DsSWEET17, a Tonoplast-Localized Sugar Transporter from Dianthus spiculifolius, Affects Sugar Metabolism and Confers Multiple Stress Tolerance in Arabidopsis
Abstract
1. Introduction
2. Results
2.1. Sequence Analysis of DsSWEET17
2.2. Expression and Subcellular Localization of DsSWEET17
2.3. Overexpression of DsSWEET17 in Arabidopsis Affects Seedling Growth in the Presence of Exogenous Fructose
2.4. Overexpression of DsSWEET17 in Arabidopsis Affects Sugar Metabolism and Confers Tolerance to Multiple Stresses
3. Discussion
4. Materials and Methods
4.1. Identification of DsSWEET17 and Sequence Analysis
4.2. Plant Material and Growth Conditions
4.3. RNA Extraction and Quantitative Real-Time PCR Analyses
4.4. Vector Construction and Plant Transformation
4.5. Confocal Laser Scanning Microscopy and FM4-64 Staining
4.6. Analysis of the Sugar Content
4.7. Sugar Treatment and Stress Tolerance Assay
Author Contributions
Funding
Conflicts of Interest
References
- Lemoine, R.; La Camera, S.; Atanassova, R.; Dedaldechamp, F.; Allario, T.; Pourtau, N.; Bonnemain, J.L.; Laloi, M.; Coutos-Thevenot, P.; Maurousset, L.; et al. Source-to-sink transport of sugar and regulation by environmental factors. Front. Plant Sci. 2013, 4, 272. [Google Scholar] [CrossRef] [PubMed]
- Baker, R.F.; Leach, K.A.; Braun, D.M. SWEET as sugar: New sucrose effluxers in plants. Mol. Plant 2012, 5, 766–768. [Google Scholar] [CrossRef] [PubMed]
- Eom, J.S.; Chen, L.Q.; Sosso, D.; Julius, B.T.; Lin, I.W.; Qu, X.Q.; Braun, D.M.; Frommer, W.B. SWEETs, transporters for intracellular and intercellular sugar translocation. Curr. Opin. Plant Biol. 2015, 25, 53–62. [Google Scholar] [CrossRef] [PubMed]
- Hedrich, R.; Sauer, N.; Neuhaus, H.E. Sugar transport across the plant vacuolar membrane: Nature and regulation of carrier proteins. Curr. Opin. Plant Biol. 2015, 25, 63–70. [Google Scholar] [CrossRef] [PubMed]
- Kanno, Y.; Oikawa, T.; Chiba, Y.; Ishimaru, Y.; Shimizu, T.; Sano, N.; Koshiba, T.; Kamiya, Y.; Ueda, M.; Seo, M. AtSWEET13 and AtSWEET14 regulate gibberellin-mediated physiological processes. Nat. Commun. 2016, 7, 13245. [Google Scholar] [CrossRef] [PubMed]
- Streubel, J.; Pesce, C.; Hutin, M.; Koebnik, R.; Boch, J.; Szurek, B. Five phylogenetically close rice SWEET genes confer TAL effector-mediated susceptibility to Xanthomonas oryzae pv. oryzae. New Phytol. 2013, 200, 808–819. [Google Scholar] [CrossRef] [PubMed]
- Mizuno, H.; Kasuga, S.; Kawahigashi, H. The sorghum SWEET gene family: Stem sucrose accumulation as revealed through transcriptome profiling. Biotechnol. Biofuels 2016, 9, 127. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.Q.; Hou, B.H.; Lalonde, S.; Takanaga, H.; Hartung, M.L.; Qu, X.Q.; Guo, W.J.; Kim, J.G.; Underwood, W.; Chaudhuri, B.; et al. Sugar transporters for intercellular exchange and nutrition of pathogens. Nature 2010, 468, 527–532. [Google Scholar] [CrossRef] [PubMed]
- Tao, Y.; Cheung, L.S.; Li, S.; Eom, J.S.; Chen, L.Q.; Xu, Y.; Perry, K.; Frommer, W.B.; Feng, L. Structure of a eukaryotic SWEET transporter in a homotrimeric complex. Nature 2015, 527, 259–263. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Zhang, Y.; Yang, C.; Tian, Z.; Li, J. AtSWEET4, a hexose facilitator, mediates sugar transport to axial sinks and affects plant development. Sci. Rep. 2016, 6, 24563. [Google Scholar] [CrossRef] [PubMed]
- Guan, Y.F.; Huang, X.Y.; Zhu, J.; Gao, J.F.; Zhang, H.X.; Yang, Z.N. Ruptured Pollen Grain1, a member of the MtN3/saliva gene family, is crucial for exine pattern formation and cell integrity of microspores in Arabidopsis. Plant Physiol. 2008, 147, 852–863. [Google Scholar] [CrossRef] [PubMed]
- Lin, I.W.; Sosso, D.; Chen, L.Q.; Gase, K.; Kim, S.G.; Kessler, D.; Klinkenberg, P.M.; Gorder, M.K.; Hou, B.H.; Qu, X.Q.; et al. Nectar secretion requires sucrose phosphate synthases and the sugar transporter SWEET9. Nature 2014, 508, 546–549. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.Q.; Qu, X.Q.; Hou, B.H.; Sosso, D.; Osorio, S.; Fernie, A.R.; Frommer, W.B. Sucrose efflux mediated by SWEET proteins as a key step for phloem transport. Science 2012, 335, 207–211. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.Q. SWEET sugar transporters for phloem transport and pathogen nutrition. New Phytol. 2014, 201, 1150–1155. [Google Scholar] [CrossRef] [PubMed]
- Klemens, P.A.; Patzke, K.; Deitmer, J.; Spinner, L.; Le Hir, R.; Bellini, C.; Bedu, M.; Chardon, F.; Krapp, A.; Neuhaus, H.E. Overexpression of the vacuolar sugar carrier AtSWEET16 modifies germination, growth, and stress tolerance in Arabidopsis. Plant Physiol. 2013, 163, 1338–1352. [Google Scholar] [CrossRef] [PubMed]
- Guo, W.J.; Nagy, R.; Chen, H.Y.; Pfrunder, S.; Yu, Y.C.; Santelia, D.; Frommer, W.B.; Martinoia, E. SWEET17, a facilitative transporter, mediates fructose transport across the tonoplast of Arabidopsis roots and leaves. Plant Physiol. 2014, 164, 777–789. [Google Scholar] [CrossRef] [PubMed]
- Chardon, F.; Bedu, M.; Calenge, F.; Klemens, P.A.; Spinner, L.; Clement, G.; Chietera, G.; Leran, S.; Ferrand, M.; Lacombe, B.; et al. Leaf fructose content is controlled by the vacuolar transporter SWEET17 in Arabidopsis. Curr. Biol. 2013, 23, 697–702. [Google Scholar] [CrossRef] [PubMed]
- Zhou, A.; Ma, H.; Liu, E.; Jiang, T.; Feng, S.; Gong, S.; Wang, J. Transcriptome sequencing of Dianthus spiculifolius and analysis of the genes involved in responses to combined cold and drought stress. Int. J. Mol. Sci. 2017, 18, 849. [Google Scholar] [CrossRef] [PubMed]
- Zhou, A.; Ma, H.; Feng, S.; Gong, S.; Wang, J. A novel sugar transporter from Dianthus spiculifolius, DsSWEET12, affects sugar metabolism and confers osmotic and oxidative stress tolerance in Arabidopsis. Int. J. Mol. Sci. 2018, 19, 497. [Google Scholar] [CrossRef] [PubMed]
- Durand, M.; Mainson, D.; Porcheron, B.; Maurousset, L.; Lemoine, R.; Pourtau, N. Carbon source-sink relationship in Arabidopsis thaliana: The role of sucrose transporters. Planta 2018, 247, 587–611. [Google Scholar] [CrossRef] [PubMed]
- Moustakas, M.; Sperdouli, I.; Kouna, T.; Antonopoulou, C.I.; Therios, I. Exogenous proline induces soluble sugar accumulation and alleviates drought stress effects on photosystem II functioning of Arabidopsis thaliana leaves. Plant Growth Regul. 2011, 65, 315–325. [Google Scholar] [CrossRef]
- Couee, I.; Sulmon, C.; Gouesbet, G.; El Amrani, A. Involvement of soluble sugars in reactive oxygen species balance and responses to oxidative stress in plants. J. Exp. Bot. 2006, 57, 449–459. [Google Scholar] [CrossRef] [PubMed]
- Clough, S.J.; Bent, A.F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998, 16, 735–743. [Google Scholar] [CrossRef] [PubMed]
- Zhou, A.; Liu, E.; Ma, H.; Feng, S.; Gong, S.; Wang, J. NaCl-induced expression of AtVHA-c5 gene in the roots plays a role in response of Arabidopsis to salt stress. Plant Cell Rep. 2018, 37, 443–452. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Primer Sequence (5′→3′) | Purpose |
---|---|---|
DsSWEET17-qF | CATCAATGGTTTCGGTGTTCT | qPCR |
DsSWEET17-qR | TGACGCCCTTGTAACGCTAA | qPCR |
DsActin-qF | CGGTGGCTCTATCCTCGCTT | qPCR |
DsActin-qR | TTCCTGTGGACGATTGACGG | qPCR |
AtActin1-F (AT2G37620) | GAAAATGGCTGATGGTGAAG | RT-PCR |
AtActin1-R | CTCATAGATAGGAACAGTGTGGC | RT-PCR |
DsSWEET17 (BamHI)-F | GGATCCATGGTGGATTTTAGCTTCT | Cloning and Subcellular localization |
DsSWEET17 (SacI)-R | GAGCTCTTAAACATTTGGAAGTAGAC | Cloning |
DsSWEET17 (AgeI)-R | ACCGGTACATTTGGAAGTAGACTAGAAG | Subcellular localization |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, A.; Ma, H.; Feng, S.; Gong, S.; Wang, J. DsSWEET17, a Tonoplast-Localized Sugar Transporter from Dianthus spiculifolius, Affects Sugar Metabolism and Confers Multiple Stress Tolerance in Arabidopsis. Int. J. Mol. Sci. 2018, 19, 1564. https://doi.org/10.3390/ijms19061564
Zhou A, Ma H, Feng S, Gong S, Wang J. DsSWEET17, a Tonoplast-Localized Sugar Transporter from Dianthus spiculifolius, Affects Sugar Metabolism and Confers Multiple Stress Tolerance in Arabidopsis. International Journal of Molecular Sciences. 2018; 19(6):1564. https://doi.org/10.3390/ijms19061564
Chicago/Turabian StyleZhou, Aimin, Hongping Ma, Shuang Feng, Shufang Gong, and Jingang Wang. 2018. "DsSWEET17, a Tonoplast-Localized Sugar Transporter from Dianthus spiculifolius, Affects Sugar Metabolism and Confers Multiple Stress Tolerance in Arabidopsis" International Journal of Molecular Sciences 19, no. 6: 1564. https://doi.org/10.3390/ijms19061564
APA StyleZhou, A., Ma, H., Feng, S., Gong, S., & Wang, J. (2018). DsSWEET17, a Tonoplast-Localized Sugar Transporter from Dianthus spiculifolius, Affects Sugar Metabolism and Confers Multiple Stress Tolerance in Arabidopsis. International Journal of Molecular Sciences, 19(6), 1564. https://doi.org/10.3390/ijms19061564