose drug testing. Hepatology 2012, 55, 1227–1236. [Google Scholar] [CrossRef]
- Leite, S.B.; Teixeira, A.P.; Miranda, J.P.; Tostões, R.M.; Clemente, J.J.; Sousa, M.F.; Carrondo, M.J.T.; Alves, P.M. Merging bioreactor technology with 3D hepatocyte-fibroblast culturing approaches: Improved in vitro models for toxicological applications. Toxicol. Vitr. 2011, 25, 825–832. [Google Scholar] [CrossRef]
- Miranda, J.P.; Rodrigues, A.; Tostões, R.M.; Leite, S.; Zimmerman, H.; Carrondo, M.J.T.; Alves, P.M. Extending hepatocyte functionality for drug-testing applications using high-viscosity alginate-encapsulated three-dimensional cultures in bioreactors. Tissue Eng. Part. C Methods 2010, 16, 1223–1232. [Google Scholar] [CrossRef]
- Hoffmann, S.; Müller-Vieira, U.; Biemel, K.; Knobeloch, D.; Heydel, S.; Lübberstedt, M.; Nüssler, A.K.; Andersson, T.B.; Gerlach, J.C.; Zeilinger, K. Analysis of drug metabolism activities in a miniaturized liver cell bioreactor for use in pharmacological studies. Biotechnol. Bioeng. 2012, 109, 3172–3181. [Google Scholar] [CrossRef]
- Freyer, N.; Knöspel, F.; Strahl, N.; Amini, L.; Schrade, P.; Bachmann, S.; Damm, G.; Seehofer, D.; Jacobs, F.; Monshouwer, M.; et al. Hepatic Differentiation of Human Induced Pluripotent Stem Cells in a Perfused Three-Dimensional Multicompartment Bioreactor. Biores. Open Access 2016, 5, 235–248. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Loskill, P.; Marcus, S.G.; Mathur, A.; Reese, W.M.; Healy, K.E. μOrgano: A Lego®-Like Plug & Play System for Modular Multi-Organ-Chips. PLoS ONE 2015, 10, e0139587. [Google Scholar]
- Franzen, N.; van Harten, W.H.; Retèl, V.P.; Loskill, P.; van den Eijnden-van Raaij, J.; IJzerman, M. Impact of organ-on-a-chip technology on pharmaceutical R&D costs. Drug Discov. Today 2019, 24, 1720–1724. [Google Scholar] [PubMed]
- Jang, K.-J.; Otieno, M.A.; Ronxhi, J.; Lim, H.-K.; Ewart, L.; Kodella, K.R.; Petropolis, D.B.; Kulkarni, G.; Rubins, J.E.; Conegliano, D.; et al. Reproducing human and cross-species drug toxicities using a Liver-Chip. Sci. Transl. Med. 2019, 11. [Google Scholar] [CrossRef] [PubMed]
- Gröger, M.; Dinger, J.; Kiehntopf, M.; Peters, F.T.; Rauen, U.; Mosig, A.S. Preservation of Cell Structure, Metabolism, and Biotransformation Activity of Liver-On-Chip Organ Models by Hypothermic Storage. Adv. Healthc. Mater. 2018, 7, 1700616. [Google Scholar] [CrossRef]
- Li, N.; Schwartz, M.; Ionescu-zanetti, C. PDMS Compound Adsorption in Context. J. Biomol. Screen. 2009, 14, 194–202. [Google Scholar]
- Raasch, M.; Fritsche, E.; Kurtz, A.; Bauer, M.; Mosig, A.S. Microphysiological systems meet hiPSC technology – New tools for disease modeling of liver infections in basic research and drug development. Adv. Drug Deliv. Rev. 2019, 140, 51–67. [Google Scholar] [CrossRef]
- Leite, S.B.; Wilk-Zasadna, I.; Zaldivar, J.M.; Airola, E.; Reis-Fernandes, M.; Mennecozzi, M.; Guguen-Guillouzo, C.; Chesne, C.; Guillou, C.; Alves, P.M.; et al. Three-dimensional HepaRG model as an attractive tool for toxicity testing. Toxicol. Sci. 2012, 130, 106–116. [Google Scholar] [CrossRef] [Green Version]
- Lubberstedt, M.; Muller-Vieira, U.; Biemel, K.M.; Darnell, M.; Hoffmann, S.A.; Knospel, F.; Wonne, E.C.; Knobeloch, D.; Nussler, A.K.; Gerlach, J.C.; et al. Serum-free culture of primary human hepatocytes in a miniaturized hollow-fibre membrane bioreactor for pharmacological in vitro studies. J. Tissue Eng. Regen. Med. 2015. [Google Scholar] [CrossRef]
- Edington, C.D.; Chen, W.L.K.; Geishecker, E.; Kassis, T.; Soenksen, L.R.; Bhushan, B.M.; Freake, D.; Kirschner, J.; Maass, C.; Tsamandouras, N.; et al. Interconnected Microphysiological Systems for Quantitative Biology and Pharmacology Studies. Sci. Rep. 2018, 8, 1–18. [Google Scholar] [CrossRef] [Green Version]
- Kostadinova, R.; Boess, F.; Applegate, D.; Suter, L.; Weiser, T.; Singer, T.; Naughton, B.; Roth, A. A long-term three dimensional liver co-culture system for improved prediction of clinically relevant drug-induced hepatotoxicity. Toxicol. Appl. Pharmacol. 2013, 268, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Gunness, P.; Mueller, D.; Shevchenko, V.; Heinzle, E.; Ingelman-Sundberg, M.; Noor, F. 3D organotypic cultures of human HepaRG cells: A tool for in vitro toxicity studies. Toxicol. Sci. 2013, 133, 67–78. [Google Scholar] [CrossRef] [PubMed]
- Wrzesinski, K.; Fey, S.J. After trypsinisation, 3D spheroids of C3A hepatocytes need 18 days to re-establish similar levels of key physiological functions to those seen in the liver. Toxicol. Res. 2013, 2, 123–135. [Google Scholar] [CrossRef] [Green Version]
- Caixas, U.; Antunes, A.M.M.; Marinho, A.T.; Godinho, A.L.A.; Grilo, N.M.; Marques, M.M.; Oliveira, M.C.; Branco, T.; Monteiro, E.C.; Pereira, S.A. Evidence for nevirapine bioactivation in man: Searching for the first step in the mechanism of nevirapine toxicity. Toxicology 2012, 301, 33–39. [Google Scholar] [CrossRef]
- Antunes, A.M.M.; Godinho, A.L.A.; Martins, I.L.; Justino, G.C.; Beland, F.A.; Marques, M.M. Amino Acid Adduct Formation by the Nevirapine Metabolite, 12-Hydroxynevirapine—A Possible Factor in Nevirapine Toxicity. Chem. Res. Toxicol. 2010, 23, 888–899. [Google Scholar] [CrossRef]
- Fan-Havard, P.; Liu, Z.; Chou, M.; Ling, Y.; Barrail-Tran, A.; Haas, D.W.; Taburet, A.-M.; ANRS12154 Study Group. Pharmacokinetics of phase I nevirapine metabolites following a single dose and at steady state. Antimicrob. Agents Chemother. 2013, 57, 2154–2160. [Google Scholar] [CrossRef] [Green Version]
- Kim, S.G.; Lee, S.J. PI3K, RSK, and mTOR Signal Networks for the GST Gene Regulation. Toxicol. Sci. 2006, 96, 206–213. [Google Scholar] [CrossRef] [Green Version]
- Hall, D.B.; MacGregor, T.R. Case-Control Exploration of Relationships Between Early Rash or Liver Toxicity and Plasma Concentrations of Nevirapine and Primary Metabolites. HIV Clin. Trials 2007, 8, 391–399. [Google Scholar] [CrossRef]
- Marinho, A.T.; Godinho, A.L.A.; Novais, D.A.; Antunes, A.M.M.; Marques, M.M.; Ramos, T.; Dias, C.G.; Monteiro, E.C.; Pereira, S.A. Development and validation of an HPLC-UV method for quantifying nevirapine and its main phase I metabolites in human blood. Anal. Methods 2014, 6, 1575–1580. [Google Scholar] [CrossRef]
- Marinho, A.T.; Rodrigues, P.M.; Caixas, U.; Antunes, A.M.M.; Branco, T.; Harjivan, S.G.; Marques, M.M.; Monteiro, E.C.; Pereira, S.A. Differences in nevirapine biotransformation as a factor for its sex-dependent dimorphic profile of adverse drug reactions. J. Antimicrob. Chemother. 2014, 69, 476–482. [Google Scholar] [CrossRef] [Green Version]
- Allocati, N.; Masulli, M.; Di Ilio, C.; Federici, L. Glutathione transferases: Substrates, inihibitors and pro-drugs in cancer and neurodegenerative diseases. Oncogenesis 2018, 7, 8. [Google Scholar] [CrossRef] [PubMed]
- Dekker, S.J.; Zhang, Y.; Vos, J.C.; Vermeulen, N.P.E.; Commandeur, J.N.M. Different Reactive Metabolites of Nevirapine Require Distinct Glutathione S -Transferase Isoforms for Bioinactivation. Chem. Res. Toxicol. 2016, 29, 2136–2144. [Google Scholar] [CrossRef] [PubMed]
- Chan, J.C.Y.; Soh, A.C.K.; Kioh, D.Y.Q.; Li, J.; Verma, C.; Koh, S.K.; Beuerman, R.W.; Zhou, L.; Chan, E.C.Y. Reactive Metabolite-induced Protein Glutathionylation: A Potentially Novel Mechanism Underlying Acetaminophen Hepatotoxicity. Mol. Cell. Proteom. 2018, 17, 2034–2050. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, X.; Greenhaw, J.; Ali, A.; Shi, Q.; Roberts, D.W.; Hinson, J.A.; Muskhelishvili, L.; Beger, R.; Pence, L.M.; Ando, Y.; et al. Changes in mouse liver protein glutathionylation after acetaminophen exposure. J. Pharmacol. Exp. Ther. 2012, 340, 360–368. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liptrott, N.J.; Pushpakom, S.; Wyen, C.; Fätkenheuer, G.; Hoffmann, C.; Mauss, S.; Knechten, H.; Brockmeyer, N.H.; Hopper-Borge, E.; Siccardi, M.; et al. Association of ABCC10 polymorphisms with nevirapine plasma concentrations in the German Competence Network for HIV/AIDS. Pharmacogenet. Genom. 2012, 22, 10–19. [Google Scholar] [CrossRef] [Green Version]
- Lickteig, A.J.; Slitt, A.L.; Arkan, M.C.; Karin, M.; Cherrington, N.J. Differential Regulation of Hepatic Transporters in the Absence of Tumor Necrosis Factor-α, Interleukin-1β, Interleukin-6, and Nuclear Factor-κB in Two Models of Cholestasis. Drug Metab. Dispos. 2007, 35, 402–409. [Google Scholar] [CrossRef] [Green Version]
- Terelius, Y.; Figler, R.A.; Marukian, S.; Collado, M.S.; Lawson, M.J.; Mackey, A.J.; Manka, D.; Qualls, C.W.; Blackman, B.R.; Wamhoff, B.R.; et al. Transcriptional profiling suggests that Nevirapine and Ritonavir cause drug induced liver injury through distinct mechanisms in primary human hepatocytes. Chem. Biol. Interact. 2016, 255, 31–44. [Google Scholar] [CrossRef] [Green Version]
- Santos, J.M.; Camões, S.P.; Filipe, E.; Cipriano, M.; Barcia, R.N.; Filipe, M.; Teixeira, M.; Simões, S.; Gaspar, M.; Mosqueira, D.; et al. Three-dimensional spheroid cell culture of umbilical cord tissue-derived mesenchymal stromal cells leads to enhanced paracrine induction of wound healing. Stem Cell Res. Ther. 2015, 6, 90. [Google Scholar] [CrossRef] [Green Version]
- Mangiacasale, R.; Pittoggi, C.; Sciamanna, I.; Careddu, A.; Mattei, E.; Lorenzini, R.; Travaglini, L.; Landriscina, M.; Barone, C.; Nervi, C.; et al. Exposure of normal and transformed cells to nevirapine, a reverse transcriptase inhibitor, reduces cell growth and promotes differentiation. Oncogene 2003, 22, 2750–2761. [Google Scholar] [CrossRef] [Green Version]
- Pittoggi, C.; Martis, G.; Mastrangeli, G.; Mastrangeli, B.; Spadafora, C. In vitro evidence for a new therapeutic approach in renal cell carcinoma. Int. Braz J. Urol. 2008, 34, 492–502. [Google Scholar] [CrossRef] [Green Version]
- Thein, P.; Kalinec, G.M.; Park, C.; Kalinec, F. In Vitro Assessment of Antiretroviral Drugs Demonstrates Potential for Ototoxicity. Hear. Res. 2014, 310, 27–35. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Justino, G.C.; Santos, M.R.; Canário, S.; Borges, C.; Florêncio, M.H.; Mira, L. Plasma quercetin metabolites: Structure-antioxidant activity relationships. Arch. Biochem. Biophys. 2004, 432, 109–121. [Google Scholar] [CrossRef] [PubMed]
- Babu, S.R.; Lakshmi, V.M.; Huang, G.P.-W.; Zenser, T.V.; Davis, B.B. Glucuronide conjugates of 4-aminobiphenyl and its N-hydroxy metabolites. Biochem. Pharmacol. 1996, 51, 1679–1685. [Google Scholar] [CrossRef]
- Spandidos, A.; Wang, X.; Wang, H.; Seed, B. PrimerBank: A resource of human and mouse PCR primer pairs for gene expression detection and quantification. Nucleic Acids Res. 2010, 38, D792–D799. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wilkening, S.; Bader, A. Differential regulation of CYP3A4 and CYP3A7 by dimethylsulfoxide in primary human hepatocytes. Basic Clin. Pharmacol. Toxicol. 2004, 95, 92–93. [Google Scholar] [CrossRef] [PubMed]
- Anthérieu, S.; Chesné, C.; Li, R.; Camus, S.; Lahoz, A.; Picazo, L.; Turpeinen, M.; Tolonen, A.; Uusitalo, J.; Guguen-Guillouzo, C.; et al. Stable Expression, Activity, and Inducibility of Cytochromes P450 in Differentiated HepaRG Cells. Drug Metab. Dispos. 2010, 38, 516–525. [Google Scholar] [CrossRef]
- Grilo, N.M.; João Correia, M.; Miranda, J.P.; Cipriano, M.; Serpa, J.; Matilde Marques, M.; Monteiro, E.C.; Antunes, A.M.M.; Diogo, L.N.; Pereira, S.A. Unmasking efavirenz neurotoxicity: Time matters to the underlying mechanisms. Eur. J. Pharm. Sci. 2017, 105, 47–54. [Google Scholar] [CrossRef]
Endpoint a | 3D-HLC (NVP Treated/ Non-Treated) | 2D-HLC (NVP Treated/ Non-Treated) | 3D-HLC/ 2D-HLC (NVP Treated) | ||
---|---|---|---|---|---|
Gene expression | Phase I | CYP3A4 | + | + | + |
CYP2B6 | +++ | unchanged | +++ | ||
CYP2D6 | + | + | + | ||
Phase II | SULT1A1 | + | unchanged | ++ | |
UGT1A1 | + | unchanged | +++ | ||
GSTA1-A2 | + | unchanged | ++ | ||
Phase III | MRP7 | + | unchanged | ++ | |
Enzymatic activity | Phase I | ECOD | ++ | unchanged | + |
CYP3A4 | unchanged | unchanged | unchanged | ||
Phase II | UGTs | unchanged | unchanged | + | |
SULT1A1 | unchanged | unchanged | unchanged | ||
NVP metabolites b | Phase I | 2-OH-NVP | detected | detected | + |
(CYP3A4) | |||||
12-OH-NVP | detected | detected | + | ||
(CYP3A4/2D6/2C9) | |||||
3-OH-NVP | detected | detected | ++ | ||
(CYP2B6) | |||||
8-OH-NVP | detected | detected | unchanged | ||
(CYP3A4/2D6/2C9) | |||||
Phase II | Sulfate conjugates | detected | detected | ++ | |
Glucuronic acid conjugates | detected | not detected | +++ | ||
Glutathiolomic profile | GSH synthesis | residual | residual | + | |
GSH catabolism | + | ++ | − |
Study Type | Sample | 2-OH-NVP * | 12-OH-NVP * | 3-OH-NVP * | 8-OH-NVP * | Ref. |
---|---|---|---|---|---|---|
Clinical, 2 weeks of NVP treatment | Human plasma | 13 | 43 | 39 | 2.0 | [40] |
Clinical, 4 weeks of NVP treatment | Human plasma | 15 | 43 | 42 | 2.0 | [40] |
Clinical, Steady state NVP treatment | Human urine | 23 | 33 | 33 | 1.0 | [14] |
Clinical, Steady state NVP treatment | Human plasma | 13 | 80 | 6.0 | 0.0 | [41] |
Clinical, Steady state NVP treatment | Human plasma | 16 | 75 | 7.0 | 2.0 | [42] |
Clinical, Single Dose NVP treatment | Human plasma | 32 | 52 | 16 | 0.0 | [38] |
Clinical, Steady state NVP treatment | Human plasma | 5 | 51 | 9 | 35 | [38] |
In vitro, spheroids of freshly isolated rat primary hepatocytes, exposed to NVP for 11 days | Cell culture supernatant of rat hepatocytes | 25 | 57 | 18 | 0.0 | [6] |
In vitro, human cryopreserved microsomal preparations | Microsomes, reaction buffer | 39 | 27 | 27 | 7.0 | [16] |
In vitro, HLC spheroids exposed to NVP for 10 days | Human cell culture supernatant | 60 | 28 | 10 | 2.0 | Present study |
Primers | Reference | |
---|---|---|
ACTB_F | CATGTACGTTGCTATCCAGGC | PrimerBank ID 4501885a1 [56] |
ACTB_R | CTCCTTAATGTCACGCACGAT | |
CYP3A4_F | ATTCAGCAAGAAGAACAAGGACA | [57] |
CYP3A4_R | TGGTGTTCTCAGGCACAGAT | |
CYP2B6_F | TTCCTACTGCTTCCGTCTATCAAA | [58] |
CYP2B6_R | GTGCAGAATCCCACAGCTCA | |
CYP2D6_F | TGGCAAGGTCCTACGCTTC | [58] |
CYP2D6_R | GCCACCACTATGCACAGGTT | |
SULT1A1_F | CGGCACTACCTGGGTAAGC | PrimerBank ID: 29540539a1 [56] |
SULT1A1_R | CACCCGCATGAAGATGGGAG | |
UGT1A1_F | TGACGCCTCGTTGTACATCAG | [58] |
UGT1A1_R | CCTCCCTTTGGAATGGCAC | |
GSTA1-A2_F | TGCAACAATTAAGTGCTTTACCTAAGTG | [58] |
GSTA1-A2_R | TTAACTAAGTGGGTGAATAGGAGTTGTATT | |
MRP7_F | TGGCACATTCCCCTCATGG | [58] |
MRP7_R | CCACAACACGGTCAGCACTA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cipriano, M.; Pinheiro, P.F.; Sequeira, C.O.; Rodrigues, J.S.; Oliveira, N.G.; Antunes, A.M.M.; Castro, M.; Marques, M.M.; Pereira, S.A.; Miranda, J.P. Nevirapine Biotransformation Insights: An Integrated In Vitro Approach Unveils the Biocompetence and Glutathiolomic Profile of a Human Hepatocyte-Like Cell 3D Model. Int. J. Mol. Sci. 2020, 21, 3998. https://doi.org/10.3390/ijms21113998
Cipriano M, Pinheiro PF, Sequeira CO, Rodrigues JS, Oliveira NG, Antunes AMM, Castro M, Marques MM, Pereira SA, Miranda JP. Nevirapine Biotransformation Insights: An Integrated In Vitro Approach Unveils the Biocompetence and Glutathiolomic Profile of a Human Hepatocyte-Like Cell 3D Model. International Journal of Molecular Sciences. 2020; 21(11):3998. https://doi.org/10.3390/ijms21113998
Chicago/Turabian StyleCipriano, Madalena, Pedro F Pinheiro, Catarina O Sequeira, Joana S Rodrigues, Nuno G Oliveira, Alexandra M M Antunes, Matilde Castro, M Matilde Marques, Sofia A Pereira, and Joana P Miranda. 2020. "Nevirapine Biotransformation Insights: An Integrated In Vitro Approach Unveils the Biocompetence and Glutathiolomic Profile of a Human Hepatocyte-Like Cell 3D Model" International Journal of Molecular Sciences 21, no. 11: 3998. https://doi.org/10.3390/ijms21113998