Isolation and Characterization of Twelve Polymorphic Microsatellite Loci for the Cocoa Mirid Bug Sahlbergella Singularis
Abstract
:1. Introduction
2. Results and Discussion
3. Experimental Section
3.1. Isolation of Microsatellite Markers
3.2. Primer Validation
3.3. Cross-Species Transferability
4. Conclusions
Acknowledgments
References
- Entwistle, P.F. Pests of Cocoa; Longman Group Limited: London, UK, 1972; pp. 221–311. [Google Scholar]
- Babin, R.; Anikwe, J.C.; Dibog, L.; Lumaret, J.-P. Effects of cocoa tree phenology and canopy microclimate on the performance of the mirid bug Sahlbergella singularis. Entomol. Exp. Appl 2011, 141, 25–34. [Google Scholar]
- Babin, R.; ten Hoopen, G.M.; Cilas, C.; Enjalric, F.; Yede; Gendre, P.; Lumaret, J.-P. Impact of shade on the spatial distribution of Sahlbergella singularis in traditional cocoa agroforests. Agric. For. Entomol 2010, 12, 69–79. [Google Scholar]
- Hoy, M.A. Insect Molecular Genetics, an Introduction to Principles and Applications, 2nd ed; Academic Press: Orlando, FL, USA, 2003; pp. 400–441. [Google Scholar]
- Dakin, E.E.; Avise, J.C. Microsatellite null alleles in parentage analysis. Heredity 2004, 93, 504–509. [Google Scholar]
- Chapuis, M.-P.; Estoup, A. Microsatellite null alleles and estimation of population differentiation. Mol. Biol. Evol 2007, 24, 621–631. [Google Scholar]
- Liu, Y.-D.; Yang, Z.-C.; Wu, K.-M. Eight polymorphic microsatellite markers developed in the gree leaf bug, Lygus lucorum Meyer-Dür (Hemiptera: Miridae). Mol. Ecol. Notes 2007, 7, 29–31. [Google Scholar]
- Shrestha, R.B.; Parajulee, M.N.; Perera, O.P.; Scheffler, B.E.; Densmore, L.D. Characterization of microsatellite loci in the western tarnished plant bug, Lygus hesperus Knight (Hemiptera: Miridae). Mol. Ecol. Notes 2007, 7, 1342–1344. [Google Scholar]
- Kobayashi, T.; Sakurai, T.; Sakakibara, M.; Watanabe, T. Multiple origins of outbreak populations of a native insect pest in an agro-ecosystem. Bull. Entomol. Res 2011, 101, 313–324. [Google Scholar]
- Risterucci, A.-M.; Grivet, L.; N’Goran, J.A.K.; Pieretti, I.; Flament, M.H.; Lanaud, C. A high density linkage map of Theobroma cacao L. Theor. Appl. Genet 2000, 101, 948–955. [Google Scholar]
- Billote, N.; Lagoda, P.J.L.; Risterucci, A.-M.; Baurens, F.-C. Microsatellite-enriched libraries: applied methodology for the development of SSR markers in tropical crops. Fruits 1999, 54, 277–288. [Google Scholar]
- Dereeper, A.; Argout, X.; Billot, C.; Rami, J.-F.; Ruiz, M. SAT, a flexible and optimized Web application for SSR marker development. BMC Bioinforma 2007, 8, 465. [Google Scholar]
- Rozen, S.; Skaletsky, H.J. Primer3 on the WWW for General Users and for Biologist Programmers. In Bioinformatics Methods and Protocols: Methods in Molecular Biology; Krawetz, S., Misener, S., Eds.; Humana Press: Totowa, NJ, USA, 2000; pp. 365–386. [Google Scholar]
- Don, R.H.; Cox, P.T.; Wainwright, B.J.; Baker, K.; Mattick, J.S. “Touchdown” PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res 1991, 19. [Google Scholar] [CrossRef]
- Piry, S.; Alapetite, A.; Cornuet, J.M.; Paetkau, D.; Baudouin, L.; Estoup, A. GENECLASS2: A software for genetic assignment and first-generation migrant detection. J. Hered 2004, 95, 536–539. [Google Scholar]
- Rousset, F. Genepop’007: A complete reimplementation of the Genepop software for Windows and Linux. Mol. Ecol. Resour 2008, 8, 103–106. [Google Scholar]
- Rice, W.R. Analysing tables of statistical tests. Evolution 1989, 43, 223–225. [Google Scholar]
- Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. Micro-checker: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar]
- Latip, S.N.H.; Muhamad, R.; Manjeri, G.; Tan, S.G. Development of microsatellite markers for Helopeltis theivora Waterhouse (Hemiptera: Miridae). Afr. J. Biotechnol 2010, 9, 4478–4481. [Google Scholar]
Locus | PCR multiplex set | Repeat motif | Allele size (bp) | Allele size range (bp) | Na | Ho | He | rnull (%) | Primer sequence (5′-3′) | Genbank Accession N° |
---|---|---|---|---|---|---|---|---|---|---|
Ss14 | 1 | (GA)30CA(GA)2 AA(GA)3 | 234 | 205–278 | 16 | 0.462 | 0.917 * | 23 | F: Pet-CTGGAAATGGGTAGGGGATT R: GACAGGGTAGTCGGCAAGAC | JQ687207 |
Ss24 | 1 | (AC)26 | 188 | 153–247 | 17 | 0.720 | 0.904 | 9 | F: Ned-AAACACGACTTTTCCCTTAC R: AGCTAAAATGCTATCTCTGC | JQ687206 |
Ss01 | 2 | (TC)19 | 239 | 216–252 | 18 | 0.750 | 0.927 * | 7 | F: Fam-TCCGAGGGAAACCTTCCTAT R: ACGTTATGCAGCACCGATTA | JQ687216 |
Ss11 | 2 | (AC)24 | 155 | 119–151 | 12 | 0.750 | 0.871 | 4 | F: Fam-GTCCATGCGAGCTGATGTT R: CGTCTCTCCTGCTTCATACG | JQ687213 |
Ss15 | 2 | (GA)28 | 161 | 125–194 | 25 | 0.741 | 0.946 | 10 | F: Pet-CGAAGCCAAGCGTATATTCC R: TGCGAGGTCGATAGTTTGAA | JQ687208 |
Ss04 | 3 | (CT)6AT(CT)7 (CA)3CG(CA)6 | 217 | 187–234 | 17 | 0.643 | 0.851 * | 11 | F: Fam-GGATGTTCCTTTACCGCTTT R: ACATGAATAGCGTGAGATTCC | JQ687210 |
Ss05 | 3 | (GT)11 | 120 | 104–125 | 9 | 0.714 | 0.872 | 8 | F: Fam-CTAGTGATGGTATGTAATCAGC R: GTGAACTCTACAAGGGATAATG | JQ687217 |
Ss12 | 3 | (AC)14 | 198 | 183–229 | 10 | 0.609 | 0.788 | 10 | F: Vic-ACAACCAAGCTGATGTTTCG R: TCATTCATTACAGTGCCTCTTG | JQ687214 |
Ss06 | 4 | (CA)6 | 100 | 96–102 | 5 | 0.536 | 0.671 | 4 | F: Vic-TATAGGGCCAGGGGTAGACA R: AAAGGGCTGTAATCGAAATGC | JQ687215 |
Ss19 | 4 | GACGAG(GA)17 GG(GA)2 | 160 | 130–183 | 14 | 0.786 | 0.865 | 4 | F: Vic-CAGCAATGTCTTAATGTTCGAC R: TTGAAGCAGTGGCTCTTAATG | JQ687211 |
Ss10 | na | (GT)15(GTGA)3 (GAAT)3 | 101 | 76–127 | 8 | 0.179 | 0.706 * | 31 | F: Fam-GCTGGGTATTTGAGAGGGATT R: CGCCAGATGAATAATAAAGACG | JQ687212 |
Ss25 | na | (AC)27 | 231 | 191–231 | 13 | 0.778 | 0.861 | 4 | F:FamCGTTATCAGTATCATTCGAGCAGT R: GTTAGTCCTCGCCGCATCT | JQ687209 |
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Babin, R.; Fenouillet, C.; Legavre, T.; Blondin, L.; Calatayud, C.; Risterucci, A.-M.; Chapuis, M.-P. Isolation and Characterization of Twelve Polymorphic Microsatellite Loci for the Cocoa Mirid Bug Sahlbergella Singularis. Int. J. Mol. Sci. 2012, 13, 4412-4417. https://doi.org/10.3390/ijms13044412
Babin R, Fenouillet C, Legavre T, Blondin L, Calatayud C, Risterucci A-M, Chapuis M-P. Isolation and Characterization of Twelve Polymorphic Microsatellite Loci for the Cocoa Mirid Bug Sahlbergella Singularis. International Journal of Molecular Sciences. 2012; 13(4):4412-4417. https://doi.org/10.3390/ijms13044412
Chicago/Turabian StyleBabin, Régis, Catherine Fenouillet, Thierry Legavre, Laurence Blondin, Caroline Calatayud, Ange-Marie Risterucci, and Marie-Pierre Chapuis. 2012. "Isolation and Characterization of Twelve Polymorphic Microsatellite Loci for the Cocoa Mirid Bug Sahlbergella Singularis" International Journal of Molecular Sciences 13, no. 4: 4412-4417. https://doi.org/10.3390/ijms13044412