Co-Expression Network Analysis of AMPK and Autophagy Gene Products during Adipocyte Differentiation
Abstract
:1. Introduction
2. Results
2.1. Preparing Data and Annotations
2.2. Detecting Co-Expression Modules of AMPK and Autophagy Genes in Differentiating Adipocytes
2.3. Correlating the Detected Modules to the Stage of Differentiation
2.4. Testing the Over-Representation of the Modules over the Differentiation Course
2.5. Visualizing Modules and Identifying Novel AMPK-Autophagy Interactions
2.6. Testing for Molecular Functions and Cellular Components Enrichment by the Detected Modules
2.7. Preservation of AMPK-Autophagy Networks across Independent Datasets
2.8. Validation of Selected Gene Products Correlations with Prkab1 and Prkag1
3. Discussion
4. Materials and Methods
4.1. Data and Annotation Sources
4.1.1. Gene Ontology
4.1.2. Microarrays Expression Data
4.1.3. Protein–Protein Interactions
4.2. Weighted-Gene Co-Expression Network Analysis
4.3. Network Visualization and Analysis
4.4. Gene Modules Over-Representation
4.5. Cell Culture and RT-qPCR
4.6. Software Environment and Reproducibility
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
AMPK | AMP-Activated Protein Kinase |
CC | Cellular Components |
FDR | False Discovery Rate |
GEO | Gene Expression Omnibus |
GO | Gene Ontology |
MDS | Multi-Dimensional Scaling |
mTOR | Mechanistic Target Of Rapamycin Kinase |
MF | Molecular Function |
PC | Principal Component |
PPI | Protein–Protein Interaction |
RT-qPCR | Real-Time Quantitative Polymerase Chain Reaction |
TOM | Topological Overlap Matrix |
ULK1 | Unc-51 Like Autophagy Activating Kinase 1 |
WGCNA | Weighted Gene Co-expression Network Analysis |
Appendix A. Datasets and Annotations
Appendix A.1. Time Point of Samples in the Microarrays Datasets
Time Point (hours) | GSE15018 | GSE20696 | GSE34150 | GSE69313 |
---|---|---|---|---|
−48 | 2 | |||
0 | 2 | 3 | 3 | |
1 | 1 | |||
2 | 1 | |||
3 | 1 | |||
4 | 1 | |||
5 | 1 | |||
6 | 1 | 3 | ||
7 | 1 | |||
8 | 1 | |||
9 | 1 | |||
10 | 1 | |||
11 | 1 | |||
12 | 1 | |||
13 | 1 | |||
14 | 1 | |||
15 | 1 | |||
16 | 1 | |||
17 | 1 | |||
18 | 1 | |||
24 | 3 | |||
48 | 2 | 3 | ||
72 | 3 | |||
96 | 3 | |||
144 | 3 | |||
168 | 2 | |||
192 | 3 | |||
240 | 3 | |||
336 | 3 | |||
432 | 3 |
Appendix A.2. Comparing the Average Expression in Four Datasets
Appendix A.3. Data Quality Assessment
Appendix A.4. Confirming Differentiation and Lipogenesis
Appendix A.5. RT-qPCR Primer Sequences
Name | Forward (5 to 3) | Reverse (3 to 5) |
---|---|---|
18S | ACCGCAGCTAGGAATAATGGA | GCCTCAGTTCCGAAAACCA |
Becn1 | CAGGAACTCACAGCTCCATTAC | CCATCCTGGCGAGTTTCAATA |
Prkab1 | GAGATCAAGGCTCCAGAGAAAG | GTTGAAGGACCCAGACAAGTAG |
Prkag1 | GAACTGGAGGAGCACAAGATAG | GGGAGCCTGTGGATCTTATTT |
Rab8a | GCTCGATGGCAAGAGGATTA | CTGTAGTAGGCTGTCGTGATTG |
Sirt2 | CATAGCCTCTAACCACCATAGC | GTAGCCTGTTGTCTGGGAATAA |
Trim21 | GATAGCCCAGAATACCAAGAAGAG | GCCCATCTTCCTCACAGAATAG |
Trp53inp2 | GGTGAAGCGCTGGAACAT | CACAACTACCTCAGCGCAGC |
Wipi1 | GTGTGTCTAGACGACGAGAATG | GACTTCTGAGGTAGGCTTCTTG |
Appendix A.6. Gene Ontology Annotation
Category | Term | Genes |
---|---|---|
AMPK | AMP-activated protein kinase activity | Prkab1, Prkag1, Smok1, Smok2a, Prkaa1, Prkaa2, Prkab2, Prkag2, |
Smok2b, Prkag3, 4921509C19Rik, Smok3a, Smok3b, Smok3c | ||
autophagy | autophagy of mitochondrion | Atg5, Rb1cc1, Cdkn2a, Capn10, Park2, Wipi1, Wdr45, Becn1, |
Fis1, Atg4b, Map1lc3a, Wdr45b, Cisd2, Fundc2, Map1lc3b, Atg12, Atg3, | ||
Pink1, Fbxo7, Fundc1, Atg7, Wipi2, Atg2b, Usp30, Atg9b, | ||
Ambra1, Atg4d, Atg4c, Atg9a, Atg2a, Atg4a | ||
autophagy of nucleus | Atg5, Wipi1, Wdr45, Becn1, Atg4b, Wdr45b, Atg12, Atg3, | |
Wipi2, Trappc8, Atg2b, Becn2, Atg4d, Atg4c, Atg2a, Atg4a | ||
autophagy of peroxisome | Rb1cc1, Acbd5, Pik3r4, Trappc8, Pik3c3 | |
chaperone-mediated autophagy | Hspa8, Lamp2 | |
late endosomal microautophagy | Hspa8, Vps4b, Vps4a | |
macroautophagy | Atg5, Cln3, Ei24, Nbr1, Sqstm1, Pik3c2a, Plaa, Ulk1, | |
Tcirg1, Ubqln1, Becn1, Ubxn6, Map1lc3a, Map1lc3b, Atg3, | ||
Trp53inp2, Tbc1d5, Atg7, Pik3r4, Zfyve1, D17Wsu92e, Pik3c3, Yod1, | ||
Tmem74, Pik3c2b, Vcp, Atg14 | ||
negative regulation of autophagy | Akt1, Bcl2, Eif4g2, Htr2b, Il3, Lep, Lepr, Mcl1, | |
Mt3, Ptpn22, Tnfaip3, Rnf5, Mtor, Sirt2, Rraga, Washc1, | ||
Rasip1, Zkscan3, Dapl1, Wdr6, Tbc1d14, Lars, Bmf, Eif4g1, | ||
Dap, Kdm4a, Herc1, Rubcn | ||
positive regulation of autophagy | Ager, Dcn, Hif1a, Ifng, Pim2, Prkd1, Plk2, Trim21, | |
Stk11, Tfeb, Tsc2, Xbp1, Mid2, Map2k1, Irgm2, Mefv, | ||
Sh3glb1, Nprl2, Becn1, Tmem59, Foxo1, Trp53inp1, Lrrk2, Mtdh, | ||
Trp53inp2, Dapk1, Optn, Plekhf1, Atg7, Svip, Uvrag, Tlr9, | ||
Trim8, Sh3bp4, Prkaa1, Ticam1, Prkaa2, Flcn, Ambra1, Zc3h12a, | ||
Dhrsx, Tpcn1, Rnf152, Trim65, Atg14 | ||
protein targeting to vacuole involved in autophagy | Smurf1 | |
regulation of autophagy | Atm, Bcl2, Casp1, Hmgb1, Lmx1b, Rab8a, Mapt, Pik3r2, Pip4k2a, Usp10, | |
Xbp1, Park2, Bok, Rragd, Rragc, Iigp1, Trp53inp1, Lrrk2, Pycard, Cisd2, | ||
Dram2, Soga3, Kat8, Rab39b, Rraga, Mtcl1, Dram1, Mfsd8, Fbxl2, Usp13, | ||
3110043O21Rik, Rptor, Chmp4b, Nlrp6, Pip4k2b, Pip4k2c, Usp33, Wdr41, | ||
Tpcn2, Smcr8, Lamp3, Rragb, Wdr24, Depdc5, Soga1, Fbxw7as1 |
Appendix B. Rational of Analysis Directive
Appendix B.1. Choosing the Network Power Threshold
Appendix B.2. Steps of Constructing the Weighed Co-Expression Networks
- The absolute values of either Pearson’s (default) or Spearman’s coefficient can be used to provide an initial similarity measure between each pair of nodes as in: .
- The similarity matrix is then transformed to and adjacency matrix by elevating it to a selected power as in: .
- This matrix is then used to calculate the connectivity/weight of each pair of nodes as follows:
Appendix B.3. Node Centrality Measures
- Degree Centrality: the number of edges/connections shared by a node. The Degree of a node v is given by:
- Betweenness Centrality: The number of the occasion of a node falls on the shortest between two other nodes. The Betweenness of a node v is given by:
- Hub Score/Eigenvector: a measure of the influence of a given node in a network. The Eigenvector of a node v is given by:
Appendix B.4. Network Preservation
Appendix C. A Note on Reproducing the Analysis
Appendix C.1. Setting up the Docker Environment
- $
- docker pull mahshaaban/analysis_containers:bioc_wgcna,
- $
- docker run -it mahshaaban/analysis_containers:bioc_wgcna bash.
Appendix C.2. Obtaining the Source Code
- 01.analysis.R This script loads the required libraries, download the data and run all the steps of the analysis described in the manuscript,
- figures/A sub-folder with a separate file for each graph in the manuscript,
- tables/A sub-folder with a sepearte file for each table in the manuscript.
- $
- git clone http://github.com/MahShaaban/aacna.
Appendix C.3. Running the Analysis
- $
- cd aacna/analysis/
- $
- make
Appendix C.4. Details of the R Environment
References
- Zhang, Y.; Goldman, S.; Baerga, R.; Zhao, Y.; Komatsu, M.; Jin, S. Adipose-specific deletion of autophagy-related gene 7 (atg7) in mice reveals a role in adipogenesis. Proc. Natl. Acad. Sci. USA 2009, 106, 19860–19865. [Google Scholar] [CrossRef] [PubMed]
- Baerga, R.; Zhang, Y.; Chen, P.H.; Goldman, S.; Jin, S. Targeted deletion of autophagy-related 5 (atg5) impairs adipogenesis in a cellular model and in mice. Autophagy 2009, 5, 1118–1130. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.; Xiang, Y.; Wang, Y.; Baikati, K.; Cuervo, A.M.; Luu, Y.K.; Tang, Y.; Pessin, J.E.; Schwartz, G.J.; Czaja, M.J. Autophagy regulates adipose mass and differentiation in mice. J. Clin. Investig. 2009, 119, 3329–3339. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Singh, R.; Kaushik, S.; Wang, Y.; Xiang, Y.; Novak, I.; Komatsu, M.; Tanaka, K.; Cuervo, A.M.; Czaja, M.J. Autophagy regulates lipid metabolism. Nature 2009, 458, 1131–1135. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gwinn, D.M.; Shackelford, D.B.; Egan, D.F.; Mihaylova, M.M.; Mery, A.; Vasquez, D.S.; Turk, B.E.; Shaw, R.J. AMPK Phosphorylation of raptor mediates a metabolic checkpoint. Mol. Cell 2008, 30, 214–226. [Google Scholar] [CrossRef] [PubMed]
- Inoki, K.; Zhu, T.; Guan, K.L. TSC2 Mediates Cellular Energy Response to Control Cell Growth and Survival. Cell 2003, 115, 577–590. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.; Kundu, M.; Viollet, B.; Guan, K.L. AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nat. Cell Biol. 2011, 13, 132–141. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Egan, D.F.; Shackelford, D.B.; Mihaylova, M.M.; Gelino, S.; Kohnz, R.A.; Mair, W.; Vasquez, D.S.; Joshi, A.; Gwinn, D.M.; Taylor, R.; et al. Phosphorylation of ULK1 (hATG1) by AMP-activated protein kinase connects energy sensing to mitophagy. Science 2011, 331, 456–461. [Google Scholar] [CrossRef] [PubMed]
- Green, H.; Kehinde, O. An established preadipose cell line and its differentiation in culture II. Factors affecting the adipose conversion. Cell 1975, 5, 19–27. [Google Scholar] [CrossRef]
- Ntambi, J.M.; Young-Cheul, K. Adipocyte differentiation and gene expression. J. Nutr. 2000, 130, 3122S–3126S. [Google Scholar] [CrossRef] [PubMed]
- Roberts, R.; Hodson, L.; Dennis, A.L.; Neville, M.J.; Humphreys, S.M.; Harnden, K.E.; Micklem, K.J.; Frayn, K.N. Markers of de novo lipogenesis in adipose tissue: Associations with small adipocytes and insulin sensitivity in humans. Diabetologia 2009, 52, 882–890. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Horvath, S. A General Framework for Weighted Gene Co-Expression Network Analysis. Stat. Appl. Genet. Mol. Biol. 2005, 4, Article17. [Google Scholar] [CrossRef] [PubMed]
- Edgar, R.; Domrachev, M.; Lash, A.E. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res. 2002, 30, 207–210. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chin, K. Dataset: A Time Course Analysis of the Effects of Prieurianin in the Mouse Preadipocytes 3T3-L1 Cells; The University of Toledo College of Medicine: Toledo, OH, USA, 2010. [Google Scholar]
- Mikkelsen, T.S.; Xu, Z.; Zhang, X.; Wang, L.; Gimble, J.M.; Lander, E.S.; Rosen, E.D. Comparative epigenomic analysis of murine and human adipogenesis. Cell 2010, 143, 156–169. [Google Scholar] [CrossRef] [PubMed]
- Horsch, M.; Beckers, J.; Adamski, J.; Halama, A. Dataset: Genome-Wide Expression Profiling Analysis of a Time Course of Differentiating Adipocytes; Helmholtz Zentrum Munchen GmbH: Neuherberg, Germany, 2015. [Google Scholar]
- Zhang, M.; Zhang, Y.; Ma, J.; Guo, F.; Cao, Q.; Zhang, Y.; Zhou, B.; Chai, J.; Zhao, W.; Zhao, R. Dataset: Effect of siRNA Knock-Down of FTO on 3T3-L1 Cell Differentiation; China Academy of Space Technology: Beijing, China, 2015. [Google Scholar]
- Hahm, J.R.; Ahmed, M.; Kim, D.R. RKIP phosphorylation–dependent ERK1 activation stimulates adipogenic lipid accumulation in 3T3-L1 preadipocytes overexpressing LC3. Biochem. Biophys. Res. Commun. 2016, 478, 12–17. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, M.; Quoc Nguyen, H.; Seok Hwang, J.; Zada, S.; Huyen Lai, T.; Soo Kang, S.; Ryong Kim, D. Systematic characterization of autophagy-related genes during the adipocyte differentiation using public-access data. Oncotarget 2018, 9, 15526–15541. [Google Scholar] [CrossRef] [PubMed]
- Davies, S.P.; Hawley, S.A.; Woods, A.; Carling, D.; Haystead, T.A.; Hardie, D.G. Purification of the AMP-activated protein kinase on ATP-γ-sepharose and analysis of its subunit structure. Eur. J. Biochem. 1994, 223, 351–357. [Google Scholar] [CrossRef] [PubMed]
- Dasgupta, B.; Chhipa, R.R. Evolving lessons on the complex role of AMPK in normal physiology and cancer. Trends Pharmacol. Sci. 2016, 37, 192–206. [Google Scholar] [CrossRef] [PubMed]
- Ross, F.A.; Jensen, T.E.; Hardie, D.G. Differential regulation by AMP and ADP of AMPK complexes containing different subunit isoforms. Biochem. J. 2016, 473, 189–199. [Google Scholar] [CrossRef] [PubMed]
- Mauvezin, C.; Orpinell, M.; Francis, V.A.; Mansilla, F.; Duran, J.; Ribas, V.; Palacín, M.; Boya, P.; Teleman, A.A.; Zorzano, A. The Nuclear Cofactor DOR Regulates Autophagy in Mammalian and Drosophila Cells; EMBO Reports; Nature Publishing Group: London, UK, 2010. [Google Scholar]
- Sala, D.; Ivanova, S.; Plana, N.; Ribas, V.; Duran, J.; Bach, D.; Turkseven, S.; Laville, M.; Vidal, H.; Karczewska-Kupczewska, M.; et al. Autophagy-regulating TP53INP2 mediates muscle wasting and is repressed in diabetes. J. Clin. Investig. 2014, 124, 1914–1927. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kirkin, V.; Lamark, T.; Sou, Y.S.; Bjørkøy, G.; Nunn, J.L.; Bruun, J.A.; Shvets, E.; McEwan, D.G.; Clausen, T.H.; Wild, P.; et al. A Role for NBR1 in Autophagosomal Degradation of Ubiquitinated Substrates. Mol. Cell 2009, 33, 505–516. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liang, J.; Xu, Z.X.; Ding, Z.; Lu, Y.; Yu, Q.; Werle, K.D.; Zhou, G.; Park, Y.Y.; Peng, G.; Gambello, M.J.; et al. Myristoylation confers noncanonical AMPK functions in autophagy selectivity and mitochondrial surveillance. Nat. Commun. 2015, 6, 7926. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jeon, S.M. Regulation and function of AMPK in physiology and diseases. Exp. Mol. Med. 2016, 48, e245. [Google Scholar] [CrossRef] [PubMed]
- Kola, B.; Grossman, A.; Korbonits, M. The role of AMP-activated protein kinase in obesity. Front. Horm Res. 2008, 36, 198–211. [Google Scholar] [PubMed]
- Goldman, S.; Zhang, Y.; Jin, S. Autophagy and adipogenesis: implications in obesity and type II diabetes. Autophagy 2010, 6, 179–181. [Google Scholar] [CrossRef] [PubMed]
- Nassiri, I.; Lombardo, R.; Lauria, M.; Morine, M.J.; Moyseos, P.; Varma, V.; Nolen, G.T.; Knox, B.; Sloper, D.; Kaput, J.; et al. Systems view of adipogenesis via novel omics-driven and tissue-specific activity scoring of network functional modules. Sci. Rep. 2016, 6, 28851. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stuart, J.M.; Segal, E.; Koller, D.; Kim, S.K. A gene-coexpression network for global discovery of conserved genetic modules. Science 2003, 302, 249–255. [Google Scholar] [CrossRef] [PubMed]
- Carter, S.L.; Brechbühler, C.M.; Griffin, M.; Bond, A.T. Gene co-expression network topology provides a framework for molecular characterization of cellular state. Bioinformatics (Oxford England) 2004, 20, 2242–2250. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene Ontology: Tool for the unification of biology. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef] [PubMed]
- Carlson, M. org.Mm.eg.db: Genome Wide Annotation for Mouse; Bioconductor: Seattle, WA, USA, 2016. [Google Scholar]
- Carlson, M. GO.db: A Set of Annotation Maps Describing the Entire Gene Ontology; R Package Version 3.2; Bioconductor: Seattle, WA, USA, 2015. [Google Scholar]
- Zhu, Y.; Davis, S.; Stephens, R.; Meltzer, P.S.; Chen, Y. GEOmetadb: Powerful alternative search engine for the Gene Expression Omnibus. Bioinformatics 2008, 24, 2798–2800. [Google Scholar] [CrossRef] [PubMed]
- Sean, D.; Meltzer, P.S. GEOquery: A bridge between the Gene Expression Omnibus (GEO) and BioConductor. Bioinformatics 2007, 23, 1846–1847. [Google Scholar]
- Szklarczyk, D.; Morris, J.H.; Cook, H.; Kuhn, M.; Wyder, S.; Simonovic, M.; Santos, A.; Doncheva, N.T.; Roth, A.; Bork, P.; et al. The STRING database in 2017: Quality-controlled protein–protein association networks, made broadly accessible. Nucleic Acids Res. 2017, 45, D362–D368. [Google Scholar] [CrossRef] [PubMed]
- Langfelder, P.; Horvath, S. WGCNA: An R package for weighted correlation network analysis. BMC Bioinform. 2008, 9, 559. [Google Scholar] [CrossRef] [PubMed]
- Langfelder, P.; Luo, R.; Oldham, M.C.; Horvath, S. Is my network module preserved and reproducible? PLoS Comput. Biol. 2011. [Google Scholar] [CrossRef] [PubMed]
- Xu, K.; Tang, C.; Tang, R.; Ali, G.; Zhu, J. A Comparative Study of Six Software Packages for Complex Network Research. In Proceedings of the 2010 Second International Conference on Communication Software and Networks, Singapore, 26–28 February 2010; pp. 350–354. [Google Scholar]
- Ritchie, M.E.; Phipson, B.; Wu, D.; Hu, Y.; Law, C.W.; Shi, W.; Smyth, G.K. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015, 43, e47. [Google Scholar] [CrossRef] [PubMed]
- Yu, G.; Wang, L.G.; Han, Y.; He, Q.Y. clusterProfiler: An R Package for Comparing Biological Themes among Gene Clusters. OMICS J. Integr.e Biol. 2012, 16, 284–287. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, M.; Kim, D.R. pcr: An R package for quality assessment, analysis and testing of qPCR data. PeerJ 2018, 6, e4473. [Google Scholar] [CrossRef] [PubMed]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2017. [Google Scholar]
- Huber, W.; Carey, V.J.; Gentleman, R.; Anders, S.; Carlson, M.; Carvalho, B.S.; Bravo, H.C.; Davis, S.; Gatto, L.; Girke, T.; et al. Orchestrating high-throughput genomic analysis with Bioconductor. Nat. Methods 2015, 12, 115–121. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Merkel, D. Docker: Lightweight Linux containers for consistent development and deployment. Linux J. 2014, 2014, 2. [Google Scholar]
Series ID | Platform ID | Samples | Included | (Contact, Year) | Reference |
---|---|---|---|---|---|
GSE15018 | GPL6845 | 54 | 18 | (Chin, 2009) | [14] |
GSE20696 | GPL1261 | 8 | 8 | (Mikkelsen, 2010) | [15] |
GSE34150 | GPL6885 | 24 | 24 | (Irmler, 2011) | [16] |
GSE69313 | GPL6246 | 48 | 12 | (Renbin, 2015) | [17] |
Module/Color | AMPK | Autophagy |
---|---|---|
blue | Acbd5, Atg5, Atm, Bmf, Bok, Casp1, Cln3, Dapk1, | |
Dhrsx, Fbxl2, Fbxo7, Fis1, Hif1a, Lep, Map1lc3a, | ||
Prkaa2, Prkab1, | Mcl1, Mid2, Optn, Pik3c2a, Pink1, Prkaa2, Rab39b, | |
Prkag2, Prkag3, Smok3b | Rab8a, Rragc, Sh3bp4, Sh3glb1, Sqstm1, Tbc1d5, Tnfaip3, | |
Tpcn1, Tpcn2, Trim8, Trp53inp2, Vcp, | ||
Wdr45, Yod1, Zc3h12a, Zfyve1 | ||
turquoise | 4921509C19Rik, Prkab2, Prkag1 | Ager, Akt1, Bcl2, Becn1, Capn10, Cdkn2a, |
D17Wsu92e, Dap, Dcn, Depdc5, Ei24, Eif4g1, Eif4g2, | ||
Foxo1, Fundc1, Fundc2, Hmgb1, Hspa8, Htr2b, | ||
Ifng, Lamp2, Lars, Lmx1b, Lrrk2, Map1lc3b, Map2k1, | ||
Mapt, Mt3, Nbr1, Nlrp6, Pik3c3, Pik3r2, | ||
Pik3r4, Pim2, Plaa, Plekhf1, Plk2, Pycard, | ||
Rasip1, Rnf5, Rraga, Rragb, Sirt2, Smcr8, | ||
Smurf1, Stk11, Tcirg1, Tmem74, Trim21, Trp53inp1, | ||
Tsc2, Ubqln1, Ulk1, Usp10, Usp13, Usp30, | ||
Usp33, Vps4a, Vps4b, Wdr6, Wipi1, Wipi2, Xbp1 |
Module/Color | Gene | Degree | Betweenness | Closeness | Hub Score |
---|---|---|---|---|---|
blue | Trp53inp2 | 19 | 14.67 | 0.16 | 1 |
Map1lc3a | 19 | 22.71 | 0.16 | 0.99 | |
Wdr45 | 18 | 11.23 | 0.16 | 0.98 | |
Pink1 | 18 | 12.91 | 0.16 | 0.97 | |
Dapk1 | 18 | 14.48 | 0.16 | 0.96 | |
turquoise | Foxo1 | 28 | 70.89 | 0.28 | 1 |
Dcn | 25 | 36.23 | 0.28 | 0.96 | |
Xbp1 | 24 | 29.59 | 0.28 | 0.93 | |
Plk2 | 24 | 60.28 | 0.27 | 0.9 | |
Eif4g1 | 24 | 41.01 | 0.27 | 0.9 |
Module/Color | AMPK | Autophagy |
---|---|---|
blue | Prkab1 | Bmf, Dapk1, Rab8a, Sh3glb1, Trp53inp2 |
Prkag3 | Rragc | |
inbetween | Prkab1 | Tsc2, Ubqln1, Wipi1 |
Prkab2 | Zc3h12a | |
Prkag3 | Usp33 | |
turquoise | Prkag1 | Akt1, Bcl2, Becn1, Capn10, Cdkn2a, Dcn, Eif4g1, Foxo1, |
Fundc1, Lamp2, Lars, Map1lc3b, Nbr1, Plk2, Sirt2, Trim21, | ||
Trp53inp1, Usp33, Vps4a, Wipi2, Xbp1 |
Module/Color | Ontology | AMPK | Term | Autophgy |
---|---|---|---|---|
blue | CC | Prkab1 | outer membrane | Sh3glb1 |
MF | nucleoside binding | Dapk1, Rab8a | ||
ubiquitin-like protein binding | Trp53inp2 | |||
Prkag3 | nucleoside binding | Rragc | ||
turquoise | CC | Prkag1 | anchoring junction | Usp33 |
extrinsic component of membrane | Becn1, Wipi2 | |||
Flemming body | Vps4a | |||
intrinsic component of organelle membrane | Fundc1, Lamp2 | |||
midbody | Sirt2, Vps4a | |||
mitochondrial membrane part | Fundc1 | |||
outer membrane | Bcl2, Capn10, Fundc1 | |||
phosphatidylinositol 3-kinase complex | Becn1 | |||
MF | 14-3-3 protein binding | Akt1 | ||
enzyme activator activity | Lars | |||
kinase regulator activity | Cdkn2a, Dcn | |||
nucleoside-triphosphatase regulator activity | Lars | |||
p53 binding | Cdkn2a | |||
phosphatidylinositol 3-kinase binding | Becn1, Xbp1 | |||
phospholipid binding | Akt1, Wipi2 | |||
protein N-terminus binding | Cdkn2a, Dcn | |||
ubiquitin-like protein binding | Nbr1, Sirt2 | |||
ubiquitinyl hydrolase activity | Usp33 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ahmed, M.; Hwang, J.S.; Lai, T.H.; Zada, S.; Nguyen, H.Q.; Pham, T.M.; Yun, M.; Kim, D.R. Co-Expression Network Analysis of AMPK and Autophagy Gene Products during Adipocyte Differentiation. Int. J. Mol. Sci. 2018, 19, 1808. https://doi.org/10.3390/ijms19061808
Ahmed M, Hwang JS, Lai TH, Zada S, Nguyen HQ, Pham TM, Yun M, Kim DR. Co-Expression Network Analysis of AMPK and Autophagy Gene Products during Adipocyte Differentiation. International Journal of Molecular Sciences. 2018; 19(6):1808. https://doi.org/10.3390/ijms19061808
Chicago/Turabian StyleAhmed, Mahmoud, Jin Seok Hwang, Trang Huyen Lai, Sahib Zada, Huynh Quoc Nguyen, Trang Min Pham, Miyong Yun, and Deok Ryong Kim. 2018. "Co-Expression Network Analysis of AMPK and Autophagy Gene Products during Adipocyte Differentiation" International Journal of Molecular Sciences 19, no. 6: 1808. https://doi.org/10.3390/ijms19061808