RUNX1 Plays an Important Role in Mediating BMP9-Induced Osteogenic Differentiation of Mesenchymal Stem Cells Line C3H10T1/2, Murine Multi-Lineage Cells Lines C2C12 and MEFs
Abstract
:1. Introduction
2. Results
2.1. RUNX1 Is Upregulated by BMP9 in MSCs and MMCs
2.2. RUNX1 Is a Direct Target of BMP9/Smad Signaling Pathway
2.3. Effect of RUNX1 on BMP9-Induced Early Osteogenic Marker-Alkaline Phosphatase (ALP)
2.4. Effect of RUNX1 on BMP9-Induced Late Osteogenic Differentiation
2.5. Effect of RUNX1 on BMP9-Induced mRNA Expression Levels of Pivotal Osteogenic Markers
2.6. Effect of RUNX1 on BMP9-Induced Protein Expression Levels of Pivotal Osteogenic Markers
2.7. Effect of RUNX1 on BMP9-Induced Classical Smad1/5/8 Signaling and MAPKs Signaling
3. Discussion
4. Materials and Methods
4.1. Cell Lines and Chemicals
4.2. Construction of Recombinant Adenoviruses
4.3. Cell Culture
4.4. Preparation of Conditioned Medium
4.5. Chromatin Immunoprecipitation (ChIP) Analysis
4.6. Alkaline Phosphatase (ALP) Assays
4.7. Measurement of Matrix Mineralization
4.8. Total RNA Isolation, Semi-Quantitative PCR (RT-PCR) and Quantitative Real-Time PCR (RT-qPCR)
4.9. Western Blot
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Bakhshandeh, B.; Soleimani, M.; Ghaemi, N.; Shabani, I. Effective combination of aligned nanocomposite nanofibers and human unrestricted somatic stem cells for bone tissue engineering. Acta Pharmacol. Sin. 2011, 32, 626–636. [Google Scholar] [CrossRef] [PubMed]
- Sarikaya, B.; Aydin, H.M. Collagen/β-Tricalcium Phosphate Based Synthetic Bone Grafts via Dehydrothermal Processing. BioMed Res. Int. 2015, 2015, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Gholizadeh, S.; Moztarzadeh, F.; Haghighipour, N.; Ghazizadeh, L.; Baghbani, F.; Shokrgozar, M.A.; Allahyari, Z. Preparation and characterization of novel functionalized multiwalled carbon nanotubes/chitosan/β-Glycerophosphate scaffolds for bone tissue engineering. Int. J. Biol. Macromol. 2017, 97, 365–372. [Google Scholar] [CrossRef] [PubMed]
- Gibon, E.; Lu, L.; Goodman, S.B. Aging, inflammation, stem cells, and bone healing. Stem Cell Res. Ther. 2016, 7, 44. [Google Scholar] [CrossRef] [PubMed]
- Owston, H.; Giannoudis, P.V.; Jones, E. Do skeletal muscle MSCs in humans contribute to bone repair? A systematic review. Injury 2016, 47, S3–S15. [Google Scholar] [CrossRef]
- Pittenger, M.F.; Mackay, A.M.; Beck, S.C.; Jaiswal, R.K.; Douglas, R.; Mosca, J.D.; Moorman, M.A.; Simonetti, D.W.; Craig, S.; Marshak, D.R. Multilineage potential of adult human mesenchymal stem cells. Science 1999, 284, 143–147. [Google Scholar] [CrossRef] [PubMed]
- Molofsky, A.V.; Pardal, R.; Morrison, S.J. Diverse mechanisms regulate stem cell self-renewal. Curr. Opin. Cell Biol. 2004, 16, 700–707. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Gomez, I.; Elvira, G.; Zapata, A.G.; Lamana, M.L.; Ramirez, M.; Castro, J.G.; Arranz, M.G.; Vicente, A.; Bueren, J.; Garcia-Olmo, D. Mesenchymal stem cells: Biological properties and clinical applications. Expert Opin. Biol. Ther. 2010, 10, 1453–1468. [Google Scholar] [CrossRef] [PubMed]
- Myers, T.J.; Granero-Molto, F.; Longobardi, L.; Li, T.; Yan, Y.; Spagnoli, A. Mesenchymal stem cells at the intersection of cell and gene therapy. Expert Opin. Biol. Ther. 2010, 10, 1663–1679. [Google Scholar] [CrossRef] [PubMed]
- Arthur, A.; Zannettino, A.; Gronthos, S. The therapeutic applications of multipotential mesenchymal/stromal stem cells in skeletal tissue repair. J. Cell Physiol. 2009, 218, 237–245. [Google Scholar] [CrossRef] [PubMed]
- Trombi, L.; Danti, S.; Savelli, S.; Moscato, S.; D’Alessandro, D.; Ricci, C.; Giannotti, S.; Petrini, M. Mesenchymal Stromal Cell Culture and Delivery in Autologous Conditions: A Smart Approach for Orthopedic Applications. J. Vis. Exp. 2016, 118, e54845. [Google Scholar] [CrossRef] [PubMed]
- Chen, D.; Zhao, M.; Mundy, G.R. Bone morphogenetic proteins. Growth Factors 2004, 22, 233–241. [Google Scholar] [CrossRef] [PubMed]
- Hogan, B.L. Bone morphogenetic proteins: Multifunctional regulators of vertebrate development. Genes Dev. 1996, 10, 1580–1594. [Google Scholar] [CrossRef] [PubMed]
- Luu, H.H.; Song, W.X.; Luo, X.; Manning, D.; Luo, J.; Deng, Z.L.; Sharff, K.A.; Montag, A.G.; Haydon, R.C.; He, T.C. Distinct roles of bone morphogenetic proteins in osteogenic differentiation of mesenchymal stem cells. J. Orthop. Res. 2007, 25, 665–677. [Google Scholar] [CrossRef] [PubMed]
- Hakki, S.S.; Bozkurt, B.; Hakki, E.E.; Kayis, S.A.; Turac, G.; Yilmaz, I.; Karaoz, E. Bone morphogenetic protein-2, -6, and -7 differently regulate osteogenic differentiation of human periodontal ligament stem cells. J. Biomed. Mater. Res. B Appl. Biomater. 2014, 102, 119–130. [Google Scholar] [CrossRef] [PubMed]
- Varady, P.; Li, J.Z.; Alden, T.D.; Kallmes, D.F.; Williams, M.B.; Helm, G.A. CT and radionuclide study of BMP-2 gene therapy-induced bone formation. Acad. Radiol. 2002, 9, 632–637. [Google Scholar] [CrossRef]
- Friedlaender, G.E.; Perry, C.R.; Cole, J.D.; Cook, S.D.; Cierny, G.; Muschler, G.F.; Zych, G.A.; Calhoun, J.H.; LaForte, A.J.; Yin, S. Osteogenic protein-1 (bone morphogenetic protein-7) in the treatment of tibial nonunions. J. Bone Jt. Surg. Am. 2001, 83, S151–S158. [Google Scholar] [CrossRef]
- Boraiah, S.; Paul, O.; Hawkes, D.; Wickham, M.; Lorich, D.G. Complications of recombinant human BMP-2 for treating complex tibial plateau fractures: a preliminary report. Clin. Orthop. Relat. Res. 2009, 467, 3257–3262. [Google Scholar] [CrossRef] [PubMed]
- Rutherford, R.B.; Nussenbaum, B.; Krebsbach, P.H. Bone morphogenetic protein 7 ex vivo gene therapy. Drug News Perspect. 2003, 16, 5–10. [Google Scholar] [CrossRef] [PubMed]
- Kang, Q.; Sun, M.H.; Cheng, H.; Peng, Y.; Montag, A.G.; Deyrup, A.T.; Jiang, W.; Luu, H.H.; Luo, J.; Szatkowski, J.P.; et al. Characterization of the distinct orthotopic bone-forming activity of 14 BMPs using recombinant adenovirus-mediated gene delivery. Gene Ther. 2004, 11, 1312–1320. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Li, X.; Li, Y.; Southwood, M.; Ye, L.; Long, L.; Al-Lamki, R.S.; Morrell, N.W. Id proteins are critical downstream effectors of BMP signaling in human pulmonary arterial smooth muscle cells. Am. J. Physiol. Lung Cell. Mol. Physiol. 2013, 305, L312–L321. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Weng, Y.; Yuan, T.; Zhang, H.; Bai, H.; Li, B.; Yang, D.; Zhang, R.; He, F.; Yan, S.; et al. CXCL12/CXCR4 signal axis plays an important role in mediating bone morphogenetic protein 9-induced osteogenic differentiation of mesenchymal stem cells. Int. J. Med. Sci. 2013, 10, 1181–1192. [Google Scholar] [CrossRef] [PubMed]
- Hojo, H.; Ohba, S.; He, X.; Lai, L.P.; McMahon, A.P. Sp7/Osterix Is Restricted to Bone-Forming Vertebrates where It Acts as a Dlx Co-factor in Osteoblast Specification. Dev. Cell 2016, 37, 238–253. [Google Scholar] [CrossRef] [PubMed]
- Xu, D.J.; Zhao, Y.Z.; Wang, J.; He, J.W.; Weng, Y.G.; Luo, J.Y. Smads, p38 and ERK1/2 are involved in BMP9-induced osteogenic differentiation of C3H10T1/2 mesenchymal stem cells. BMB Rep. 2012, 45, 247–252. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Jiang, W.; Huang, J.; He, B.C.; Zuo, G.W.; Zhang, W.; Luo, Q.; Shi, Q.; Zhang, B.Q.; Wagner, E.R.; et al. Insulin-like growth factor 2 (IGF-2) potentiates BMP-9-induced osteogenic differentiation and bone formation. J. Bone Miner. Res. 2010, 25, 2447–2459. [Google Scholar] [CrossRef] [PubMed]
- Song, T.; Wang, W.; Xu, J.; Zhao, D.; Dong, Q.; Li, L.; Yang, X.; Duan, X.; Liang, Y.; Xiao, Y.; et al. Fibroblast growth factor 2 inhibits bone morphogenetic protein 9-induced osteogenic differentiation of mesenchymal stem cells by repressing Smads signaling and subsequently reducing Smads dependent up-regulation of ALK1 and ALK2. Int. J. Biochem. Cell Biol. 2013, 45, 1639–1646. [Google Scholar] [CrossRef] [PubMed]
- Luo, J.; Tang, M.; Huang, J.; He, B.C.; Gao, J.L.; Chen, L.; Zuo, G.W.; Zhang, W.; Luo, Q.; Shi, Q.; et al. TGFβ/BMP type I receptors ALK1 and ALK2 are essential for BMP9-induced osteogenic signaling in mesenchymal stem cells. J. Biol. Chem. 2010, 285, 29588–29598. [Google Scholar] [CrossRef] [PubMed]
- Song, Q.; Zhong, L.; Chen, C.; Tang, Z.; Liu, H.; Zhou, Y.; Tang, M.; Zhou, L.; Zuo, G.; Luo, J.; et al. miR-21 synergizes with BMP9 in osteogenic differentiation by activating the BMP9/Smad signaling pathway in murine multilineage cells. Int. J. Mol. Med. 2015, 36, 1497–1506. [Google Scholar] [CrossRef] [PubMed]
- Choi, J.Y.; Pratap, J.; Javed, A.; Zaidi, S.K.; Xing, L.; Balint, E.; Dalamangas, S.; Boyce, B.; van Wijnen, A.J.; Lian, J.B.; et al. Subnuclear targeting of Runx/Cbfa/AML factors is essential for tissue-specific differentiation during embryonic development. Proc. Natl. Acad. Sci. USA 2001, 98, 8650–8655. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Belflower, R.M.; Dong, Y.F.; Schwarz, E.M.; O′Keefe, R.J.; Drissi, H. Runx1/AML1/Cbfa2 mediates onset of mesenchymal cell differentiation toward chondrogenesis. J. Bone Miner. Res. 2005, 20, 1624–1636. [Google Scholar] [CrossRef] [PubMed]
- Qin, X.; Jiang, Q.; Matsuo, Y.; Kawane, T.; Komori, H.; Moriishi, T.; Taniuchi, I.; Ito, K.; Kawai, Y.; Rokutanda, S.; et al. Cbfb regulates bone development by stabilizing Runx family proteins. J. Bone Miner. Res. 2015, 30, 706–714. [Google Scholar] [CrossRef] [PubMed]
- Yoshida, C.A.; Komori, T. Role of Runx proteins in chondrogenesis. Crit. Rev. Eukaryot. Gene Expr. 2005, 15, 243–254. [Google Scholar] [CrossRef] [PubMed]
- Liakhovitskaia, A.; Lana-Elola, E.; Stamateris, E.; Rice, D.P.; van’t Hof, R.J.; Medvinsky, A. The essential requirement for Runx1 in the development of the sternum. Dev. Biol. 2010, 340, 539–546. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.; Tang, Z.; Song, Q.; Yang, M.; Shi, Q.; Weng, Y. Downregulated microRNA-23b promotes BMP9-mediated osteogenesis in C2C12 myoblast cells by targeting Runx2. Mol. Med. Rep. 2016, 13, 2492–2498. [Google Scholar] [CrossRef] [PubMed]
- Peng, Y.; Kang, Q.; Luo, Q.; Jiang, W.; Si, W.; Liu, B.A.; Luu, H.H.; Park, J.K.; Li, X.; Luo, J.; et al. Inhibitor of DNA binding/differentiation helix-loop-helix proteins mediate bone morphogenetic protein-induced osteoblast differentiation of mesenchymal stem cells. J. Biol. Chem. 2004, 279, 32941–32949. [Google Scholar] [CrossRef] [PubMed]
- Luo, Q.; Kang, Q.; Si, W.; Jiang, W.; Park, J.K.; Peng, Y.; Li, X.; Luu, H.H.; Luo, J.; Montag, A.G.; et al. Connective tissue growth factor (CTGF) is regulated by Wnt and bone morphogenetic proteins signaling in osteoblast differentiation of mesenchymal stem cells. J. Biol. Chem. 2004, 279, 55958–55968. [Google Scholar] [CrossRef] [PubMed]
- Sharff, K.A.; Song, W.X.; Luo, X.; Tang, N.; Luo, J.; Chen, J.; Bi, Y.; He, B.C.; Huang, J.; Li, X.; et al. Hey1 basic helix-loop-helix protein plays an important role in mediating BMP9-induced osteogenic differentiation of mesenchymal progenitor cells. J. Biol. Chem. 2009, 284, 649–659. [Google Scholar] [CrossRef] [PubMed]
- Hu, N.; Jiang, D.; Huang, E.; Liu, X.; Li, R.; Liang, X.; Kim, S.H.; Chen, X.; Gao, J.L.; Zhang, H.; et al. BMP9-regulated angiogenic signaling plays an important role in the osteogenic differentiation of mesenchymal progenitor cells. J. Cell Sci. 2013, 126, 532–541. [Google Scholar] [CrossRef] [PubMed]
- David, L.; Mallet, C.; Keramidas, M.; Lamande, N.; Gasc, J.M.; Dupuis-Girod, S.; Plauchu, H.; Feige, J.J.; Bailly, S. Bone morphogenetic protein-9 is a circulating vascular quiescence factor. Circ. Res. 2008, 102, 914–922. [Google Scholar] [CrossRef] [PubMed]
- Song, J.J.; Celeste, A.J.; Kong, F.M.; Jirtle, R.L.; Rosen, V.; Thies, R.S. Bone morphogenetic protein-9 binds to liver cells and stimulates proliferation. Endocrinology 1995, 136, 4293–4297. [Google Scholar] [CrossRef] [PubMed]
- Herrera, B.; van Dinther, M.; Ten Dijke, P.; Inman, G.J. Autocrine bone morphogenetic protein-9 signals through activin receptor-like kinase-2/Smad1/Smad4 to promote ovarian cancer cell proliferation. Cancer Res. 2009, 69, 9254–9262. [Google Scholar] [CrossRef] [PubMed]
- Ren, W.; Liu, Y.; Wan, S.; Fei, C.; Wang, W.; Chen, Y.; Zhang, Z.; Wang, T.; Wang, J.; Zhou, L.; et al. BMP9 inhibits proliferation and metastasis of HER2-positive SK-BR-3 breast cancer cells through ERK1/2 and PI3K/AKT pathways. PLoS ONE 2014, 9, e96816. [Google Scholar] [CrossRef] [PubMed]
- Ren, W.; Sun, X.; Wang, K.; Feng, H.; Liu, Y.; Fei, C.; Wan, S.; Wang, W.; Luo, J.; Shi, Q.; et al. BMP9 inhibits the bone metastasis of breast cancer cells by downregulating CCN2 (connective tissue growth factor, CTGF) expression. Mol. Biol. Rep. 2014, 41, 1373–1383. [Google Scholar] [CrossRef] [PubMed]
- Lamplot, J.D.; Qin, J.; Nan, G.; Wang, J.; Liu, X.; Yin, L.; Tomal, J.; Li, R.; Shui, W.; Zhang, H.; et al. BMP9 signaling in stem cell differentiation and osteogenesis. Am. J. Stem Cells 2013, 2, 1–21. [Google Scholar] [PubMed]
- Ito, Y. Oncogenic potential of the RUNX gene family: ‘Overview’. Oncogene 2004, 23, 4198–4208. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Zhang, H.; Zhang, W.; Huang, E.; Wang, N.; Wu, N.; Wen, S.; Chen, X.; Liao, Z.; Deng, F.; et al. Bone morphogenetic protein-9 effectively induces osteo/odontoblastic differentiation of the reversibly immortalized stem cells of dental apical papilla. Stem Cells Dev. 2014, 23, 1405–1416. [Google Scholar] [CrossRef] [PubMed]
- Levanon, D.; Groner, Y. Structure and regulated expression of mammalian RUNX genes. Oncogene 2004, 23, 4211–4219. [Google Scholar] [CrossRef] [PubMed]
- Soung do, Y.; Talebian, L.; Matheny, C.J.; Guzzo, R.; Speck, M.E.; Lieberman, J.R.; Speck, N.A.; Drissi, H. Runx1 dose-dependently regulates endochondral ossification during skeletal development and fracture healing. J. Bone Miner. Res. 2012, 27, 1585–1597. [Google Scholar] [CrossRef] [PubMed]
- Komori, T. Regulation of skeletal development by the Runx family of transcription factors. J. Cell Biochem. 2005, 95, 445–453. [Google Scholar] [CrossRef] [PubMed]
- Rahman, M.S.; Akhtar, N.; Jamil, H.M.; Banik, R.S.; Asaduzzaman, S.M. TGF-β/BMP signaling and other molecular events: Regulation of osteoblastogenesis and bone formation. Bone Res. 2015, 3, 15005. [Google Scholar] [CrossRef] [PubMed]
- Tsukazaki, T.; Chiang, T.A.; Davison, A.F.; Attisano, L.; Wrana, J.L. SARA, a FYVE domain protein that recruits Smad2 to the TGFbeta receptor. Cell 1998, 95, 779–791. [Google Scholar] [CrossRef]
- Dai, F.; Lin, X.; Chang, C.; Feng, X.H. Nuclear export of Smad2 and Smad3 by RanBP3 facilitates termination of TGF-β signaling. Dev. Cell 2009, 16, 345–357. [Google Scholar] [CrossRef] [PubMed]
- Lin, X.; Duan, X.; Liang, Y.Y.; Su, Y.; Wrighton, K.H.; Long, J.; Hu, M.; Davis, C.M.; Wang, J.; Brunicardi, F.C.; et al. PPM1A Functions as a Smad Phosphatase to Terminate TGFβ Signaling. Cell 2016, 166, 1597. [Google Scholar] [CrossRef] [PubMed]
- He, T.C.; Zhou, S.; da Costa, L.T.; Yu, J.; Kinzler, K.W.; Vogelstein, B. A simplified system for generating recombinant adenoviruses. Proc. Natl. Acad. Sci. USA 1998, 95, 2509–2514. [Google Scholar] [CrossRef] [PubMed]
- Wu, N.; Zhao, Y.; Yin, Y.; Zhang, Y.; Luo, J. Identification and analysis of type II TGF-β receptors in BMP-9-induced osteogenic differentiation of C3H10T1/2 mesenchymal stem cells. Acta Biochim. Biophys. Sin. 2010, 42, 699–708. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Hegde, V.L.; Rao, R.; Zhang, J.; Nagarkatti, P.S.; Nagarkatti, M. Histone modifications are associated with Delta9-tetrahydrocannabinol-mediated alterations in antigen-specific T cell responses. J. Biol. Chem. 2014, 289, 18707–18718. [Google Scholar] [CrossRef] [PubMed]
- Nagase, M.; Kurihara, H.; Aiba, A.; Young, M.J.; Sakai, T. Deletion of Rac1GTPase in the Myeloid Lineage Protects against Inflammation-Mediated Kidney Injury in Mice. PLoS ONE 2016, 11, e0150886. [Google Scholar] [CrossRef] [PubMed]
- Hu, D.; Wang, V.; Yang, M.; Abdullah, S.; Davis, D.A.; Uldrick, T.S.; Polizzotto, M.N.; Veeranna, R.P.; Pittaluga, S.; Tosato, G.; et al. Induction of Kaposi’s Sarcoma-Associated Herpesvirus-Encoded Viral Interleukin-6 by X-Box Binding Protein 1. J. Virol. 2015, 90, 368–378. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Dong, Q.; Wang, Y.; Feng, Q.; Zhou, P.; Ou, X.; Meng, Q.; He, T.; Luo, J. Hedgehog signaling is involved in the BMP9-induced osteogenic differentiation of mesenchymal stem cells. Int. J. Mol. Med. 2015, 35, 1641–1650. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Li, L.; Dong, Q.; Wang, Y.; Feng, Q.; Ou, X.; Zhou, P.; He, T.; Luo, J. Activation of PKA/CREB Signaling is Involved in BMP9-Induced Osteogenic Differentiation of Mesenchymal Stem Cells. Cell Physiol. Biochem. 2015, 37, 548–562. [Google Scholar] [CrossRef] [PubMed]
- Peng, Y.; Kang, Q.; Cheng, H.; Li, X.; Sun, M.H.; Jiang, W.; Luu, H.H.; Park, J.Y.; Haydon, R.C.; He, T.C. Transcriptional characterization of bone morphogenetic proteins (BMPs)-mediated osteogenic signaling. J. Cell Biochem. 2003, 90, 1149–1165. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Forward Primer | Reverse Primer |
---|---|---|
GAPDH | GGCTGCCCAGAACATCAT | CGGACACATTGGGGGTAG |
CollaI | ATCGACATGTCAGCCTTTGC | TGACTTGAGTGTAGCGTCCAC |
OSX | GGGAGCAGAGTGCCAAGA | TACTCCTGGCGCATAGGG |
DLX5 | CTCAGCCACCACCCTCAT | TGGCAGGTGGGAATTGAT |
RUNX2 | GGTGAAACTCTTGCCTCGTC | AGTCCCAACTTCCTGTGCT |
RUNX1 | GCCATGGCTACGGTTCAG | CAGAACCAGCGGTTAGGC |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ji, C.; Liu, X.; Xu, L.; Yu, T.; Dong, C.; Luo, J. RUNX1 Plays an Important Role in Mediating BMP9-Induced Osteogenic Differentiation of Mesenchymal Stem Cells Line C3H10T1/2, Murine Multi-Lineage Cells Lines C2C12 and MEFs. Int. J. Mol. Sci. 2017, 18, 1348. https://doi.org/10.3390/ijms18071348
Ji C, Liu X, Xu L, Yu T, Dong C, Luo J. RUNX1 Plays an Important Role in Mediating BMP9-Induced Osteogenic Differentiation of Mesenchymal Stem Cells Line C3H10T1/2, Murine Multi-Lineage Cells Lines C2C12 and MEFs. International Journal of Molecular Sciences. 2017; 18(7):1348. https://doi.org/10.3390/ijms18071348
Chicago/Turabian StyleJi, Caixia, Xiaohua Liu, Li Xu, Tingting Yu, Chaoqun Dong, and Jinyong Luo. 2017. "RUNX1 Plays an Important Role in Mediating BMP9-Induced Osteogenic Differentiation of Mesenchymal Stem Cells Line C3H10T1/2, Murine Multi-Lineage Cells Lines C2C12 and MEFs" International Journal of Molecular Sciences 18, no. 7: 1348. https://doi.org/10.3390/ijms18071348
APA StyleJi, C., Liu, X., Xu, L., Yu, T., Dong, C., & Luo, J. (2017). RUNX1 Plays an Important Role in Mediating BMP9-Induced Osteogenic Differentiation of Mesenchymal Stem Cells Line C3H10T1/2, Murine Multi-Lineage Cells Lines C2C12 and MEFs. International Journal of Molecular Sciences, 18(7), 1348. https://doi.org/10.3390/ijms18071348