Next Article in Journal
Maintenance of Kidney Metabolic Homeostasis by PPAR Gamma
Next Article in Special Issue
Transcriptome Analyses in Different Cucumber Cultivars Provide Novel Insights into Drought Stress Responses
Previous Article in Journal
A Non-Enzymatic Method to Obtain a Fat Tissue Derivative Highly Enriched in Adipose Stem Cells (ASCs) from Human Lipoaspirates: Preliminary Results
Previous Article in Special Issue
Isolation and Characterization of a Green-Tissue Promoter from Common Wild Rice (Oryza rufipogon Griff.)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 19
Issue 7
10.3390/ijms19072062
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Chrysanthemum DgWRKY2 Gene Enhances Tolerance to Salt Stress in Transgenic Chrysanthemum

by
Ling He
,
Yin-Huan Wu
,
Qian Zhao
,
Bei Wang
,
Qing-Lin Liu
* and
Lei Zhang
Department of Ornamental Horticulture, Sichuan Agricultural University, 211 Huimin Road, Wenjiang District, Chengdu 611130, Sichuan, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2018, 19(7), 2062; https://doi.org/10.3390/ijms19072062
Submission received: 22 May 2018 / Revised: 2 July 2018 / Accepted: 10 July 2018 / Published: 16 July 2018
(This article belongs to the Special Issue Plant Genetics and Molecular Breeding)
Browse Figures
Versions Notes

Abstract

:
WRKY transcription factors (TFs) play a vital part in coping with different stresses. In this study, DgWRKY2 was isolated from Dendranthema grandiflorum. The gene encodes a 325 amino acid protein, belonging to the group II WRKY family, and contains one typical WRKY domain (WRKYGQK) and a zinc finger motif (C-X4-5-C-X22-23-H-X1-H). Overexpression of DgWRKY2 in chrysanthemum enhanced tolerance to high-salt stress compared to the wild type (WT). In addition, the activities of antioxidant enzymes (superoxide dismutase (SOD), peroxidase (POD), catalase (CAT)), proline content, soluble sugar content, soluble protein content, and chlorophyll content of transgenic chrysanthemum, as well as the survival rate of the transgenic lines, were on average higher than that of the WT. On the contrary, hydrogen peroxide (H2O2), superoxide anion (O2−), and malondialdehyde (MDA) accumulation decreased compared to WT. Expression of the stress-related genes DgCAT, DgAPX, DgZnSOD, DgP5CS, DgDREB1A, and DgDREB2A was increased in the DgWRKY2 transgenic chrysanthemum compared with their expression in the WT. In conclusion, our results indicate that DgWRKY2 confers salt tolerance to transgenic chrysanthemum by enhancing antioxidant and osmotic adjustment. Therefore, this study suggests that DgWRKY2 could be used as a reserve gene for salt-tolerant plant breeding.

1. Introduction

High-salt stress is one of the most important factors that seriously affects and inhibits the growth and yield of plants [1]. Environmental stresses affect plant growth, causing plants to evolve mechanisms to face these challenges [2]. Under salt stress, transcription factors (TFs) can regulate the expression of multiple stress-related genes, which enhance tolerance to salt compared with the activity of a functional gene [3]. These genes are involved in the salt stress response in plants, forming a complex regulatory network [4]. Therefore, by using transcription factors, the plants’ resistance can be improved.
WRKYs are a massive TF family, dominating the genetic transcription of plants. WRKY was named after the highly conserved sequence motif WRKYGQK. The WRKY proteins are divided into 3 types: class I contains two conserved WRKY domains and a zinc finger structure C-X4-5-C-X22-23-H-X1-H; class II contains one conserved WRKY domain and the same zinc finger structure, and most of the WRKY proteins found to date are this type; there is one conserved domain in class III, the zinc finger structure C-X7-C-X22-23-H-X1-C [5]. Overexpression of genes is a commonly used method to study gene function. Many studies had shown that WRKY TFs played a vital role in the physiological processes of plants [6,7,8,9]. It has also been proved that overexpression of some WRKY genes successfully increase plant tolerance to abiotic stress. TaWRKY93 may increase salinity tolerance by enhancing osmotic adjustment, maintaining membrane stability, and increasing transcription of stress-related genes [10]. During salt treatment, NbWRKY79 enhanced the tolerance of the transgenic plants to oxidant stress. Therefore, it increased the salt tolerance of Nicotiana benthamiana [11]. RtWRKY1 conferred tolerance to salt stress in transgenic Arabidopsis by regulating plant growth, osmotic balance, Na+/K+ homeostasis, and the antioxidant system [12]. VvWRKY30 increased salt resistance by regulating reactive oxygen species (ROS)-scavenging activity and the accumulation of osmoticum [13].
Physiological traits are important indicative indexes of botanical abiotic resistance. Plants produce ROS in the body under environmental pressures, including accumulation of superoxide anions (O2−), hydroxyl ions (OH−), hydroxyl radicals (-OH), hydrogen peroxide (H2O2), and other types. These species not only lead to membrane lipid peroxidation of plant cells, affecting the redox state of the protein, but also cause oxidative damage to nucleic acids [14]. The plant antioxidant defense system consists of a variety of enzymes (superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), ascorbate peroxidase (APX), etc.), which act as active oxygen scavengers in plants [15]. Much evidence has shown that the production and removal of ROS are closely related to the mechanism of salt tolerance [16,17]. As penetrating agents, soluble sugar, soluble protein, and proline maintain osmotic balance together. Under salt stress, transcription factors may participate in the regulation of the expression of many salt tolerance-related functional genes, so as to obtain stronger stress resistance than can be imparted by functional genes. The key genes encoding antioxidant enzymes (Cu/ZnSOD, CAT, APX, etc.) can increase the efficiency of ROS elimination in plant cells, so much so that the plant’s tolerance to abiotic stresses is improved [18,19,20]. The proline synthase gene (P5CS) can effectively increase the tolerance of transgenic plants to osmotic stress [21]. The DREB (dehydration-responsive element binding proteins) transcription factor can specifically bind to the DRE cis-acting element or the core sequence with the DRE element (CCGAC), regulate the expression of stress-related genes, and mediate the transmission of abiotic stress signals [22,23,24,25].
Chrysanthemums are cut flower with high economic benefits and appreciable value, but it is sensitive to salinity, which can cause slow growth, plant chlorosis, and even death [26]. In a previous study, we obtained a database of the chrysanthemum transcriptome in response to salinity conditions by using high-throughput sequencing [27]. A large number of salt-induced transcripts were found in the data, especially from the WRKY family. Previously, we identified four WRKY genes (DgWRKY1, DgWRKY3, DgWRKY4, and DgWRKY5) and demonstrated that they can increase the salt tolerance of tobacco or chrysanthemum [28,29,30,31]. In order to analyze the WRKY family in chrysanthemum from multiple angles to complement our information, the salt stress-related gene DgWRKY2 was isolated from chrysanthemum. This study investigated the importance of DgWRKY2 as a transcription regulator under salt stress.

2. Results

2.1. Isolation and Characterization of DgWRKY2

DgWRKY2 contained a complete open reading frame of 1107 bp, which encoded a protein of 325 amino acids with a calculated molecular mass of 36.55 kDa. The theoretical isoelectric point is PI = 6.66 (Figure 1). Multi-sequence alignment analysis of the amino acid sequences of DgWRKY2 and eight other genes showed that DgWRKY2 contains a WRKY domain and a zinc finger structure (C-X4-5-C-X22-23-H-X1-H). It was further confirmed that the cloned cDNA sequence was a WRKY transcription factor II family member (Figure 2). Phylogenetic analysis showed that DgWRKY2 is most closely related to AtWRKY28 from Arabidopsis thaliana (Figure 3).

2.2. Salt-Tolerance Analysis of DgWRKY2 Transgenic Chrysanthemum

To determine whether DgWRKY2 overexpression enhanced salt tolerance, chrysanthemum transgenic lines with overexpressed DgWRKY2 were produced by Agrobacterium-mediated transformation. DgWRKY2 transcription levels in up in five transgenic lines (OE-3, OE-11, OE-17, OE-21 and OE-24) were detected by qRT-PCR (Figure 4A). We compared the salt stress tolerance between OE-17 and OE-21 transgenic chrysanthemum and the WT. Under normal growth conditions, the phenotypic differences were not significant. The growth rate was consistent. By contrast, under salt stress, wilting and yellowing of leaves of the WT plants were evident (Figure 4B). After the recovery period (2 weeks), the survival rate in the WT was 40.23%, while the survival rates in transgenic lines OE-17 and OE-21 were 79.07% and 82.60%, respectively (Figure 4C). The survival rate of transgenic chrysanthemums was significantly higher than that of the WT.

2.3. Analysis of Chlorophyll Content and under Salt Stress

Salt stress significantly inhibited plant photosynthesis [32]. The content of chlorophyll in the leaves of the WT decreased obviously at the 10th day, while reaching the minimum value at the 15th day. However, the chlorophyll content from the transgenic chrysanthemum lines OE-17 and OE-21 increased significantly, by 35% and 33% at the 5th day, and decreased gradually later on. In general, the decrease of chlorophyll content in transgenic chrysanthemum is lower than that of the WT (Figure 4D).

2.4. Accumulation of H2O2, O2−, and MDA in DgWRKY2 Transgenic Chrysanthemum under Salt Stress

Reactive oxygen species in plant cells have a strong toxic effect. In order to study the effect of transgenic lines on the scavenging of reactive oxygen species, H2O2 and O2− in different lines were investigated with DAB and NBT staining. Under normal circumstances, there was no significant difference in H2O2 and O2− between the WT and two transgenic lines. After treatment with salt stress, the H2O2 content in each line increased significantly (Figure 5A,B). The contents of O2− showed an upward trend with the increase of stress time (Figure 5C,D), but it was not as obvious as that of H2O2. Under salt stress, despite the rising trend, the accumulation of H2O2 and O2− in the transgenic lines was much lower than that of the WT. These results indicate that the overexpression of DgWRKY2 might regulate the activity of antioxidant protective enzymes, conferring greater tolerance to salt stress in transgenic plants. Similarly, under salt stress, the MDA accumulation level of overexpressed lines was apparently lower than that of the WT (Figure 5E). In all, these results provided strong evidence that the accumulation of ROS in DgWRKY2 overexpression chrysanthemum was lower than that of WT under salt stress. Thus, DgWRKY2 overexpression reduced the ROS level and alleviated the oxidant damage under salt stress.

2.5. Physiological Changes in DgWRKY2 Transgenic Chrysanthemum

Antioxidant enzymes play an important part in botanical stress tolerance. We observed activities of SOD, POD, and CAT in the leaves of DgWRKY2 lines and WT plants at different stages of treatment. Under normal growth conditions, the activities of these three enzymes had no obvious differences in any of the lines. Under salt treatment conditions, there was an increase in the WT and overexpressed lines. Moreover, compared with WT, these increases were extraordinarily greater in the overexpressed lines (Figure 6A–C). As a result, overexpression of DgWRKY2 increases the antioxidant enzyme activity of transgenic chrysanthemum to counteract injury from ROS. Thus, this reduced oxidative damage.
Osmotic adjustment is one of the most basic characteristics of plant salt tolerance, while proline is the most widely distributed compatible penetrant [33,34]. Under salt stress, we measured the proline content of transgenic lines and the WT in order to understand the osmoregulation ability of transgenic plants (Figure 7A). There was little difference in proline content between transgenic lines and WT under normal circumstances. By contrast, under salt stress, there was a remarkable increase in proline content for both. Nevertheless, the accumulation of proline in the transgenic lines was significantly higher than that of the WT under salt stress. These results indicate that DgWRKY2 upregulated the accumulation of proline in the transgenic lines under salt stress.
Soluble proteins keep cells appropriately permeable and protect cells from dehydration, while stabilizing and protecting the structure and function of biological macromolecules [35]. We observed the content of soluble protein and of soluble sugar of these three lines under salt stress. In this environment, soluble protein and soluble sugar content of overexpressed lines increased significantly compared with the WT. (Figure 7B,C). The above data suggest that overexpression of DgWRKY2 enhanced the osmoregulation ability of transgenic chrysanthemum while it increased its salt tolerance.

2.6. Expression of Abiotic Stress-Related Genes in DgWRKY2 Transformed Chrysanthemum

In order to reveal the signal regulatory network of transgenic lines in the stress resistance process, we measured the expression of several functional genes involved in signal transduction pathways by qRT-PCR. Under standard circumstances, there was little difference in the expression of abiotic stress-response genes. When exposed to salt stress, the expression level of the gene encoding ROS-scavenging enzymes (CAT, APX, and Cu/ZnSOD) in the transgenic lines was much higher than in the WT (Figure 8A–C). Additionally, P5CS, a gene related to proline synthase, showed an expression level with a similar trend (Figure 8D). Furthermore, other genes, such as DREB1A and DREB2A, that are closely related to plant responses to environmental stresses, were all significantly upregulated in the overexpressed lines compared to the WT under salinity conditions (Figure 8E,F). Our data suggest that DgWRKY2 overexpression could reduce osmotic pressure by clearing excess ROS and accumulating proline, thereby promoting salt tolerance.

3. Discussion

To date, the WRKY gene has been cloned from Arabidopsis thaliana [36], wheat [37,38], rice [39], soybean [40], chrysanthemum [28,29], birch [41], and other plants. It was confirmed that the WRKY gene is related to plant stress resistance. We isolated a new WRKY transcription factor—DgWRKY2—from chrysanthemum, and found it to be induced by salt stress. The deduced amino acid sequence of the DgWRKY2 gene from this study contains one WRKY domain (WRKYGQK) and a zinc finger structure (C-X4-5-C-X22-23-H-X1-H), which could be considered part of the group II WRKY family.
The same group of WRKY proteins might have similar capabilities. Previous studies have shown that GmWRKY54 might improve the salt and cold tolerance of plants through the regulation of DREB2A and STZ/Zat10 [40]. OsWRKY11 overexpression increased rice drought tolerance [42]. The expression of AtWRKY28 changed significantly under NaCl stress, indicating that AtWRKY28 had much to do with adaptation to environmental stress [43]. In our previous study, an overexpression DgWRKY1 tobacco line was more tolerant to salt stress than the WT [28]. DgWRKY2 belongs to group II with GmWRKY54, OsWRKY11, AtWRKY28, and DgWRKY1, thus, we hypothesized that DgWRKY2 has a positive effect on salt tolerance. In addition, the previous studies demonstrated that DgWRKY3, DgWRKY4, and DgWRKY5 also played a positive regulatory role on salt stress [29,30,31]. DgWRKY1 and DgWRKY3 were only studied for their role in salt tolerance in tobacco, and the salt tolerance in chrysanthemum has yet to be studied. Previous studies have confirmed that DgWRKY4 and DgWRKY5 belong to the group III, and DgWRKY2 in this study belongs to group II. The results of these studies showed that DgWRKY4 and DgWRKY5 imparted stronger salt tolerance than DgWRKY2. This is partly due to different groups playing different roles in the stress regulatory network. Additional work is needed to understand the mechanisms.
In this study, the DgWRKY2 overexpression transgenic chrysanthemum was compared with the WT from physiological and biochemical aspects, and the function of DgWRKY2 overexpression was verified. Chlorophyll content in chrysanthemum leaves continued to decrease in the late stage of salt stress. We speculated that ROS inhibited the photosynthesis of chrysanthemum [44]. However, chlorophyll content in the overexpressed lines was higher than that of the WT at respectively different salt stress stages. Increased ROS activity causes a great deal of physiological and metabolic changes in plants, enabling them to cope with environmental stress. In CmWRKY17-overexpressing plants, CmWRKY17 altered the salinity sensitivity via regulation of ROS levels [45]. NbWRKY79 was involved with the regulation of SOD, POD, CAT, and APX activities, which resulted in the suppression of ROS accumulation so that the plant could endure less oxidative damage under salt conditions [11]. MsWRKY11 might reduce ROS levels and thus increase salt tolerance in soybean [46]. The activity of antioxidant enzymes SOD, POD, and CAT in DgWRKY2 overexpression lines increased, and the activity of the enzymes was significantly higher than that of the WT at each stage of salt treatment. Moreover, the content of H2O2 and O2− in transgenic chrysanthemum leaves was also lower than that of WT. The above results indicate that DgWRKY2 overexpression could enhance plant antioxidant capacity by increasing the activities of SOD, POD, and CAT, thereby enhancing the salt tolerance of transgenic chrysanthemum.
Accumulation of MDA content can lead to membrane lipid peroxidation of plant cells, causing changes in the cell membrane structure and permeability, reducing cell function [47]. In contrast, proline prevents membrane lipid peroxidation, maintains normal cellular structure, and maintains a stable cell osmotic pressure [48]. Under salt treatment, compared with the WT, MDA content of the overexpressed lines was lower, but proline content was higher. The contents of soluble sugar and soluble protein in DgWRKY2 overexpression lines were higher than those of WT. The results suggest that DgWRKY2 might increase its salt tolerance by regulating the osmotic pressure of plant cells.
The expression of antioxidant genes (Cu/ZnSOD, CAT, and APX) was upregulated under salinity, which is consistent with physiological results. Under salt stress, the expression of antioxidant enzyme genes was significantly higher in RtWRKY1-overexpressed Arabidopsis than in the wild type [12]. The P5CS gene is associated with a proline-synthesizing enzyme in plants. When the expression of the P5CS gene was induced by environmental stress, the proline content in plants increased. Under salt stress, the expression of genes related to proline biosynthesis was upregulated in VvWRKY30 transgenic lines compared with their expression in the WT [13]. These results show that transgenic plants exhibited increased expression levels of P5CS under stress conditions. The DREB gene belongs to the AP2/EREBP transcription factor family. These TFs are closely related to the response of plants to the environment [49,50]. In this study, DREB1A was upregulated to a greater extent in overexpressed lines than in WT, and DREB2A first increased and later decreased. Previous studies indicated that OsDREB2A might participate in abiotic stress by directly binding the DREB element to regulate the expression of downstream genes. Overexpression of OsDREB2A in soybean might be used to improve its tolerance to salt stress [51]. Cong found that overexpression of the OjDREB gene improved salt tolerance in tobacco plant [52]. These results suggest that enhanced salt tolerance was associated with the induction of downstream stress-related gene expression in DgWRKY2 transgenic plants.

4. Materials and Methods

4.1. Plant Materials

The experimental material used for treatment is a wild-type chrysanthemum: Dendranthema grandiforum—‘Jinba’. All plant materials were provided by Sichuan Agricultural University, Chengdu, China. Chrysanthemum seedlings grew on MS culture medium (200 μL m−2 s−1, 16 h photoperiod, 25 °C/22 °C day/night temperature, and 70% relative humidity) for 20 days. Then, 20-day-old seedlings were planted in basins filled with a 1:1 mixture of peat and perlite, incubated for 3 days, and watered once daily (70% of field capacity). Seedlings at the six-leaf stage were harvested, frozen in liquid nitrogen immediately, and stored at −80 °C for RNA extraction.

4.2. Cloning of DgWRKY2 and Sequence Analysis

The RNA extraction of chrysanthemum leaves was performed by TRNzol reagent (Mylab, Beijing, China). The full-length cDNA of the DgWRKY2 sequence was obtained by PCR (polymerase chain reaction) utilizing gene-specific primers (Table 1). The RACE reactions were carried out according to the manufacturer’s protocol (Invitrogen RACE cDNA amplification kit, Clontech, Mountain View, CA, USA). The fragment generated was cloned into pEASY-T1 Cloning Kit (Transgene Biotech, Beijing, China) and sequenced.
The sequence of DgWRKY2 was analyzed by the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov/gorf/gorf.html) to obtain its open reading frame (ORF). Identification of protein domains and significant sites was performed with Motifscan (http://myhits.isb-sib.ch/cgi-bin/motif_scan). The phylogenetic tree was drawn with the MEGA 5.0 program (Sudhir Kumar, Arizona State University, Tempe, AZ, USA) using the neighbor-joining method.

4.3. Generation of Transgenic Chrysanthemum

The pEASY-WRKY2 cloning vector was constructed by TA cloning technology (The complementarity between the vector 3′-T overhangs and PCR product 3′-A overhangs allows direct ligation of Taq-amplified PCR products into the T-vector). The plasmid containing the pEASY-WRKY2 and pBI121 expression vectors were double digested with SacI and XbaI to construct the pBI121-DgWRKY2 expression vector. The fused construction of pBI121-DgWRKY2 was transformed into the leaf disk of chrysanthemum by Agrobacterium tumefaciens (strain LBA4404) [53]. Callus induction from chrysanthemum was used to form seedlings [54]. The obtained DgWRKY2 transgenic chrysanthemum lines (OE-17 and OE-21) were employed in subsequent experiments. The transgenic lines OE-17 and OE-21 were expanded for subsequent replication experiments.

4.4. Expression of DgWRKY2 under Salt Treatment

The method of RNA extraction is the same as above. Then RNA was used for first-strand cDNA synthesis with reverse transcriptase (TransScript II All-in-one First-Strand cDNA Synthesis SuperMix for PCR, Transgene, Beijing, China) according to the manufacturer’s protocol. Quantitative real-time PCR (qRT-PCR) was performed by SsoFast EvaGreen supermix (Bio-Rad, Hercules, CA, USA) and Bio-Rad CFX96TM detection system. The gene elongation factor 1α (EF1α) was used as a reference for quantitative expression analysis. A final 20 μL qPCR reaction mixture contained: 10 μL SsoFast EvaGreen supermix, 2 μL diluted cDNA sample, and 300 nM primers. Then, the reactions were incubated following the standard process: 1 cycle of 95 °C for 30 s, 40 cycles of 15 s at 95 °C and 30 s at 60 °C, and a single melting cycle from 65 to 95 °C. To avoid experimental errors, each reaction was repeated at least three times. To avoid variables and statistic error, a negative control group was set up, in which water supplanted the above solution. Relative expression levels were calculated by the 2−ΔΔCt method [55].

4.5. Salt Treatment of Transgenic Chrysanthemum and Stress Tolerance Assays

Two overexpressed lines (OE-17 and OE-21) and the WT of chrysanthemum, all 20 days old, were sown into a 1:1 mixture of peat and perlite, then cultured in a light incubator (200 μL m−2 s−1, 16 h photoperiod, 25 °C/22 °C day/night temperature, and 70% relative humidity). Soil-grown chrysanthemum seedlings at the six-leaf stage were irrigated with an increasing concentration of NaCl solution: 100 mm for 1–5 days (d), 200 mm for 6–10 days, and 400 mm for 11–15 days, using Chen as a reference [56]. Under salt stress, leaves 4–5 were harvested at 0, 5, 10, and 15 days for both physiological and molecular experiments. After a 2-week recovery, the surviving plants were collected to calculate the survival rate.

4.6. Determination of Physiological Indexes of Transgenic Chrysanthemum under Salt Stress

Activities of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) were measured according to Li [57]. Malondialdehyde (MDA) content in chrysanthemum was measured according to Zhang [58]. Accumulation of proline, soluble sugar, and soluble protein was measured according to Sun [59]. The chlorophyll content was detected according to Jin [60].

4.7. Histochemical Detection of Reactive Oxygen Species (ROS)

Nitroblue tetrazolium (NBT) and diaminobenzidine (DAB) staining was measured according to Shi [61]. The standard steps were as follows: chrysanthemum leaves were completely immersed in 10 mm phosphate buffer (pH = 7.8) containing 1 mg/mL NBT or DAB at room temperature. The leaves were not placed in 95% ethanol for decolorization until the spots appeared. After that, the sample was observed, and photos of the sample were taken. Finally, H2O2 and O2− concentration were determined by detection kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).

4.8. Expression of Salt Stress Response Genes in Dgwrky2 Transgenic Chrysanthemum

To evaluate the expression of abiotic stress-related genes, RNA from the WT and transgenic lines was extracted for reverse transcription. Transgenic chrysanthemum stress-responsive gene expression was detected by qRT-PCR. The abiotic stress-response genes monitored were Cu/ZnSOD, CAT, APX, P5CS, DREB1A, and DREB2A. All relevant primers used in the study are listed in Table 1.

4.9. Statistical Analysis

All experiments were performed three times for biological repetition to avoid all types of error. All data were analyzed by SPSS version 24.0 (International Business Machines Corporation, Armonk, NY, USA). A one-way analysis of variance, Tukey’s multiple range test (p < 0.05), was employed to identify the treatment means to avoid static errors.

5. Conclusions

In summary, this study demonstrated that DgWRKY2 could positively regulate salt stress tolerance. To alleviate the damage of salt stress to plants, DgWRKY2 overexpression improved expression of stress-related genes, resulting in relatively enhanced photosynthetic capacity, greatly increased activities of antioxidant enzymes, and high accumulation of proline, soluble sugar, and soluble protein. This indicates that DgWRKY2 may enhance the sensitivity to salinity by enabling antioxidant and osmotic adjustment capabilities. Overall, this study identified DgWRKY2 as a potential genetic resource for plant salt tolerance. Not only did DgWRKY2 play an important role in supplementing and perfecting chrysanthemum-tolerant germplasm resources, but it could also be used as a reserved gene for salt-tolerant plant breeding.

Author Contributions

L.H., Y.-H.W. and Q.-L.L. conceived and designed the experiments. L.H., Y.-H.W., B.W., Q.-L.L. and Q.Z. performed the experiments. L.Z. and L.H. analyzed the data. L.H. wrote the paper. All authors read and approved the manuscript.

Funding

This research was funded by National Natural Science Foundation of China grant number 31770742.

Acknowledgments

This study was supported by Sichuan Agricultural University Ornamental Horticulture lab. We would like to acknowledge the contribution of Qing-Lin Liu for the provision of experimental materials and instruments.

Conflicts of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Jamil, A.; Riaz, S.; Ashraf, M.; Foolad, M.R. Gene Expression Profiling of Plants under Salt Stress. Crit. Rev. Plant Sci. 2011, 30, 435–458. [Google Scholar] [CrossRef]
  2. Munns, R. Comparative physiology of salt and water stress. Plant Cell Environ. 2002, 25, 239–250. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Bing, L.; Zhao, B.C.; Shen, Y.Z.; Huang, Z.J.; Ge, R.C. Progress of Study on Salt Tolerance and Salt Tolerant Related Genes in Plant. J. Hebei Norm. Univ. 2008, 2, 243–248. [Google Scholar]
  4. Tuteja, N. Mechanisms of high salinity tolerance in plants. Methods Enzymol. 2007, 428, 419–438. [Google Scholar] [CrossRef] [PubMed]
  5. Eulgem, T.; Rushton, P.J.; Robatzek, S.; Somssich, I.E. The WRKY superfamily of plant transcription factors. Trends Plant Sci. 2000, 5, 199–206. [Google Scholar] [CrossRef]
  6. Zhang, Y.; Yu, H.; Yang, X.; Li, Q.; Ling, J.; Wang, H.; Gu, X.; Huang, S.; Jiang, W. CsWRKY46, a WRKY transcription factor from cucumber, confers cold resistance in transgenic-plant by regulating a set of cold-stress responsive genes in an ABA-dependent manner. Plant Physiol. Biochem. 2016, 108, 478. [Google Scholar] [CrossRef] [PubMed]
  7. Bakshi, M.; Oelmüller, R. WRKY transcription factors: Jack of many trades in plants. Plant Signal. Behav. 2014, 9, e27700. [Google Scholar] [CrossRef] [PubMed]
  8. Tripathi, P.; Rabara, R.C.; Rushton, P.J. A systems biology perspective on the role of WRKY transcription factors in drought responses in plants. Planta 2014, 239, 255–266. [Google Scholar] [CrossRef] [PubMed]
  9. Guo, Y.; Cai, Z.; Gan, S. Transcriptome of Arabidopsis leaf senescence. Plant Cell Environ. 2004, 27, 521–549. [Google Scholar] [CrossRef] [Green Version]
  10. Qin, Y.; Tian, Y.; Liu, X. A wheat salinity-induced WRKY transcription factor TaWRKY93 confers multiple abiotic stress tolerance in Arabidopsis thaliana. Biochem. Biophys. Res. Commun. 2015, 464, 428. [Google Scholar] [CrossRef] [PubMed]
  11. Nam, T.N.; Le, H.T.; Mai, D.S.; Tuan, N.V. Overexpression of NbWRKY79, enhances salt stress tolerance in Nicotiana benthamiana. Acta Physiol. Plant. 2017, 39, 121. [Google Scholar] [CrossRef]
  12. Du, C.; Zhao, P.; Zhang, H.; Li, N.; Zheng, L.; Wang, Y. The Reaumuria trigyna transcription factor RtWRKY1 confers tolerance to salt stress in transgenic Arabidopsis. J. Plant Physiol. 2017, 215, 48–58. [Google Scholar] [CrossRef] [PubMed]
  13. Zhu, D.; Hou, L.; Xiao, P.; Guo, Y.; Deyholos, M.K.; Liu, X. VvWRKY30, a grape WRKY transcription factor, plays a positive regulatory role under salinity stress. Plant Sci. 2018. [Google Scholar] [CrossRef]
  14. Powers, S.K.; Lennon, S.L.; Quindry, J.; Mehta, J.L. Exercise and cardioprotection. Curr. Opin. Cardiol. 2002, 17, 495–502. [Google Scholar] [CrossRef] [PubMed]
  15. Jiang, M.; Zhang, J. Water stress-induced abscisic acid accumulation triggers the increased generation of reactive oxygen species and up-regulates the activities of antioxidant enzymes in maize leaves. J. Exp. Bot. 2002, 53, 2401–2410. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Meloni, D.A.; Oliva, M.A.; Martinez, C.A.; Cambraia, J. Photosynthesis and activity of superoxide dismutase, peroxidase and glutathione reductase in cotton under salt stress. Environ. Exp. Bot. 2003, 49, 69–76. [Google Scholar] [CrossRef]
  17. Moradi, F.; Ismail, A.M. Responses of photosynthesis, chlorophyll fluorescence and ROS-scavenging systems to salt stress during seedling and reproductive stages in rice. Ann. Bot. 2007, 99, 1161–1173. [Google Scholar] [CrossRef] [PubMed]
  18. Negi, N.P.; Sharma, V.; Sarin, N.B. Pyramiding of Two Antioxidant Enzymes CuZnSOD and cAPX from Salt Tolerant Cell Lines of Arachis hypogeae Confers Drought Stress Tolerance in Nicotiana tabacum. Indian J. Agric. Biochem. 2017, 30, 141. [Google Scholar] [CrossRef]
  19. Hui, Y.; Qiang, L.; Park, S.C.; Wang, X.; Liu, Y.J.; Zhang, Y.G.; Tang, W.; Kou, M.; Ma, D.F. Overexpression of CuZnSOD, and APX, enhance salt stress tolerance in sweet potato. Plant Physiol. Biochem. 2016, 109, 20–27. [Google Scholar] [CrossRef]
  20. Yang, Z.; Zhou, Y.; Ge, L.; Li, G.; Liu, Q.; Xu, Y.; Jiang, L.; Yang, Y.; School of Agriculture, Jiangxi Agricultural University; School of Sciences, Jiangxi Agricultural University. Expression of Cucumber CsCAT3 Gene under Stress and Its Salt Tolerance in Transgenic Arabidopsis thaliana. Mol. Plant Breed. 2018. [Google Scholar]
  21. Guerzoni, J.T.S.; Belintani, N.G.; Moreira, R.M.P.; Hoshino, A.A.; Domingues, D.S.; Filho, J.C.B.; Vieira, L.G.E. Stress-induced Δ1-pyrroline-5-carboxylate synthetase (P5CS) gene confers tolerance to salt stress in transgenic sugarcane. Acta Physiol. Plant. 2014, 36, 2309–2319. [Google Scholar] [CrossRef]
  22. Wang, W.; Vinocur, B.; Altman, A. Plant responses to drought, salinity and extreme temperatures: Towards genetic engineering for stress tolerance. Planta 2003, 218, 1–14. [Google Scholar] [CrossRef] [PubMed]
  23. Qin, F.; Kakimoto, M.; Sakuma, Y.; Maruyama, K.; Osakabe, Y.; Tran, L.S.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Regulation and functional analysis of ZmDREB2A in response to drought and heat stresses in Zea mays L. Plant J. 2010, 50, 54–69. [Google Scholar] [CrossRef] [PubMed]
  24. Zhou, M.L.; Ma, J.T.; Zhao, Y.M.; Wei, Y.H.; Tang, Y.X.; Wu, Y.M. Improvement of drought and salt tolerance in Arabidopsis and Lotus corniculatus by overexpression of a novel DREB transcription factor from Populus euphratica. Gene 2012, 506, 10–17. [Google Scholar] [CrossRef] [PubMed]
  25. Ma, J.T.; Yin, C.C.; Guo, Q.Q.; Zhou, M.L.; Wang, Z.L.; Wu, Y.M. A novel DREB transcription factor from Halimodendron halodendron, leads to enhance drought and salt tolerance in Arabidopsis. Biol. Plant. 2014, 59, 74–82. [Google Scholar] [CrossRef]
  26. Akça, Y.; Samsunlu, E. The effect of salt stress on growth, chlorophyll content, proline and nutrient accumulation, and k/na ratio in walnut. Am. Bank. 2012, 1999, 1513–1520. [Google Scholar]
  27. Wu, Y.H.; Wang, T.; Wang, K.; Liang, Q.Y.; Bai, Z.Y.; Liu, Q.L.; Jiang, B.B.; Zhang, L. Comparative Analysis of the Chrysanthemum Leaf Transcript Profiling in Response to Salt Stress. PLoS ONE 2016, 11, e0159721. [Google Scholar] [CrossRef] [PubMed]
  28. Liu, Q.L.; Xu, K.D.; Pan, Y.Z.; Jiang, B.B.; Liu, G.L.; Jia, Y.; Zhang, H.Q. Functional Analysis of a Novel Chrysanthemum WRKY Transcription Factor Gene Involved in Salt Tolerance. Plant Mol. Biol. Rep. 2014, 32, 282–289. [Google Scholar] [CrossRef]
  29. Liu, Q.L.; Zhong, M.; Li, S.; Pan, Y.Z.; Jiang, B.B.; Jia, Y.; Zhang, H.Q. Overexpression of a chrysanthemum transcription factor gene, DgWRKY3, intobacco enhances tolerance to salt stress. Plant Physiol. Biochem. 2013, 69, 27–33. [Google Scholar] [CrossRef] [PubMed]
  30. Wang, K.; Wu, Y.H.; Tian, X.Q.; Bai, Z.Y.; Liang, Q.Y.; Liu, Q.L.; Pan, Y.Z.; Zhang, L.; Jiang, B.B. Overexpression of DgWRKY4 Enhances Salt Tolerance in Chrysanthemum Seedlings. Front. Plant Sci. 2017, 8, 1592. [Google Scholar] [CrossRef] [PubMed]
  31. Liang, Q.Y.; Wu, Y.H.; Wang, K.; Bai, Z.Y.; Liu, Q.L.; Pan, Y.Z.; Zhang, L.; Jiang, B.B. Chrysanthemum WRKY gene DgWRKY5 enhances tolerance to salt stress in transgenic chrysanthemum. Sci. Rep. 2017, 7, 4799. [Google Scholar] [CrossRef] [PubMed]
  32. Diao, M.; Ma, L.; Wang, J.; Cui, J.; Fu, A.; Liu, H. Selenium Promotes the Growth and Photosynthesis of Tomato Seedlings Under Salt Stress by Enhancing Chloroplast Antioxidant Defense System. J. Plant Growth Regul. 2014, 33, 671–682. [Google Scholar] [CrossRef]
  33. Ben, K.R.; Abdelly, C.; Savouré, A. Proline, a multifunctional amino-acid involved in plant adaptation to environmental constraints. Biol. Aujourdhui 2012, 206, 291. [Google Scholar] [CrossRef]
  34. Chaleff, R.S. Further characterization of picloram tolerant mutance of Nicotinana tabacum. Theor. Appl. Genet. 1980, 58, 91–95. [Google Scholar] [CrossRef]
  35. Wang, F.; Liu, P.; Zhu, J. Effect of magnesium (Mg) on contents of free proline, soluble sugar and protein in soybean leaves. J. Henan Agric. Sci. 2004, 6, 35–38. [Google Scholar]
  36. Fu, Q.T.; Yu, D.Q. Expression profiles of AtWRKY25, AtWRKY26 and AtWRKY33 under abiotic stresses. Hereditas 2010, 32, 848–856. [Google Scholar] [CrossRef] [PubMed]
  37. Qin, Y.X. Salt-Tolerant Drought-Tolerant Wheat Gene TaWRKY79 and Application Thereof. CN 102703465A, 3 October 2012. [Google Scholar]
  38. Tian, Y.C.; Qin, Y.X. Wheat Salt-Tolerant and Drought-Resistant Gene TaWRKY80 and Application Thereof. CN 102703466B, 3 July 2013. [Google Scholar]
  39. Wang, H.; Hao, J.; Chen, X.; Hao, Z.; Wang, X.; Lou, Y.; Peng, Y.; Guo, Z. Overexpression of rice WRKY89 enhances ultraviolet B tolerance and disease resistance in rice plants. Plant Mol. Biol. 2007, 65, 799–815. [Google Scholar] [CrossRef] [PubMed]
  40. Zhou, Q.Y.; Tian, A.G.; Zou, H.F.; Xie, Z.M.; Lei, G.; Huang, J.; Wang, C.M.; Wang, H.W.; Zhang, J.S.; Chen, S.Y. Soybean WRKY-type transcription factor genes, GmWRKY13, GmWRKY21, and GmWRKY54, confer differential tolerance to abiotic stresses in transgenic Arabidopsis plants. Plant Biotechnol. J. 2008, 6, 486–503. [Google Scholar] [CrossRef] [PubMed]
  41. Wang, F.; Hou, X.; Tang, J.; Wang, Z.; Wang, S.; Jiang, F.; Li, Y. A novel cold-inducible gene from Pak-choi (Brassica campestris, ssp. chinensis), BcWRKY46, enhances the cold, salt and dehydration stress tolerance in transgenic tobacco. Mol. Biol. Rep. 2012, 39, 4553. [Google Scholar] [CrossRef]
  42. Song, Y.; Jing, S.J.; Yu, D.Q. Overexpression of the stress-induced OsWRKY08 improves osmotic stress tolerance in Arabidopsis. Chin. Sci. Bull. 2009, 54, 4671–4678. [Google Scholar] [CrossRef]
  43. Zhong, G.M.; Wu, L.T.; Wang, J.M.; Yang, Y.; Li, X.F. Subcellular localization and expression analysis of transcription factor AtWRKY28 under biotic stresses. J. Agric. Sci. Technol. 2012, 14, 57–63. [Google Scholar]
  44. Zhao, Y.; Zhou, Y.; Jiang, H.; Li, X.; Gan, D.; Peng, X.; Zhu, S.; Cheng, B. Systematic Analysis of Sequences and Expression Patterns of Drought-Responsive Members of the HD-Zip Gene Family in Maize. PLoS ONE 2011, 6, e28488. [Google Scholar] [CrossRef] [PubMed]
  45. Raghavendra, A.S.; Padmasree, K.; Saradadevi, K. Interdependence of photosynthesis and respiration in plant cells: Interactions between chloroplasts and mitochondria. Plant Sci. 1994, 97, 1–14. [Google Scholar] [CrossRef]
  46. Li, P.; Song, A.; Gao, C.; Wang, L.; Wang, Y.; Sun, J.; Jiang, J.; Chen, F.; Chen, S. Chrysanthemum WRKY gene CmWRKY17, negatively regulates salt stress tolerance in transgenic chrysanthemum and Arabidopsis plants. Plant Cell Rep. 2015, 34, 1365–1378. [Google Scholar] [CrossRef] [PubMed]
  47. Wang, Y.; Jiang, L.; Chen, J.; Tao, L.; An, Y.; Cai, H.; Guo, C. Overexpression of the alfalfa WRKY11 gene enhances salt tolerance in soybean. PLoS ONE 2018, 13, e0192382. [Google Scholar] [CrossRef] [PubMed]
  48. Skórzyńskapolit, E. Lipid peroxidation in plant cells, its physiological role and changes under heavy metal stress. Acta Soc. Bot. Pol. 2007, 76, 49–54. [Google Scholar] [CrossRef]
  49. Jain, M.; Mathur, G.; Koul, S.; Sarin, N. Ameliorative effects of proline on salt stress-induced lipid peroxidation in cell lines of groundnut (Arachis hypogaea L.). Plant Cell Rep. 2001, 20, 463–468. [Google Scholar] [CrossRef]
  50. Tang, M.; Liu, X.; Deng, H.; Shen, S. Over-expression of JcDREB, a putative AP2/EREBP domain-containing transcription factor gene in woody biodiesel plant Jatropha curcas, enhances salt and freezing tolerance in transgenic Arabidopsis thaliana. Plant Sci. Int. J. Exp. Plant Biol. 2011, 181, 623. [Google Scholar] [CrossRef] [PubMed]
  51. Sakuma, Y.; Maruyama, K.; Osakabe, Y.; Qin, F.; Seki, M.; Shinozaki, K. Functional analysis of an Arabidopsis transcription factor, DREB2A, involved in drought-responsive gene expression. Plant Cell 2006, 18, 1292–1309. [Google Scholar] [CrossRef] [PubMed]
  52. Mallikarjuna, G.; Mallikarjuna, K.; Reddy, M.K.; Kaul, T. Expression of OsDREB2A, transcription factor confers enhanced dehydration and salt stress tolerance in rice (Oryza sativa, L.). Biotechnol. Lett. 2011, 33, 1689–1697. [Google Scholar] [CrossRef] [PubMed]
  53. An, G.; Watson, B.D.; Chiang, C.C. Transformation of Tobacco, Tomato, Potato, and Arabidopsis thaliana Using a Binary Ti Vector System. Plant Physiol. 1986, 81, 301–305. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Xue, J.P.; Yu, M.; Zhang, A.M. Studies on callus induced from leaves and plantlets regeneration of the traditional Chinese medicine Chrysanthemum morifolium. China J. Chin. Mater. Med. 2003, 28, 213–216. [Google Scholar]
  55. Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  56. Chen, L.; Chen, Y.; Jiang, J.; Chen, S.; Chen, F.; Guan, Z.; Fang, W. The constitutive expression of Chrysanthemum dichrum ICE1 in Chrysanthemum grandiflorum improves the level of low temperature, salinity and drought tolerance. Plant Cell Rep. 2012, 31, 1747–1758. [Google Scholar] [CrossRef] [PubMed]
  57. Li, H.S. Principles and Techniques of Plant Physiological and Biochemical Experiment, 3rd ed.; Higher Education Press: Beijing, China, 2015; pp. 182–184. [Google Scholar]
  58. Zhang, L.; Tian, L.H.; Zhao, J.F.; Song, Y.; Zhang, C.J.; Guo, Y. Identification of an apoplastic protein involved in the initial phase of salt stress response in rice root by two-dimensional electrophoresis. Plant Physiol. Plant Signal. Behav. 2009, 149, 916–928. [Google Scholar] [CrossRef] [PubMed]
  59. Sun, H.J.; Wang, S.F.; Chen, Y.T. Effects of salt stress on growth and physiological index of 6 tree species. For. Res. 2009, 22, 315–324. [Google Scholar]
  60. Jin, Y.; Donglin, L.I.; Ding, Y.; Wang, L. Effects of salt stress on photosynthetic characteristics and chlorophyll content of Sapium sebiferum seedlings. J. Nanjing For. Univ. 2011, 35, 29–33. [Google Scholar]
  61. Shi, J.; Fu, X.Z.; Peng, T.; Huang, X.S.; Fan, Q.J.; Liu, J.H. Spermine pretreatment confers dehydration tolerance of citrus in vitro plants via modulation of antioxidative capacity and stomatal response. Tree Physiol. 2010, 30, 914–922. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Ijms 19 02062 g001 550
Figure 1. The nucleotide sequence and the deduced amino acid sequence of DgWRKY2. The WRKY domain is underlined. The cysteine and histidine in the zinc-finger motifs are boxed.
Figure 1. The nucleotide sequence and the deduced amino acid sequence of DgWRKY2. The WRKY domain is underlined. The cysteine and histidine in the zinc-finger motifs are boxed.
Ijms 19 02062 g001
Ijms 19 02062 g002 550
Figure 2. Comparison between the amino acid sequences deduced for the DgWRKY2 gene. Amino acid residues conserved in all sequences are shaded in black, and those conserved in four sequences are shaded in light gray. The completely conserved WRKYGQK amino acids are boxed. The cysteine and histidine in zinc finger motifs are indicated by arrowheads (▼).
Figure 2. Comparison between the amino acid sequences deduced for the DgWRKY2 gene. Amino acid residues conserved in all sequences are shaded in black, and those conserved in four sequences are shaded in light gray. The completely conserved WRKYGQK amino acids are boxed. The cysteine and histidine in zinc finger motifs are indicated by arrowheads (▼).
Ijms 19 02062 g002
Ijms 19 02062 g003 550
Figure 3. Phylogenetic tree analysis of the WRKY protein in different plants. The phylogenetic tree was drawn using the MEGA 5.0 program with the neighbor-joining method. DgWRKY2 is boxed. The plant WRKY proteins used for the phylogenetic tree are as follows: DgWRKY1 (KC153303), DgWRKY3 (KC292215), DgWRKY4, DgWRKY5 from Dendranthema grandiflorum; AtWRKY11 (NP_849559), AtWRKY15 (NP_179913.1), AtWRKY17 (NP_565574.1), AtWRKY18 (NP_567882), AtWRKY22 (AEE81999), AtWRKY25 (NP_180584), AtWRKY26 (AAK28309), AtWRKY27 (NP_568777), AtWRKY28 (NP_193551), AtWRKY29 (AEE84774), AtWRKY31 (NP_567644), AtWRKY33 (NP_181381), AtWRKY36 (NP_564976), AtWRKY40 (NP_178199), AtWRKY41 (NP_192845), AtWRKY42 (NP_192354), AtWRKY53 (NP_194112), AtWRKY60 (NP_180072), AtWRKY61 (NP_173320) from Arabidopsis thaliana. TaWRKY2 (EU665425), TaWRKY19 (EU665430) from Triticicum aestivum. GmWRKY13 (DQ322694), GmWRKY54 (DQ322698) from Glycine max. OsWRKY11 (AK108745), OsWRKY45 (AY870611) from Oryza sativa. VvWRKY11 (EC935078) from Vitis vinifera. VpWRKY3 (JF500755) from Vitis pseudoreticulata. BcWRKY46 (HM585284) from Brassica campestris.
Figure 3. Phylogenetic tree analysis of the WRKY protein in different plants. The phylogenetic tree was drawn using the MEGA 5.0 program with the neighbor-joining method. DgWRKY2 is boxed. The plant WRKY proteins used for the phylogenetic tree are as follows: DgWRKY1 (KC153303), DgWRKY3 (KC292215), DgWRKY4, DgWRKY5 from Dendranthema grandiflorum; AtWRKY11 (NP_849559), AtWRKY15 (NP_179913.1), AtWRKY17 (NP_565574.1), AtWRKY18 (NP_567882), AtWRKY22 (AEE81999), AtWRKY25 (NP_180584), AtWRKY26 (AAK28309), AtWRKY27 (NP_568777), AtWRKY28 (NP_193551), AtWRKY29 (AEE84774), AtWRKY31 (NP_567644), AtWRKY33 (NP_181381), AtWRKY36 (NP_564976), AtWRKY40 (NP_178199), AtWRKY41 (NP_192845), AtWRKY42 (NP_192354), AtWRKY53 (NP_194112), AtWRKY60 (NP_180072), AtWRKY61 (NP_173320) from Arabidopsis thaliana. TaWRKY2 (EU665425), TaWRKY19 (EU665430) from Triticicum aestivum. GmWRKY13 (DQ322694), GmWRKY54 (DQ322698) from Glycine max. OsWRKY11 (AK108745), OsWRKY45 (AY870611) from Oryza sativa. VvWRKY11 (EC935078) from Vitis vinifera. VpWRKY3 (JF500755) from Vitis pseudoreticulata. BcWRKY46 (HM585284) from Brassica campestris.
Ijms 19 02062 g003
Ijms 19 02062 g004 550
Figure 4. Expression of chrysanthemum in different strains under salt stress. (A) Relative expression level of DgWRKY2 in transgenic chrysanthemums. The different normal letters indicate a significant difference at the 0.05 level among different strain lines, the same below; (B) comparison of transgenic plants and wild type plants after different periods under salt stress; (C) chrysanthemum survival statistics after recovery; (D) chlorophyll contents of chrysanthemum leave under salt stress.
Figure 4. Expression of chrysanthemum in different strains under salt stress. (A) Relative expression level of DgWRKY2 in transgenic chrysanthemums. The different normal letters indicate a significant difference at the 0.05 level among different strain lines, the same below; (B) comparison of transgenic plants and wild type plants after different periods under salt stress; (C) chrysanthemum survival statistics after recovery; (D) chlorophyll contents of chrysanthemum leave under salt stress.
Ijms 19 02062 g004
Ijms 19 02062 g005 550
Figure 5. The levels of oxidative damage in WT and DgWRKY2 overexpression lines of chrysanthemum were analyzed. (A) Diaminobenzidine (DAB) staining of chrysanthemum leaves during salt stress treatment; (B) changes in H2O2 content under salt stress; (C) nitroblue tetrazolium (NBT) staining of chrysanthemum leaves during salt stress treatment; (D) changes in O2− content under salt stress; (E) changes in malondialdehyde (MDA) content of chrysanthemum leaves under salt stress. Data represent means and standard errors of three replicates. The different letters above the columns indicate significant differences (p < 0.05) according to Duncan’s multiple range test.
Figure 5. The levels of oxidative damage in WT and DgWRKY2 overexpression lines of chrysanthemum were analyzed. (A) Diaminobenzidine (DAB) staining of chrysanthemum leaves during salt stress treatment; (B) changes in H2O2 content under salt stress; (C) nitroblue tetrazolium (NBT) staining of chrysanthemum leaves during salt stress treatment; (D) changes in O2− content under salt stress; (E) changes in malondialdehyde (MDA) content of chrysanthemum leaves under salt stress. Data represent means and standard errors of three replicates. The different letters above the columns indicate significant differences (p < 0.05) according to Duncan’s multiple range test.
Ijms 19 02062 g005
Ijms 19 02062 g006 550
Figure 6. Changes in antioxidant enzyme activities of chrysanthemum leaves under salt stress. (A) Superoxide dismutase (SOD) activity under salt stress; (B) peroxidase (POD) activity under salt stress; (C) catalase (CAT) activity under salt stress. Data represent means and standard errors of three replicates. The different letters above the columns indicate significant differences (p < 0.05) according to Duncan’s multiple range test.
Figure 6. Changes in antioxidant enzyme activities of chrysanthemum leaves under salt stress. (A) Superoxide dismutase (SOD) activity under salt stress; (B) peroxidase (POD) activity under salt stress; (C) catalase (CAT) activity under salt stress. Data represent means and standard errors of three replicates. The different letters above the columns indicate significant differences (p < 0.05) according to Duncan’s multiple range test.
Ijms 19 02062 g006
Ijms 19 02062 g007 550
Figure 7. Changes in contents of osmotic adjustment substances of chrysanthemum leaves under salt stress. (A) Proline content under salt stress; (B) soluble sugar content under salt stress; (C) soluble protein content under salt stress. The different letters above the columns indicate significant differences (p < 0.05) according to Duncan’s multiple range test.
Figure 7. Changes in contents of osmotic adjustment substances of chrysanthemum leaves under salt stress. (A) Proline content under salt stress; (B) soluble sugar content under salt stress; (C) soluble protein content under salt stress. The different letters above the columns indicate significant differences (p < 0.05) according to Duncan’s multiple range test.
Ijms 19 02062 g007
Ijms 19 02062 g008 550
Figure 8. Expression of stress-related genes in wild type (WT) and overexpressed lines. (A) Expression analysis of Cu/ZnSOD under salt stress; (B) expression analysis of CAT under salt stress; (C) expression analysis of ascorbate peroxidase (APX) under salt stress; (D) expression analysis of P5CS in chrysanthemum under salt stress; (E) expression analysis of DREB1A under salt stress; (F) expression analysis of DREB2A under salt stress. Data represent means and standard errors of three replicates. The different letters above the columns indicate significant differences (p < 0.05) according to Duncan’s multiple range test.
Figure 8. Expression of stress-related genes in wild type (WT) and overexpressed lines. (A) Expression analysis of Cu/ZnSOD under salt stress; (B) expression analysis of CAT under salt stress; (C) expression analysis of ascorbate peroxidase (APX) under salt stress; (D) expression analysis of P5CS in chrysanthemum under salt stress; (E) expression analysis of DREB1A under salt stress; (F) expression analysis of DREB2A under salt stress. Data represent means and standard errors of three replicates. The different letters above the columns indicate significant differences (p < 0.05) according to Duncan’s multiple range test.
Ijms 19 02062 g008
Table
Table 1. Primers and their sequences in experiment.
Table 1. Primers and their sequences in experiment.
PrimerSequence (5′-3′)
DgWRKY2F: ATTTGTCAAACTTCTCCTCTCTTCT
R: GTGGGGGTGGGGGTGGATA
EF1aF: TTTTGGTATCTGGTCCTGGAG
R: CCATTCAAGCGACAGACTCA
Cu/Zn SODF: CCATTGTTGACAAGCAGATTCCACTCA
R: ATCATCAGGATCAGCATGGACGACTAC
CATF: TACAAGCAACGCCCTTCAA
R: GACCTCTGTTCCCAACAGTCA
APXF: GTTGGCTGGTGTTGTTGCT
R: GATGGTCGTTTCCCTTAGTTG
P5CSF: TTGGAGCAGAGGTTGGAAT
R: GCAGGTCTTTGTGGGTGTAG
DREB1AF: CGGTTTTGGCTATGAGGGGT
R: TTCTTCTGCCAGCGTCACAT
DREB2AF: GATCGTGGCTGAGAGACTCG
R: TACCCCACGTTCTTTGCCTC

Share and Cite

MDPI and ACS Style

He, L.; Wu, Y.-H.; Zhao, Q.; Wang, B.; Liu, Q.-L.; Zhang, L. Chrysanthemum DgWRKY2 Gene Enhances Tolerance to Salt Stress in Transgenic Chrysanthemum. Int. J. Mol. Sci. 2018, 19, 2062. https://doi.org/10.3390/ijms19072062

AMA Style

He L, Wu Y-H, Zhao Q, Wang B, Liu Q-L, Zhang L. Chrysanthemum DgWRKY2 Gene Enhances Tolerance to Salt Stress in Transgenic Chrysanthemum. International Journal of Molecular Sciences. 2018; 19(7):2062. https://doi.org/10.3390/ijms19072062

Chicago/Turabian Style

He, Ling, Yin-Huan Wu, Qian Zhao, Bei Wang, Qing-Lin Liu, and Lei Zhang. 2018. "Chrysanthemum DgWRKY2 Gene Enhances Tolerance to Salt Stress in Transgenic Chrysanthemum" International Journal of Molecular Sciences 19, no. 7: 2062. https://doi.org/10.3390/ijms19072062

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop