Olmesartan Attenuates the Impairment of Endothelial Cells Induced by Oxidized Low Density Lipoprotein through Downregulating Expression of LOX-1
Abstract
:1. Introduction
2. Results and Discussion
2.1. Olmesartan Inhibited Apoptotic Responses Induced by ox-LDL in Cultured Endothelial Cells in Vitro
2.2. Olmesartan Inhibited ox-LDL-Induced Endothelial Cell Injury in Vivo
2.3. Olmesartan Inhibited the Expression of LOX-1 in Ox-LDL-Treated Endothelial Cells
3. Experimental Section
3.1. Animal Models
3.2. Haemodynamic Measurements
3.3. Cell Culture and Treatment
3.4. Cell Viability Assay and Nitric Oxide (NO) Production Assay
3.5. Detection of Vascular Endothelial Cell Apoptosis Using Flow Cytometry
3.6. Real-Time RT-PCR
3.7. Western Blot Analyses
3.8. Statistical Analysis
4. Conclusions
References
- Vink, H.; Constantinescu, A.A.; Spaan, J.A.E. Oxidized lipoproteins degrade the endothelial surface layer—Implications for platelet-endothelial cell adhesion. Circulation 2000, 101, 1500–1502. [Google Scholar]
- Dunn, S.; Vohra, R.S.; Murphy, J.E.; Homer-Vanniasinkam, S.; Walker, J.H.; Ponnambalam, S. The lectin-like oxidized low-density-lipoprotein receptor: A pro-inflammatory factor in vascular disease. Biochem. J 2008, 409, 349–355. [Google Scholar]
- Mehta, J.L.; Li, D.Y. Identification, regulation and function of a novel lectin-like oxidized low-density lipoprotein receptor. J. Am. Coll. Cardiol 2002, 39, 1429–1435. [Google Scholar]
- Kataoka, H.; Kume, N.; Miyamoto, S.; Minami, M.; Morimoto, M.; Hayashida, K.; Hashimoto, N.; Kita, T. Oxidized LDL modulates Bax/Bcl-2 through the lectinlike ox-LDL receptor-1 in vascular smooth muscle cells. Arterioscleros. Thromb. Vasc. Biol 2001, 21, 955–960. [Google Scholar]
- Li, D.Y.; Singh, R.M.; Liu, L.; Chen, H.J.; Singh, B.M.; Kazzaz, N.; Mehta, J.L. Oxidized-LDL through LOX-1 increases the expression of angiotensin converting enzyme in human coronary artery endothelial cells. Cardiovasc. Res 2003, 57, 238–243. [Google Scholar]
- Rangaswamy, S.; Penn, M.S.; Saidel, G.M.; Chisolm, G.M. Exogenous oxidized low-density lipoprotein injures and alters the barrier function of endothelium in rats in vivo. Circ. Res 1997, 80, 37–44. [Google Scholar]
- Fujita, Y.; Kakino, A.; Nishimichi, N.; Yamaguchi, S.; Sato, Y.; Machida, S.; Cominacini, L.; Delneste, Y.; Matsuda, H.; Sawamura, T. Oxidized LDL receptor LOX-1 binds to C-reactive protein and mediates its vascular effects. Clin. Chem 2009, 55, 285–294. [Google Scholar]
- Novelli, G.; Mango, R.; Vecchione, L.; Mariotti, E.; Borgiani, P.; Mehta, J.L.; Romeo, F. New insights in atherosclerosis research: LOX-1, leading actor of cardiovascular diseases. Clin. Ter 2007, 158, 239–248. [Google Scholar]
- Rosendorff, C.; Dubiel, R.; Xu, J.B.; Chavanu, K.J. Comparison of olmesartan medoxomil versus amlodipine besylate on regression of ventricular and vascular hypertrophy. Am. J. Cardiol 2009, 104, 359–365. [Google Scholar]
- Sacristan, D.; Marques, M.; Zamorano-Leon, J.J.; Luque, M.; Armengol, J.; del Castillo, J.; Martin, J.; Delpon, E.; Ramos-Mozo, P.; de Prada, T.P.; et al. Modifications by Olmesartan medoxomil treatment of the platelet protein profile of moderate hypertensive patients. Proteomics Clin. Appl 2008, 2, 1300–1312. [Google Scholar]
- Geng, H.; Wang, A.; Rong, G.; Zhu, B.; Deng, Y.; Chen, J.; Zhong, R. The effects of ox-LDL in human atherosclerosis may be mediated in part via the toll-like receptor 4 pathway. Mil. Cell. Biochem 2010, 342, 201–206. [Google Scholar]
- Li, D.Y.; Saldeen, T.; Romeo, F.; Mehta, J.L. Oxidized LDL upregulates angiotensin II type 1 receptor expression in cultured human coronary artery endothelial cells—The potential role of transcription factor NF-kappa B. Circulation 2000, 102, 1970–1976. [Google Scholar]
- Strawn, W.B.; Ferrario, C.M. Mechanisms linking angiotensin II and atherogenesis. Curr. Opin. Lipidol 2002, 13, 505–512. [Google Scholar]
- Singh, B.M.; Mehta, J.L. Interactions between the renin-angiotensin system and dyslipidemia—Relevance in the therapy of hypertension and coronary heart disease. Arch. Intern. Med 2003, 163, 1296–1304. [Google Scholar]
- Chen, J.W.; Li, D.Y.; Schaefer, R.; Mehta, J.L. Cross-talk between dyslipidemia and renin-angiotensin system and the role of LOX-1 and MAPK in atherogenesis—Studies with the combined use of rosuvastatin and candesartan. Atherosclerosis 2006, 184, 295–301. [Google Scholar]
- Bukowska, A.; Schild, L.; Keilhoff, G.; Hirte, D.; Neumann, M.; Gardemann, A.; Neumann, K.H.; Rohl, F.W.; Huth, C.; Goette, A.; Lendeckel, U. Mitochondrial dysfunction and redox signaling in atrial tachyarrhythmia. Exp. Biol. Med 2008, 233, 558–574. [Google Scholar]
- Chai, W.; Liu, Z. p38 Mitogen-activated protein kinase mediates palmitate-induced apoptosis but notinhibitor of nuclear factor-κB degradation in human coronary artery endothelial cells. Endocrinology 2007, 148, 1622–1828. [Google Scholar]
- Li, L.; Zhou, N.; Gong, H.; Wu, J.; Lin, L.; Komuro, I.; Ge, J.; Zou, Y. Comparison of angiotensin II type 1-receptor blockers to regress pressure overload-induced cardiac hypertrophy in mice. Hypertens. Res 2010, 33, 1289–1297. [Google Scholar]
- Gerlier, D.; Thomasset, N. Use of MTT colorimetric assay to measure cell activation. J. Immunol. Methods 1986, 94, 57–63. [Google Scholar]
- Yao, L.; Kobori, H.; Rahman, M.; Seth, D.M.; Shokoji, T.; Fan, Y.Y.; Zhang, G.X.; Kimura, S.; Abe, Y.; Nishiyama, A. Olmesartan improves endothelin-induced hypertension and oxidative stress in rats. Hypertens. Res 2004, 27, 493–500. [Google Scholar]
- Tanabe, Y.; Morikawa, Y.; Kato, T.; Kanai, S.; Watakabe, T.; Nishijima, A.; Iwata, H.; Isobe, K.; Ishizaki, M.; Nakayama, K. Effects of olmesartan, an AT1 receptor antagonist, on hypoxia-induced activation of ERK1/2 and pro-inflammatory signals in the mouse lung. Naunyn Schmiedebergs Arch. Pharmacol 2006, 374, 235–248. [Google Scholar]
- Yuan, Z.Y.; Nimata, M.; Okabe, T.; Shioji, K.; Hasegawa, K.; Kita, T.; Kishimoto, C. Olmesartan, a novel AT(1) antagonist, suppresses cytotoxic myocardial injury in autoimmune heart failure. Am. J. Physiol. Heart Circ. Physiol 2005, 289, H1147–H1152. [Google Scholar]
- Fukushima, H.; Kobayashi, N.; Takeshima, H.; Koguchi, W.; Ishimitsu, T. Effects of olmesartan on Apelin/APJ and Akt/endothelial nitric oxide synthase pathway in dahl rats with end-stage heart failure. J. Cardiovasc. Pharmacol 2010, 55, 83–88. [Google Scholar]
- Akishita, M.; Nagai, K.; Xi, H.; Yu, W.; Sudoh, N.; Watanabe, T.; Ohara-Imaizumi, M.; Nagamatsu, S.; Kozaki, K.; Horiuchi, M.; et al. Renin-angiotensin system modulates oxidative stress-induced endothelial cell apoptosis in rats. Hypertension 2005, 45, 1188–1193. [Google Scholar]
- Spallarossa, P.; Fabbi, P.; Manca, V.; Garibaldi, S.; Ghigliotti, G.; Barisione, C.; Altieri, P.; Patrone, F.; Brunelli, C.; Barsotti, A. Doxorubicin-induced expression of LOX-1 in H9c2 cardiac muscle cells and its role in apoptosis. Biochem. Biophys. Res. Commun 2005, 335, 188–196. [Google Scholar]
- Chen, J.W.; Mehta, J.L.; Haider, N.; Zhang, X.J.; Narula, J.; Li, D.Y. Role of Caspases in ox-LDL-induced apoptotic cascade in human coronary artery endothelial cells. Circ. Res 2004, 94, 370–376. [Google Scholar]
- Zhu, Y.; Liao, H.L.; Wang, N.P.; Ma, K.S.; Verna, L.K.; Shyy, J.Y.J.; Chien, S.; Stemerman, M.B. LDL-activated p38 in endothelial cells is mediated by Ras. Arterioscleros. Thromb. Vasc. Biol 2001, 21, 1159–1164. [Google Scholar]
- Li, D.; Saldeen, T.; Romeo, F.; Mehta, J.L. Oxidized LDL upregulates angiotensin II type 1 receptor expression in cultured human coronary artery endothelial cells: The potential role of transcription factor NF-kappaB. Circulation 2000, 102, 1970–1976. [Google Scholar]
- Aoki, T.; Kataoka, H.; Ishibashi, R; Nakagami, H; Nozaki, K; Morishita, R; Hashimoto, N. Pitavastatin suppresses formation and progression of cerebral aneurysms through inhibition of the nuclear factor [kappa] pathway. Neurosurgery 2009, 64, 357–366. [Google Scholar]
group | Cell vitality | LDH (U/L) | NO (μM) |
---|---|---|---|
Control | 100% | 40.2 ± 10.6 | 10.5 ± 0.9 |
ox-LDL | 54.6% ± 9.2% * | 86.5 ± 20.4 * | 5.3 ± 1.2 * |
ox-LDL+olmesartan | 78.1% ± 6.2% *# | 68.6 ± 13.7 *# | 7.4 ± 2.5 *# |
olmesartan | 99.8% ± 1.2% # | 38.7 ± 10.2 # | 11.2 ± 1.8 # |
Gene | Forward primer (5′-3′) | Reverse primer (5′-3′) | Size (bp) |
---|---|---|---|
Bax | Mouse: TCAGAACCATCATGGGCTGG | CTTCCAGATGGTGAGCGAGG | 171 |
Rat: GCTGATGGCA ACTTCAACTG | CGCTCACGGAGGAAGTCCAG | 140 | |
Bcl-2 | Mouse: GCCAGTGTTCCATGCACCAA | CAAGTGGGAAGGTACAGGCA | 257 |
Rat: CACCCCTGGCATCTTCTCCTT | CATCCCAGCCTCCGTTATCCT | 141 | |
Caspase-3 | Mouse: CGGGGTACGGAGCTGGACTGT | ATGCTGCAAAGGGACTGGATG | 176 |
Rat: GTCAGTCAGA GCGTAAGGAA | CAGTGCTCACAAGGTGGGTC | 130 | |
GAPDH | Mouse: CCACTCTTCCACCTTCGATG | TCCACCACCCTGTTGCTGTA | 120 |
Rat: AGTCCATGCC ATCACTGCCA | CATGTCAGATCCACAACGGA | 300 |
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Zhang, H.; Ma, G.; Yao, Y.; Qian, H.; Li, W.; Chen, X.; Jiang, W.; Zheng, R. Olmesartan Attenuates the Impairment of Endothelial Cells Induced by Oxidized Low Density Lipoprotein through Downregulating Expression of LOX-1. Int. J. Mol. Sci. 2012, 13, 1512-1523. https://doi.org/10.3390/ijms13021512
Zhang H, Ma G, Yao Y, Qian H, Li W, Chen X, Jiang W, Zheng R. Olmesartan Attenuates the Impairment of Endothelial Cells Induced by Oxidized Low Density Lipoprotein through Downregulating Expression of LOX-1. International Journal of Molecular Sciences. 2012; 13(2):1512-1523. https://doi.org/10.3390/ijms13021512
Chicago/Turabian StyleZhang, Hua, Genshan Ma, Yuyu Yao, Huidong Qian, Weizhang Li, Xinjun Chen, Wenlong Jiang, and Ruolong Zheng. 2012. "Olmesartan Attenuates the Impairment of Endothelial Cells Induced by Oxidized Low Density Lipoprotein through Downregulating Expression of LOX-1" International Journal of Molecular Sciences 13, no. 2: 1512-1523. https://doi.org/10.3390/ijms13021512