MicroRNA-27a-3p Inhibits Melanogenesis in Mouse Skin Melanocytes by Targeting Wnt3a
Abstract
1. Introduction
2. Results and Discussion
2.1. Expression of MiR-27a-3p and Wnt3a mRNA in Brown and Gray Mouse Skin

2.2. MiR-27a-3p Targets the Predicted miRNA Binding Site in the 3' UTR of Wnt3a

2.3. Over-Expression of MiR-27a-3p in Melanocytes Inhibits the Expression of Wnt3a and β-Catenin



2.4. Over-Expression of MiR-27a-3p in Melanocytes Inhibits Melanogenesis

3. Experimental Section
3.1. Ethics Statement and Sample Collection
3.2. Plasmid Cloning
| Primer Name | Primer Sequence 5'–3' | Application |
|---|---|---|
| Wnt3a F | CAGTGCCTCGGAGATGGTG | Real time PCR |
| Wnt3a R | GGTTAGGTTCGCAGAAGTTGG | Real time PCR |
| Wnt3a 3' UTR F | CGAGCTCCGTGCCTGGGTACCTCTTTT | Luciferase reporter-wt |
| Wnt3a 3' UTR R | GCTCTAGAGAACGCAAAGTTCCAGGCAG | Luciferase reporter-wt |
| Wnt3a-3' UTR-mut F | TTCCTGGTTGGTACCACACACAACCGTCCCTCCCCCCT | Luciferase reporter-mut |
| Wnt3a-3' UTR-mut R | AGGGGGGAGGGACGGTTGTGTGTGGTACCAACCAGGAA | Luciferase reporter-mut |
| MiR-27a F | ACACTCCAGCTGGGTTCACAGTGGCTAAG | Real time PCR |
| Universal Primer | TGGTGTCGTGGAGTCG | Real time PCR |
| U 6 F | CTCGCTTCGGCAGCACA | Real time PCR |
| U 6 R | AACGCTTCACGAATTTGCGT | Real time PCR |
| MiR-27a R | CTCAACTGGTGTCGTGGAGTCCGGCAATTCAGTTGAGGCGGAACT | Real time PCR |
| MiR-27a F-XhoI | AAGCTCGAGCTGTCGCCAAGGATGTCTGT | PCR-Clone |
| MiR-27a R-EcoRI | GGAATTCAGGAGGCAGAGCAGGGTG | PCR-Clone |
| 18S-F | GAAGGGCACCACCAGGAGT | Real time PCR |
| 18S-R | CAGACAAATCACTCCACCAA | Real time PCR |
| β-Catenin | GTTGTACTGCTGGGACCCTT | Real time PCR |
| β-Catenin | CCCAAGCATTTTCACCAGCG | Real time PCR |
3.3. Cell Culture and Transfection
3.4. Luciferase Assay
3.5. RNA Preparation and Real-Time PCR Analysis
3.6. Protein Extraction and Western Blot Analysis
3.7. Melanin Measurement
3.8. Statistical Analysis
4. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- De Luca, M.; D’Anna, F.; Bondanza, S.; Franzi, A.T.; Cancedda, R. Human epithelial cells induce human melanocyte growth in vitro but only skin keratinocytes regulate its proper differentiation in the absence of dermis. J. Cell Biol. 1988, 107, 1919–1926. [Google Scholar] [CrossRef]
- Zhu, Z.; He, J.; Jia, X.; Jiang, J.; Bai, R.; Yu, X.; Lv, L.; Fan, R.; He, X.; Geng, J.; et al. MicroRNA-25 functions in regulation of pigmentation by targeting the transcription factor MITF in Alpaca (Lama pacos) skin melanocytes. Domest. Anim. Endocrinol. 2010, 38, 200–209. [Google Scholar] [CrossRef]
- Guo, H.; Yang, K.; Deng, F.; Xing, Y.; Li, Y.; Lian, X.; Yang, T. Wnt3a inhibits proliferation but promotes melanogenesis of melan-a cells. Int. J. Mol. Med. 2012, 30, 636–642. [Google Scholar]
- Eisenmann, D.M. Wnt Signaling; WormBook: Pasadena, CA, USA, 2005; pp. 1–17. [Google Scholar]
- Sethi, J.K.; Vidal-Puig, A. Wnt signalling and the control of cellular metabolism. Biochem. J. 2010, 427, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Moon, R.T.; Brown, J.D.; Torres, M. Wnts modulate cell fate and behavior during vertebrate development. Trends Genet. 1997, 13, 157–162. [Google Scholar] [CrossRef] [PubMed]
- Miller, J.R. The Wnts. Genome Biol. 2002, 3, 3001.1–3001.15. [Google Scholar]
- Dunn, K.J.; Brady, M.; Ochsenbauer-Jambor, C.; Snyder, S.; Incao, A.; Pavan, W.J. Wnt1 and Wnt3a promote expansion of melanocytes through distinct modes of action. Pigment Cell Res. 2005, 18, 167–180. [Google Scholar] [CrossRef]
- Jin, E.J.; Erickson, C.A.; Takada, S.; Burrus, L.W. Wnt and BMP signaling govern lineage segregation of melanocytes in the avian embryo. Dev. Biol. 2001, 233, 22–37. [Google Scholar] [CrossRef]
- Prasad, R.; Katiyar, S.K. Down-regulation of miRNA-106b inhibits growth of melanoma cells by promoting G1-phase cell cycle arrest and reactivation of p21/WAF1/Cip1 protein. Oncotarget 2014, 5, 10636–10649. [Google Scholar] [PubMed]
- Zhou, J.; Liu, R.; Wang, Y.; Tang, J.; Tang, S.; Chen, X.; Xia, K.; Xiong, W.; Xu, D.; Wang, S.; et al. MiR-199a-5p regulates the expression of metastasis-associated genes in B16F10 melanoma cells. Int. J. Clin. Exp. Pathol. 2014, 7, 7182–7190. [Google Scholar]
- Dong, C.; Wang, H.; Xue, L.; Dong, Y.; Yang, L.; Fan, R.; Yu, X.; Tian, X.; Ma, S.; Smith, G.W. Coat color determination by miR-137 mediated down-regulation of microphthalmia-associated transcription factor in a mouse model. RNA 2012, 18, 1679–1686. [Google Scholar]
- Goswami, S.; Tarapore, R.S.; Teslaa, J.J.; Grinblat, Y.; Setaluri, V.; Spiegelman, V.S. MicroRNA-340-mediated degradation of microphthalmia-associated transcription factor mRNA is inhibited by the coding region determinant-binding protein. J. Biol. Chem. 2010, 285, 20532–20540. [Google Scholar] [CrossRef]
- Dynoodt, P.; Mestdagh, P.; van Peer, G.; Vandesompele, J.; Goossens, K.; Peelman, L.J.; Geusens, B.; Speeckaert, R.M.; Lambert, J.L.; van Gele, M.J. Identification of miR-145 as a key regulator of the pigmentary process. J. Investig. Dermatol. 2013, 133, 201–209. [Google Scholar] [CrossRef]
- Tian, X.; Jiang, J.; Fan, R.; Wang, H.; Meng, X.; He, X.; He, J.; Li, H.; Geng, J.; Yu, X.; et al. Identification and characterization of microRNAs in white and brown alpaca skin. BMC Genomics 2012, 13, 555. [Google Scholar]
- Bartel, D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef] [PubMed]
- Wu, L.; Fan, J.; Belasco, J.G. MicroRNAs direct rapid deadenylation of mRNA. Proc. Natl. Acad. Sci. USA 2006, 103, 4034–4039. [Google Scholar] [CrossRef] [PubMed]
- Oloumi, A.; Syam, S.; Dedhar, S. Modulation of Wnt3a-mediated nuclear β-catenin accumulation and activation by integrin-linked kinase in mammalian cells. Oncogene 2006, 25, 7747–7757. [Google Scholar] [CrossRef] [PubMed]
- Takeda, K.; Yasumoto, K.; Takada, R.; Takada, S.; Watanabe, K.; Udono, T.; Saito, H.; Takahashi, K.; Shibahara, S. Induction of melanocyte-specific microphthalmia-associated transcription factor by Wnt-3a. J. Biol. Chem. 2000, 275, 14013–14016. [Google Scholar]
- Widlund, H.R.; Fisher, D.E. Microphthalamia-associated transcription factor: A critical regulator of pigment cell development and survival. Oncogene 2003, 22, 3035–3041. [Google Scholar] [CrossRef] [PubMed]
- Guo, J.; Zhang, J.F.; Wang, W.M.; Cheung, F.W.; Lu, Y.F.; Ng, C.F.; Kung, H.F.; Liu, W.K. MicroRNA-218 inhibits melanogenesis by directly suppressing microphthalmia-associated transcription factor expression. RNA Biol. 2014, 11, 732–741. [Google Scholar] [CrossRef]
- Kim, N.H.; Choi, S.H.; Kim, C.H.; Lee, C.H.; Lee, T.R.; Lee, A.Y. Reduced MiR-675 in exosome in H19 RNA-related melanogenesis via MITF as a direct target. J. Investig. Dermatol. 2014, 134, 1075–1082. [Google Scholar]
- Noguchi, S.; Kumazaki, M.; Yasui, Y.; Mori, T.; Yamada, N.; Akao, Y. MicroRNA-203 regulates melanosome transport and tyrosinase expression in melanoma cells by targeting kinesin superfamily protein 5b. J. Investig. Dermatol. 2014, 134, 461–469. [Google Scholar] [CrossRef]
- Wu, D.; Chen, J.S.; Chang, D.C.; Lin, S.L. Mir-434-5p mediates skin whitening and lightening. Clin. Cosmet. Investig. Dermatol. 2008, 1, 19–35. [Google Scholar]
- Guttilla, I.K.; White, B.A. Coordinate regulation of FOXO1 by miR-27a, miR-96, and miR-182 in breast cancer cells. J. Biol. Chem. 2009, 284, 23204–23216. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.; Wu, H.; Liu, X.; Evans, B.R.; Medina, D.J.; Liu, C.G.; Yang, J.M. Role of microRNA miR-27a and miR-451 in the regulation of MDR1/P-glycoprotein expression in human cancer cells. Biochem. Pharmacol. 2008, 76, 582–588. [Google Scholar]
- Ji, J.; Zhang, J.; Huang, G.; Qian, J.; Wang, X.; Mei, S. Over-expressed microRNA-27a and 27b influence fat accumulation and cell proliferation during rat hepatic stellate cell activation. FEBS Lett. 2009, 583, 759–766. [Google Scholar]
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, Y.; Wang, P.; Meng, J.; Ji, Y.; Xu, D.; Chen, T.; Fan, R.; Yu, X.; Yao, J.; Dong, C. MicroRNA-27a-3p Inhibits Melanogenesis in Mouse Skin Melanocytes by Targeting Wnt3a. Int. J. Mol. Sci. 2015, 16, 10921-10933. https://doi.org/10.3390/ijms160510921
Zhao Y, Wang P, Meng J, Ji Y, Xu D, Chen T, Fan R, Yu X, Yao J, Dong C. MicroRNA-27a-3p Inhibits Melanogenesis in Mouse Skin Melanocytes by Targeting Wnt3a. International Journal of Molecular Sciences. 2015; 16(5):10921-10933. https://doi.org/10.3390/ijms160510921
Chicago/Turabian StyleZhao, Yuanyuan, Pengchao Wang, Jinzhu Meng, Yuankai Ji, Dongmei Xu, Tianzhi Chen, Ruiwen Fan, Xiuju Yu, Jianbo Yao, and Changsheng Dong. 2015. "MicroRNA-27a-3p Inhibits Melanogenesis in Mouse Skin Melanocytes by Targeting Wnt3a" International Journal of Molecular Sciences 16, no. 5: 10921-10933. https://doi.org/10.3390/ijms160510921
APA StyleZhao, Y., Wang, P., Meng, J., Ji, Y., Xu, D., Chen, T., Fan, R., Yu, X., Yao, J., & Dong, C. (2015). MicroRNA-27a-3p Inhibits Melanogenesis in Mouse Skin Melanocytes by Targeting Wnt3a. International Journal of Molecular Sciences, 16(5), 10921-10933. https://doi.org/10.3390/ijms160510921
