The SBP-Box Gene VpSBP11 from Chinese Wild Vitis Is Involved in Floral Transition and Affects Leaf Development
Abstract
:1. Introduction
2. Results
2.1. Cloning and Sequence Analysis of VpSBP11
2.2. Subcellular Localization and Function of VpSBP11 in Transcriptional Activation
2.3. The Effect of an VpSBP11 Transgene on Flowering Time
2.4. Over-Expression of VpSBP11 Upregulated LFY, FUL and AP1
2.5. Regulation of the Vegetative Phase Change
2.6. Spatial VpSBP11 Expression Pattern
3. Discussion
3.1. VpSBP11 Sequence Analysis
3.2. The Grape VpSBP11 Gene Regulated Flowering Time and Affected Leaf Development
3.3. VpSBP11 Regulated Expression of Floral Meristem Identity Genes
4. Materials and Methods
4.1. Plant Material and Treatments
4.2. Cloning of VpSBP11 and Sequence Analysis
4.3. Quantitative Real-Time RT-PCR Analysis
4.4. Subcellular Localization
4.5. Trans-Activation Assay
4.6. Generation of Transgenic A. thaliana Plants Over-Expressing the Grapevine VpSBP11 Gene
4.7. Observation of Morphology of VpSBP11 Over-Expression Strains and Wild Type
4.8. Statistical Analysis
5. Conclusions
Supplementary Materials
Acknowledgments
Author Contributions
Conflicts of Interest
Abbreviations
SBP | Squamosa promoter binding protein |
AP1 | Apetala1 |
FUL | Fruitfull |
LFY | Leafy |
UTR | Untranslated region |
NLS | Nuclear localization signal |
WT | Wild-type |
References
- Simpson, G.G.; Dean, C. Environmental-dependent acceleration of a developmental switch: The floral transition. Sci. STKE 2000, 2000, pe1. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.H.; Lee, J.S.; Ahn, J.H. Ambient temperature signaling in plants: An emerging field in the regulation of flowering time. J. Plant Biol. 2008, 51, 321–326. [Google Scholar] [CrossRef]
- Wellmer, F.; Riechmann, J.L. Gene networks controlling the initiation of flower development. Trends Genet. 2010, 26, 519–527. [Google Scholar] [CrossRef] [PubMed]
- Fornara, F.; de Montaigu, A.; Coupland, G. Snap Shot: Control of flowering in Arabidopsis. Cell 2010, 141, 550. [Google Scholar] [CrossRef] [PubMed]
- Abe, M.; Kobayashi, Y.; Yamamoto, S.; Daimon, Y.; Yamaguchi, A.; Ikeda, Y.; Ichinoki, H.; Notaguchi, M.; Goto, K.; Araki, T. FD, a bZIP protein mediating signals from the floral pathway integrator FT at the shoot apex. Science 2005, 309, 1052–1056. [Google Scholar] [CrossRef] [PubMed]
- Kardailsky, I.; Shukia, V.K.; Ahn, J.H.; Dagenais, N.; Christensen, S.K.; Nguyen, J.T.; Chory, J.; Harrison, M.J.; Weigel, D. Activation tagging of the floral inducer FT. Science 1999, 286, 1962–1965. [Google Scholar] [CrossRef] [PubMed]
- Turck, F.; Fornara, F.; Coupland, G. Regulation and identity of florigen: FLOWERING LOCUS T moves center stage. Annu. Rev. Plant Biol. 2008, 59, 573–594. [Google Scholar] [CrossRef] [PubMed]
- Samach, A.; Onouchi, H.; Gold, S.E.; Ditta, G.S.; Schwarz-Sommer, Z.; Yanofsky, M.F.; Coupland, G. Distinct roles of CONSTANS target genes in reproductive development of Arabidopsis. Science 2000, 288, 1613–1616. [Google Scholar] [CrossRef] [PubMed]
- Schultz, E.A.; Haughn, G.W. LEAFY, a homeotic gene that regulates inflorescence development in Arabidopsis. Plant Cell 1991, 3, 771–781. [Google Scholar] [CrossRef] [PubMed]
- Huijser, P.; Klein, J.; Lonnig, W.E.; Meijer, H.; Saedler, H. Bracteomania, an inflorescence anomaly, is caused by the loss of function of the MADS-box gene squamosa in Antirrhinum majus. EMBO J. 1992, 11, 1239–1249. [Google Scholar] [PubMed]
- Mandel, M.A.; Gustafson-Brown, C.; Savidge, B.; Yanofsky, M.F. Molecular characterization of the Arabidopsis floral homeotic gene APETALA1. Nature 1992, 360, 273–277. [Google Scholar] [CrossRef] [PubMed]
- Ferrandiz, C.; Gu, Q.; Martienssen, R.; Yanofsky, M.F. Redundant regulation of meristem identity and plant architecture by FRUITFULL, APETALA1 and CAULIFLOWER. Development 2000, 127, 725–734. [Google Scholar] [PubMed]
- Cardon, G.; Hohmann, S.; Klein, J.; Nettesheim, K.; Saedler, H.; Huijser, P. Functional analysis of the Arabidopsis thaliana SBP-box gene SPL3: A novel gene involved in the floral transition. Plant J. 1997, 12, 367–377. [Google Scholar] [CrossRef] [PubMed]
- Yamasaki, K.; Kigawa, T.; Inoue, M.; Tateno, M.; Yamasaki, T.; Yabuki, T.; Aoki, M.; Seki, E.; Matsuda, T.; Nunokawa, E.; et al. A novel zinc-binding motif revealed by solution structures of DNA-binding domains of Arabidopsis SBP-family transcription factors. J. Mol. Biol. 2004, 337, 49–63. [Google Scholar] [CrossRef] [PubMed]
- Klein, J.; Saedler, H.; Huijser, P. A new family of DNA binding proteins includes putative transcriptional regulators of the Antirrhinum majus floral meristem identity gene SQUAMOSA. Mol. Genet. Genom. 1996, 250, 7–16. [Google Scholar]
- Xu, M.; Hu, T.; Zhao, J.; Park, M.Y.; Earley, K.W.; Wu, G.; Yang, L.; Poethig, R.S. Developmental functions of miR156-regulated SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) genes in Arabidopsis thaliana. PLoS Genet. 2016, 12, e1006263. [Google Scholar] [CrossRef] [PubMed]
- Wu, G.; Poethig, R.S. Temporal regulation of shoot development in Arabidopsis thaliana by miR156 and its target SPL3. Development 2006, 133, 3539–3547. [Google Scholar] [CrossRef] [PubMed]
- Schwarz, S.; Grande, A.V.; Bujdoso, N.; Saedler, H.; Huijser, P. The microRNA regulated SBP-box genes SPL9 and SPL15 control shoot maturation in Arabidopsis. Plant Mol. Biol. 2008, 67, 183–195. [Google Scholar] [CrossRef] [PubMed]
- Usami, T.; Horiguchi, G.; Yano, S.; Tsukaya, H. The more and smaller cells mutants of Arabidopsis thaliana identify novel roles for SQUAMOSA PROMOTER BINDING PROTEIN-LIKE genes in the control of heteroblasty. Development 2009, 136, 955–964. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Hu, Z.; Yang, Y.; Chen, X.; Chen, G. Function annotation of an SBP-box gene in Arabidopsis based on analysis of co-expression networks and promoters. Int. J Mol. Sci. 2009, 10, 116–132. [Google Scholar] [CrossRef] [PubMed]
- Yamaguchi, A.; Wu, M.F.; Yang, L.; Wu, G.; Poethig, R.S.; Wagner, D. The microRNA-regulated SBP-Box transcription factor SPL3 is a direct upstream activator of LEAFY, FRUITFULL, and APETALA1. Dev. Cell 2009, 17, 268–278. [Google Scholar] [CrossRef] [PubMed]
- Preston, J.C.; Jorgensen, S.A.; Orozco, R.; Hileman, L.C. Paralogous SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) genes differentially regulate leaf initiation and reproductive phase change in petunia. Planta 2016, 243, 429–440. [Google Scholar] [CrossRef] [PubMed]
- Jung, J.H.; Seo, P.J.; Kang, S.K.; Park, C.M. miR172 signals are incorporated into the miR156 signaling pathway at the SPL3/4/5 genes in Arabidopsis developmental transitions. Plant Mol. Biol. 2011, 76, 35–45. [Google Scholar] [CrossRef] [PubMed]
- Shikata, M.; Koyama, T.; Mitsuda, N.; Ohme-Takagi, M. Arabidopsis SBP-box genes SPL10, SPL11 and SPL2 control morphological change in association with shoot maturation in the reproductive phase. Plant Cell Physiol. 2009, 50, 2133–2145. [Google Scholar] [CrossRef] [PubMed]
- Miura, K.; Ikeda, M.; Matsubara, A.; Song, X.J.; Ito, M.; Asano, K.; Matsuoka, M.; Kitano, H.; Ashikari, M. OsSPL14 promotes panicle branching and higher grain productivity in rice. Nat. Genet. 2010, 42, 545–549. [Google Scholar] [CrossRef] [PubMed]
- Chuck, G.; Whipple, C.; Jackson, D.; Hake, S. The maize SBP-box transcription factor encoded by tasselsheath4 regulates bract development and the establishment of meristem boundaries. Development 2010, 137, 1243–1250. [Google Scholar] [CrossRef] [PubMed]
- Manning, K.; Tör, M.; Poole, M.; Hong, Y.; Thompson, A.J.; King, G.J.; Giovannoni, J.J.; Seymour, G.B. A naturally occurring epigenetic mutation in a gene encoding an SBP-box transcription factor inhibits tomato fruit ripening. Nat. Genet. 2006, 38, 948–952. [Google Scholar] [CrossRef] [PubMed]
- Martin, R.C.; Asahina, M.; Liu, P.P.; Kristof, J.R.; Coppersmith, J.L.; Pluskota, W.E.; Bassel, G.W.; Goloviznina, N.A.; Nguyen, T.T.; Martínez-Andújar, C. The regulation of post-germinative transition from the cotyledon-to vegetative-leaf stages by microRNA-targeted SQUAMOSA PROMOTER-BINDING PROTEIN LIKE13 in Arabidopsis. Seed Sci. Res. 2010, 20, 89–96. [Google Scholar] [CrossRef]
- Wang, H.; Nussbaum-Wagler, T.; Li, B.; Zhao, Q.; Vigouroux, Y.; Faller, M.; Bomblies, K.; Lukens, L.; Doebley, J.F. The origin of the naked grains of maize. Nature 2005, 436, 714–719. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Wu, K.; Yuan, Q.; Liu, X.; Liu, Z.; Lin, X.; Zeng, R.; Zhu, H.; Dong, G.; Qian, Q. Control of grain size, shape and quality by OsSPL16 in rice. Nat. Genet. 2012, 44, 950–954. [Google Scholar] [CrossRef] [PubMed]
- Han, H.; Liu, G.; Zhang, J.; Zhang, S.; Cai, F.; Bao, Z.; Zhang, Y.; Bao, M. Four SQUAMOSA PROMOTER BINDING PROTEIN-LIKE homologs from a basal eudicot tree (Platanus acerifolia) show diverse expression pattern and ability of inducing early flowering in Arabidopsis. Trees 2016, 30, 1417–1428. [Google Scholar] [CrossRef]
- Kreamer, R. US table grape exports scoring big in world markets. Agris Export. 1995, 7, 16–17. [Google Scholar]
- Wang, Y.; Liu, Y.; He, P.; Chen, J.; Lamikanra, O.; Lu, J. Evaluation of foliar resistance to Uncinula necator in Chinese wild Vitis species. Vitis 1995, 34, 159–164. [Google Scholar]
- Hou, H.; Li, J.; Gao, M.; Singer, S.D.; Wang, H.; Mao, L.; Fei, Z.; Wang, X. Genomic organization, phylogenetic comparison and differential expression of the SBP-Box family genes in grape. PLoS ONE 2013, 8, e59358. [Google Scholar] [CrossRef] [PubMed]
- Gandikota, M.; Birkenbihl, R.P.; Höhmann, S.; Cardon, G.H.; Saedler, H.; Huijser, P. The miRNA156/157 recognition element in the 3′UTR of the Arabidopsis SBP box gene SPL3 prevents early flowering by translational inhibition in seedlings. Plant J. 2007, 49, 683–693. [Google Scholar] [CrossRef] [PubMed]
- Xie, K.; Wu, C.; Xiong, L. Genomic organization, differential expression, and interaction of SQUAMOSA promoter-binding-like transcription factors and microRNA156 in rice. Plant Physiol. 2006, 142, 280–293. [Google Scholar] [CrossRef] [PubMed]
- Hempel, F.D.; Weigel, D.; Mandel, M.A.; Ditta, G.; Zambryski, P.C.; Feldman, L.J.; Yanofsky, M.F. Floral determination and expression of floral regulatory genes in Arabidopsis. Development 1997, 124, 3845–3853. [Google Scholar] [PubMed]
- Bomblies, K.; Doebley, J.F. Molecular evolution of FLORICAULA/LEAFY orthologs in the Andropogoneae (Poaceae). Mol. Biol. Evol. 2005, 22, 1082–1094. [Google Scholar] [CrossRef] [PubMed]
- Rao, N.N.; Prasad, K.; Kumar, P.R.; Vijayraghavan, U. Distinct regulatory role for RFL, the rice LFY homolog, in determining flowering time and plant architecture. Proc. Natl. Acad. Sci. USA 2008, 105, 3646–3651. [Google Scholar] [CrossRef] [PubMed]
- Teperbamnolker, P.; Samach, A. The flowering integrator FT regulates SEPALLATA3 and FRUITFULL accumulation in Arabidopsis leaves. Plant Cell 2005, 17, 2661–2675. [Google Scholar] [CrossRef] [PubMed]
- Jinjin, Z.; Yuejin, W.; Xiping, W.; Keqiang, Y.; Jinxiao, Y. An improved method for rapidly extracting total RNA from Vitis. J. Fruit Sci. 2003, 3, 178–189. (In Chinese) [Google Scholar]
- Gao, M.; Niu, J.; Zhao, S.; Jiao, C.; Xu, W.; Fei, Z.; Wang, X. Characterization of Erysiphe necator-responsive genes in Chinese wild Vitis quinquangularis. Int. J. Mol. Sci. 2012, 13, 11497–11519. [Google Scholar] [CrossRef] [PubMed]
- Mare, C.; Mazzucotelli, E.; Crosatti, C.; Francia, E.; Stanca, A.M.; Cattivelli, L. Hv-WRKY38: A new transcription factor involved in cold- and drought-response in barley. Plant Mol. Biol. 2004, 55, 399–416. [Google Scholar] [CrossRef] [PubMed]
- Fujita, M.; Fujita, Y.; Maruyama, K.; Seki, M.; Hiratsu, K.; Ohme-Takagi, M.; Tran, L.S.P.; Yamaguchi-Shinozaki, K.; Shinozaki, K. A dehydration-induced NAC protein, RD26, is involved in a novel ABA-dependent stress-signaling pathway. Plant J. 2004, 39, 863–876. [Google Scholar] [CrossRef] [PubMed]
- Clough, S.J.; Bent, A.F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998, 16, 735–743. [Google Scholar] [CrossRef] [PubMed]
- Schultz, E.R.; Kelley, K.L.; Paul, A.L.; Ferl, R.J. A method for preparing spaceflight RNA later-fixed Arabidopsis thaliana (Brassicaceae) tissue for scanning electron microscopy. Appl. Plant Sci. 2013, 1, 1300034. [Google Scholar] [CrossRef] [PubMed]
- Cheng, C.; Xu, X.; Singer, S.D.; Li, J.; Zhang, H.; Gao, M.; Wang, L.; Song, J.; Wang, X. Effect of GA3 treatment on seed development and seed-related gene expression in grape. PLoS ONE 2013, 8, e80044. [Google Scholar] [CrossRef] [PubMed]
Primer Pairs | Forward and Reverse Primers (5′–3′) | Restriction Enzyme Cutting Site |
---|---|---|
VpSBP11-F1 | F:ATGGAAGCTAAGAAGATGGT | none |
VpSBP11-R1 | R:TCATCTGATCTGGAAATGC | none |
VpSBP11-F2 | F:TCCGGCAGCGCTTCTGTCAGC | none |
VpSBP11-R2 | R:TCAGCTGAGTCCTTTCTGCGCCT | none |
AtLFY-F | F:ACGCCGTCATTTGCTACTCT | none |
AtLFY-R | R:CTTTCTCCGTCTCTGCTGCT | none |
AtFUL-F | F:TTGCAAGATCACAACAATTCGCTTCT | none |
AtFUL-R | R:GAGAGTTTGGTTCCGTCAACGACGAT | none |
AtAP1-F | F:GAAGGCCATACAGGAGCAAA | none |
AtAP1-R | R:GGACAACGGAATCTCTCAGC | none |
AtActin1-F | F:AGGCACCTCTTAACCCTAAAGC | none |
AtActin1-R | R:ACTGCTCCTGTTGAGCCCTA | none |
VpSBP11-F3 | F:CGCTCTAGAATGGAAGCTAAGAAGATGGTGA | XbaI site underlined |
VpSBP11-R3 | R:GGCGGTACCTCTGATCTGGAAATGCTTGTAAG | KpnI site underlined |
VpSBP11-F4 | F:CGTCCCGGGATGGAAGCTAAGAAGATGGT | XmaI site underlined |
VpSBP11-R4 | R:GGCGGATCCTCATCTGATCTGGAAATGCTTG | BamHI site underlined |
Gal4-F | F:GGGCCATGGTAATGAAGCTACTGTCTTCTAT | NcoI site underlined |
Gal4-R | R:GGGGGATCCTTACTCTTTTTTTGGGTTTG | BamHI site underlined |
VpSBP11-F5 | F:CACGGATCCATGGAAGCTAAGAAGATGGTGA | BamHI site underlined |
VpSBP11-R5 | R:GGCGGTACCTCATCTGATCTGGAAATGCTTG | KpnI site underlined |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hou, H.; Yan, X.; Sha, T.; Yan, Q.; Wang, X. The SBP-Box Gene VpSBP11 from Chinese Wild Vitis Is Involved in Floral Transition and Affects Leaf Development. Int. J. Mol. Sci. 2017, 18, 1493. https://doi.org/10.3390/ijms18071493
Hou H, Yan X, Sha T, Yan Q, Wang X. The SBP-Box Gene VpSBP11 from Chinese Wild Vitis Is Involved in Floral Transition and Affects Leaf Development. International Journal of Molecular Sciences. 2017; 18(7):1493. https://doi.org/10.3390/ijms18071493
Chicago/Turabian StyleHou, Hongmin, Xiaoxiao Yan, Ting Sha, Qin Yan, and Xiping Wang. 2017. "The SBP-Box Gene VpSBP11 from Chinese Wild Vitis Is Involved in Floral Transition and Affects Leaf Development" International Journal of Molecular Sciences 18, no. 7: 1493. https://doi.org/10.3390/ijms18071493