Functional Characterization of Novel Atrial Fibrillation-Linked GJA5 (Cx40) Mutants
Abstract
:1. Introduction
2. Results
2.1. AF-Linked Cx40 Mutants Formed GJ Plaque-Like Structures at the Cell–Cell Interface
2.2. Coupling Conductance of GJs Formed by AF-Linked Mutants
2.3. Homotypic Cx40 Q236H GJs Showed an Altered Vj Gating
2.4. Co-Expression of AF-Linked Mutants with Cx43
2.5. Function of Heterotypic Mutant/Cx40 GJ Channels
2.6. Propidium Iodide Uptake by AF-Linked Cx40 Mutant-Expressing Cells
3. Discussion
3.1. AF-Linked Cx40 Mutants Showed Multiple Defects in GJ or Hemichannel Function
3.2. AF-Linked Cx40 Mutants and Their Possible Role in AF Pathogenesis
3.3. AF-Linked Cx40 Mutants without Apparent Defects In Vitro
3.4. Other AF-Linked Genetic Factors
4. Materials and Methods
4.1. Plasmid Construction
K107R | Forward: 5′ CAGGAGAAGCGCAGGCTACGGGAGGCC 3′ |
Reverse: 5′ GGCCTCCCGTAGCCTGCGCTTCTCCTG 3′ | |
L223M | Forward: 5′ CTCCTCCTTAGCATGGCTGAACTCT 3′ |
Reverse: 5′ AGAGTTCAGCCATGCTAAGGAGG 3′ | |
I257L | Forward: 5′ CCCTCTGTGGGCCTAGTCCAGAGCTGC3′ |
Reverse: 5′ GCAGCTCTGGACTAGGCCCACAGAGGG3′ | |
Q236H | Forward: 5′ GGAAGAAGATCAGACACCGATTTGTCAAACC3′ |
Reverse: 5′ GGTTTGACAAATCGGTGTCTGATCTTCTTCC3′ |
4.2. Cell Culture and Transfection
4.3. Localization
4.4. Electrophysiology
4.5. Dye Uptake Assay
4.6. Data Analysis
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
Abbreviations
Cx40 | connexin40 |
Gj,ss | normalized steady-state junction conductance |
Ij | macroscopic junctional current |
Vj | transjunctional voltage |
References
- Fuster, V.; Ryden, L.E.; Cannom, D.S.; Crijns, H.J.; Curtis, A.B.; Ellenbogen, K.A.; Halperin, J.L.; Kay, G.N.; Le Huezey, J.Y.; Lowe, J.E.; et al. 2011 ACCF/AHA/HRS focused updates incorporated into the ACC/AHA/ESC 2006 Guidelines for the management of patients with atrial fibrillation: A report of the American College of Cardiology Foundation/American Heart Association Task Force on Practice Guidelines developed in partnership with the European Society of Cardiology and in collaboration with the European Heart Rhythm Association and the Heart Rhythm Society. J. Am. Coll. Cardiol. 2011, 57, e101–e198. [Google Scholar] [PubMed]
- Wakili, R.; Voigt, N.; Kaab, S.; Dobrev, D.; Nattel, S. Recent advances in the molecular pathophysiology of atrial fibrillation. J. Clin. Investig. 2011, 121, 2955–2968. [Google Scholar] [CrossRef] [PubMed]
- Go, A.S.; Hylek, E.M.; Phillips, K.A.; Chang, Y.; Henault, L.E.; Selby, J.V.; Singer, D.E. Prevalence of diagnosed atrial fibrillation in adults: National implications for rhythm management and stroke prevention: The AnTicoagulation and Risk Factors in Atrial Fibrillation (ATRIA) Study. JAMA 2001, 285, 2370–2375. [Google Scholar] [CrossRef] [PubMed]
- Wolf, P.A.; Abbott, R.D.; Kannel, W.B. Atrial fibrillation as an independent risk factor for stroke: The Framingham Study. Stroke 1991, 22, 983–988. [Google Scholar] [CrossRef] [PubMed]
- Saffitz, J.E.; Corradi, D. The electrical heart: 25 years of discovery in cardiac electrophysiology, arrhythmias and sudden death. Cardiovasc. Pathol. 2016, 25, 149–157. [Google Scholar] [CrossRef] [PubMed]
- Levy, S.; Maarek, M.; Coumel, P.; Guize, L.; Lekieffre, J.; Medvedowsky, J.L.; Sebaoun, A. Characterization of different subsets of atrial fibrillation in general practice in France: The ALFA study. The College of French Cardiologists. Circulation 1999, 99, 3028–3035. [Google Scholar] [CrossRef] [PubMed]
- Fox, C.S.; Parise, H.; D’Agostino, R.B., Sr.; Lloyd-Jones, D.M.; Vasan, R.S.; Wang, T.J.; Levy, D.; Wolf, P.A.; Benjamin, E.J. Parental atrial fibrillation as a risk factor for atrial fibrillation in offspring. JAMA 2004, 291, 2851–2855. [Google Scholar] [CrossRef] [PubMed]
- Xiao, J.; Liang, D.; Chen, Y.H. The genetics of atrial fibrillation: From the bench to the bedside. Annu. Rev. Genom. Hum. Genet. 2011, 12, 73–96. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.H.; Xu, S.J.; Bendahhou, S.; Wang, X.L.; Wang, Y.; Xu, W.Y.; Jin, H.W.; Sun, H.; Su, X.Y.; Zhuang, Q.N.; et al. KCNQ1 gain-of-function mutation in familial atrial fibrillation. Science 2003, 299, 251–254. [Google Scholar] [CrossRef] [PubMed]
- Makiyama, T.; Akao, M.; Shizuta, S.; Doi, T.; Nishiyama, K.; Oka, Y.; Ohno, S.; Nishio, Y.; Tsuji, K.; Itoh, H.; et al. A novel SCN5A gain-of-function mutation M1875T associated with familial atrial fibrillation. J. Am. Coll. Cardiol. 2008, 52, 1326–1334. [Google Scholar] [CrossRef] [PubMed]
- Gollob, M.H.; Jones, D.L.; Krahn, A.D.; Danis, L.; Gong, X.Q.; Shao, Q.; Liu, X.; Veinot, J.P.; Tang, A.S.; Stewart, A.F.; et al. Somatic mutations in the connexin 40 gene (GJA5) in atrial fibrillation. N. Engl. J. Med. 2006, 354, 2677–2688. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.Q.; Zhang, X.L.; Wang, X.H.; Tan, H.W.; Shi, H.F.; Jiang, W.F.; Fang, W.Y.; Liu, X. Connexin40 nonsense mutation in familial atrial fibrillation. Int. J. Mol. Med. 2010, 26, 605–610. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.Q.; Liu, X.; Zhang, X.L.; Wang, X.H.; Tan, H.W.; Shi, H.F.; Jiang, W.F.; Fang, W.Y. Novel connexin40 missense mutations in patients with familial atrial fibrillation. Europace 2010, 12, 1421–1427. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Yang, Y.Q.; Gong, X.Q.; Wang, X.H.; Li, R.G.; Tan, H.W.; Liu, X.; Fang, W.Y.; Bai, D. Novel germline GJA5/connexin40 mutations associated with lone atrial fibrillation impair gap junctional intercellular communication. Hum. Mutat. 2013, 34, 603–609. [Google Scholar] [PubMed]
- Sohl, G.; Willecke, K. Gap junctions and the connexin protein family. Cardiovasc. Res. 2004, 62, 228–232. [Google Scholar] [CrossRef] [PubMed]
- Zimmer, D.B.; Green, C.R.; Evans, W.H.; Gilula, N.B. Topological analysis of the major protein in isolated intact rat liver gap junctions and gap junction-derived single membrane structures. J. Biol. Chem. 1987, 262, 7751–7763. [Google Scholar] [PubMed]
- Evans, W.H.; De Vuyst, E.; Leybaert, L. The gap junction cellular internet: Connexin hemichannels enter the signalling limelight. Biochem. J. 2006, 397, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Bai, D.; Wang, A.H. Extracellular domains play different roles in gap junction formation and docking compatibility. Biochem. J. 2014, 458, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Jansen, J.A.; van Veen, T.A.; de Bakker, J.M.; van Rijen, H.V. Cardiac connexins and impulse propagation. J. Mol. Cell. Cardiol. 2010, 48, 76–82. [Google Scholar] [CrossRef] [PubMed]
- Verheule, S.; Kaese, S. Connexin diversity in the heart: Insights from transgenic mouse models. Front. Pharmacol. 2013, 4, 81. [Google Scholar] [CrossRef] [PubMed]
- Vozzi, C.; Dupont, E.; Coppen, S.R.; Yeh, H.I.; Severs, N.J. Chamber-related differences in connexin expression in the human heart. J. Mol. Cell. Cardiol. 1999, 31, 991–1003. [Google Scholar] [CrossRef] [PubMed]
- Severs, N.J.; Bruce, A.F.; Dupont, E.; Rothery, S. Remodelling of gap junctions and connexin expression in diseased myocardium. Cardiovasc. Res. 2008, 80, 9–19. [Google Scholar] [CrossRef] [PubMed]
- Fishman, G.I.; Spray, D.C.; Leinwand, L.A. Molecular characterization and functional expression of the human cardiac gap junction channel. J. Cell Biol. 1990, 111, 589–598. [Google Scholar] [CrossRef] [PubMed]
- Desplantez, T.; Dupont, E.; Severs, N.J.; Weingart, R. Gap junction channels and cardiac impulse propagation. J. Membr. Biol. 2007, 218, 13–28. [Google Scholar] [CrossRef] [PubMed]
- Kanno, S.; Saffitz, J.E. The role of myocardial gap junctions in electrical conduction and arrhythmogenesis. Cardiovasc. Pathol. 2001, 10, 169–177. [Google Scholar] [CrossRef]
- Gutstein, D.E.; Morley, G.E.; Tamaddon, H.; Vaidya, D.; Schneider, M.D.; Chen, J.; Chien, K.R.; Stuhlmann, H.; Fishman, G.I. Conduction slowing and sudden arrhythmic death in mice with cardiac-restricted inactivation of connexin43. Circ. Res. 2001, 88, 333–339. [Google Scholar] [CrossRef] [PubMed]
- Beauchamp, P.; Yamada, K.A.; Baertschi, A.J.; Green, K.; Kanter, E.M.; Saffitz, J.E.; Kleber, A.G. Relative contributions of connexins 40 and 43 to atrial impulse propagation in synthetic strands of neonatal and fetal murine cardiomyocytes. Circ. Res. 2006, 99, 1216–1224. [Google Scholar] [CrossRef] [PubMed]
- Thibodeau, I.L.; Xu, J.; Li, Q.; Liu, G.; Lam, K.; Veinot, J.P.; Birnie, D.H.; Jones, D.L.; Krahn, A.D.; Lemery, R.; et al. Paradigm of genetic mosaicism and lone atrial fibrillation: Physiological characterization of a connexin 43-deletion mutant identified from atrial tissue. Circulation 2010, 122, 236–244. [Google Scholar] [CrossRef] [PubMed]
- Igarashi, T.; Finet, J.E.; Takeuchi, A.; Fujino, Y.; Strom, M.; Greener, I.D.; Rosenbaum, D.S.; Donahue, J.K. Connexin gene transfer preserves conduction velocity and prevents atrial fibrillation. Circulation 2012, 125, 216–225. [Google Scholar] [CrossRef] [PubMed]
- Bikou, O.; Thomas, D.; Trappe, K.; Lugenbiel, P.; Kelemen, K.; Koch, M.; Soucek, R.; Voss, F.; Becker, R.; Katus, H.A.; et al. Connexin 43 gene therapy prevents persistent atrial fibrillation in a porcine model. Cardiovasc. Res. 2011, 92, 218–225. [Google Scholar] [CrossRef] [PubMed]
- Simon, A.M.; Goodenough, D.A. Diverse functions of vertebrate gap junctions. Trends Cell Biol. 1998, 8, 477–483. [Google Scholar] [CrossRef]
- Kirchhoff, S.; Nelles, E.; Hagendorff, A.; Kruger, O.; Traub, O.; Willecke, K. Reduced cardiac conduction velocity and predisposition to arrhythmias in connexin40-deficient mice. Curr. Biol. 1998, 8, 299–302. [Google Scholar] [CrossRef]
- Hagendorff, A.; Schumacher, B.; Kirchhoff, S.; Luderitz, B.; Willecke, K. Conduction disturbances and increased atrial vulnerability in Connexin40-deficient mice analyzed by transesophageal stimulation. Circulation 1999, 99, 1508–1515. [Google Scholar] [CrossRef] [PubMed]
- Leaf, D.E.; Feig, J.E.; Vasquez, C.; Riva, P.L.; Yu, C.; Lader, J.M.; Kontogeorgis, A.; Baron, E.L.; Peters, N.S.; Fisher, E.A.; et al. Connexin40 imparts conduction heterogeneity to atrial tissue. Circ. Res. 2008, 103, 1001–1008. [Google Scholar] [CrossRef] [PubMed]
- Bagwe, S.; Berenfeld, O.; Vaidya, D.; Morley, G.E.; Jalife, J. Altered right atrial excitation and propagation in connexin40 knockout mice. Circulation 2005, 112, 2245–2253. [Google Scholar] [CrossRef] [PubMed]
- Firouzi, M.; Ramanna, H.; Kok, B.; Jongsma, H.J.; Koeleman, B.P.; Doevendans, P.A.; Groenewegen, W.A.; Hauer, R.N. Association of human connexin40 gene polymorphisms with atrial vulnerability as a risk factor for idiopathic atrial fibrillation. Circ. Res. 2004, 95, e29–e33. [Google Scholar] [CrossRef] [PubMed]
- Shi, H.F.; Yang, J.F.; Wang, Q.; Li, R.G.; Xu, Y.J.; Qu, X.K.; Fang, W.Y.; Liu, X.; Yang, Y.Q. Prevalence and spectrum of GJA5 mutations associated with lone atrial fibrillation. Mol. Med. Rep. 2013, 7, 767–774. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Hills, M.D.; Ye, W.G.; Tong, X.; Bai, D. Atrial fibrillation-linked germline GJA5/connexin40 mutants showed an increased hemichannel function. PLoS ONE 2014, 9, e95125. [Google Scholar] [CrossRef] [PubMed]
- Patel, D.; Gemel, J.; Xu, Q.; Simon, A.R.; Lin, X.; Matiukas, A.; Beyer, E.C.; Veenstra, R.D. Atrial fibrillation-associated connexin40 mutants make hemichannels and synergistically form gap junction channels with novel properties. FEBS Lett. 2014, 588, 1458–1464. [Google Scholar] [CrossRef] [PubMed]
- Christophersen, I.E.; Holmegard, H.N.; Jabbari, J.; Sajadieh, A.; Haunso, S.; Tveit, A.; Svendsen, J.H.; Olesen, M.S. Rare variants in GJA5 are associated with early-onset lone atrial fibrillation. Can. J. Cardiol. 2013, 29, 111–116. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Tong, X.; Chen, H.; Huang, T.; Shao, Q.; Huang, W.; Laird, D.W.; Bai, D. An atrial-fibrillation-linked connexin40 mutant is retained in the endoplasmic reticulum and impairs the function of atrial gap-junction channels. Dis. Models Mech. 2014, 7, 561–569. [Google Scholar] [CrossRef] [PubMed]
- Lubkemeier, I.; Andrie, R.; Lickfett, L.; Bosen, F.; Stockigt, F.; Dobrowolski, R.; Draffehn, A.M.; Fregeac, J.; Schultze, J.L.; Bukauskas, F.F.; et al. The Connexin40A96S mutation from a patient with atrial fibrillation causes decreased atrial conduction velocities and sustained episodes of induced atrial fibrillation in mice. J. Mol. Cell. Cardiol. 2013, 65, 19–32. [Google Scholar] [CrossRef] [PubMed]
- Santa Cruz, A.; Mese, G.; Valiuniene, L.; Brink, P.R.; White, T.W.; Valiunas, V. Altered conductance and permeability of Cx40 mutations associated with atrial fibrillation. J. Gen. Physiol. 2015, 146, 387–398. [Google Scholar] [CrossRef] [PubMed]
- Dobrowolski, R.; Sommershof, A.; Willecke, K. Some oculodentodigital dysplasia-associated Cx43 mutations cause increased hemichannel activity in addition to deficient gap junction channels. J. Membr. Biol. 2007, 219, 9–17. [Google Scholar] [CrossRef] [PubMed]
- Lai, A.; Le, D.N.; Paznekas, W.A.; Gifford, W.D.; Jabs, E.W.; Charles, A.C. Oculodentodigital dysplasia connexin43 mutations result in non-functional connexin hemichannels and gap junctions in C6 glioma cells. J. Cell Sci. 2006, 119 Pt 3, 532–541. [Google Scholar] [CrossRef] [PubMed]
- Mese, G.; Sellitto, C.; Li, L.; Wang, H.Z.; Valiunas, V.; Richard, G.; Brink, P.R.; White, T.W. The Cx26-G45E mutation displays increased hemichannel activity in a mouse model of the lethal form of keratitis-ichthyosis-deafness syndrome. Mol. Biol. Cell 2011, 22, 4776–4786. [Google Scholar] [CrossRef] [PubMed]
- Minogue, P.J.; Tong, J.J.; Arora, A.; Russell-Eggitt, I.; Hunt, D.M.; Moore, A.T.; Ebihara, L.; Beyer, E.C.; Berthoud, V.M. A mutant connexin50 with enhanced hemichannel function leads to cell death. Investig. Ophthalmol. Vis. Sci. 2009, 50, 5837–5845. [Google Scholar] [CrossRef] [PubMed]
- Rohr, S. Role of gap junctions in the propagation of the cardiac action potential. Cardiovasc. Res. 2004, 62, 309–322. [Google Scholar] [CrossRef] [PubMed]
- Shaw, R.M.; Rudy, Y. Ionic mechanisms of propagation in cardiac tissue. Roles of the sodium and L-type calcium currents during reduced excitability and decreased gap junction coupling. Circ. Res. 1997, 81, 727–741. [Google Scholar] [CrossRef] [PubMed]
- Zipes, D.P. Mechanisms of clinical arrhythmias. J. Cardiovasc. Electrophysiol. 2003, 14, 902–912. [Google Scholar] [CrossRef] [PubMed]
- Bai, D. Atrial fibrillation-linked GJA5/connexin40 mutants impaired gap junctions via different mechanisms. FEBS Lett. 2014, 588, 1238–1243. [Google Scholar] [CrossRef] [PubMed]
- Lin, X.; Gemel, J.; Beyer, E.C.; Veenstra, R.D. Dynamic model for ventricular junctional conductance during the cardiac action potential. Am. J. Physiol. Heart Circ. Physiol. 2005, 288, H1113–H1123. [Google Scholar] [CrossRef] [PubMed]
- Verheule, S.; van Kempen, M.J.A.; Postma, S.; Rook, M.B.; Jongsma, H.J. Gap junctions in the rabbit sinoatrial node. Am. J. Physiol.-Heart Circul. Physiol. 2001, 280, H2103–H2115. [Google Scholar] [CrossRef] [PubMed]
- Hennemann, H.; Suchyna, T.; Lichtenberg-Frate, H.; Jungbluth, S.; Dahl, E.; Schwarz, J.; Nicholson, B.J.; Willecke, K. Molecular cloning and functional expression of mouse connexin40, a second gap junction gene preferentially expressed in lung. J. Cell Biol. 1992, 117, 1299–1310. [Google Scholar] [CrossRef] [PubMed]
- Bruzzone, R.; Haefliger, J.A.; Gimlich, R.L.; Paul, D.L. Connexin40, a component of gap junctions in vascular endothelium, is restricted in its ability to interact with other connexins. Mol. Biol. Cell 1993, 4, 7–20. [Google Scholar] [CrossRef] [PubMed]
- Ye, W.G.; Yue, B.; Aoyama, H.; Kim, N.K.; Cameron, J.A.; Chen, H.; Bai, D. Junctional delay, frequency, and direction-dependent uncoupling of human heterotypic Cx45/Cx43 gap junction channels. J. Mol. Cell. Cardiol. 2017, 111, 17–26. [Google Scholar] [CrossRef] [PubMed]
- Saffitz, J.E. Connexins, conduction, and atrial fibrillation. N. Engl. J. Med. 2006, 354, 2712–2714. [Google Scholar] [CrossRef] [PubMed]
- Darbar, D.; Kannankeril, P.J.; Donahue, B.S.; Kucera, G.; Stubblefield, T.; Haines, J.L.; George, A.L., Jr.; Roden, D.M. Cardiac sodium channel (SCN5A) variants associated with atrial fibrillation. Circulation 2008, 117, 1927–1935. [Google Scholar] [CrossRef] [PubMed]
- Jassim, A.; Aoyama, H.; Ye, W.G.; Chen, H.; Bai, D. Engineered Cx40 variants increased docking and function of heterotypic Cx40/Cx43 gap junction channels. J. Mol. Cell. Cardiol. 2016, 90, 11–20. [Google Scholar] [CrossRef] [PubMed]
Cells Expressing | Vj Polarity | Gmin | V0 (mV) | A |
---|---|---|---|---|
Cx40 (n = 7) | + | 0.25 ± 0.02 | 40.2 ± 1.4 | 0.15 ± 0.05 |
− | 0.27 ± 0.02 | 42.9 ± 1.4 | 0.19 ± 0.07 | |
K107R (n = 5) | + | 0.21 ± 0.03 | 38.6 ± 1.6 | 0.15 ± 0.05 |
− | 0.23 ± 0.03 | 41.1 ± 1.9 | 0.15 ± 0.05 | |
L223M (n = 5) | + | 0.24 ± 0.02 | 40.2± 1.0 | 0.20 ± 0.10 |
− | 0.31 ± 0.03 | 43.2 ± 1.8 | 0.17 ± 0.06 | |
Q236H (n = 6) | + | 0.20 ± 0.02 | 33.3 ± 1.7 *,1 | 0.19 ± 0.04 |
− | 0.24 ± 0.02 | 35.2 ± 2.0 * | 0.15 ± 0.04 | |
I257L (n = 5) | + | 0.24 ± 0.03 | 40.9 ± 2.2 | 0.12 ± 0.03 |
− | 0.24 ± 0.03 | 43.4 ± 2.2 | 0.17 ± 0.08 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Noureldin, M.; Chen, H.; Bai, D. Functional Characterization of Novel Atrial Fibrillation-Linked GJA5 (Cx40) Mutants. Int. J. Mol. Sci. 2018, 19, 977. https://doi.org/10.3390/ijms19040977
Noureldin M, Chen H, Bai D. Functional Characterization of Novel Atrial Fibrillation-Linked GJA5 (Cx40) Mutants. International Journal of Molecular Sciences. 2018; 19(4):977. https://doi.org/10.3390/ijms19040977
Chicago/Turabian StyleNoureldin, Mahmoud, Honghong Chen, and Donglin Bai. 2018. "Functional Characterization of Novel Atrial Fibrillation-Linked GJA5 (Cx40) Mutants" International Journal of Molecular Sciences 19, no. 4: 977. https://doi.org/10.3390/ijms19040977