Next Article in Journal
FK506-Binding Protein 22 from a Psychrophilic Bacterium, a Cold Shock-Inducible Peptidyl Prolyl Isomerase with the Ability to Assist in Protein Folding
Previous Article in Journal
Effects of Nitrogen Fertilization on Synthesis of Primary and Secondary Metabolites in Three Varieties of Kacip Fatimah (Labisia Pumila Blume)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

Sinanodonta woodiana (Mollusca: Bivalvia: Unionidae): Isolation and Characterization of the First Microsatellite Markers

by
Oana Paula Popa
1,2,†,
Luis Ovidiu Popa
1,3,†,
Ana-Maria Krapal
1,2,
Dumitru Murariu
1,
Elena Iulia Iorgu
1,* and
Marieta Costache
2,*
1
Molecular Biology Department, “Grigore Antipa” National Museum of Natural History, Kiseleff Street, No 1, Bucharest 011341, Romania
2
Departments of Biochemistry and Molecular Biology, University of Bucharest, 91-95 Spl. Independentei, Bucharest 050095, Romania
3
Faculty of Biology, Alexandru Ioan Cuza University of Iasi, 22, Carol I Boulevard, Iaşi RO 700505, Romania
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2011, 12(8), 5255-5260; https://doi.org/10.3390/ijms12085255
Submission received: 6 July 2011 / Revised: 25 July 2011 / Accepted: 4 August 2011 / Published: 17 August 2011
(This article belongs to the Section Biochemistry)

Abstract

Sinanodonta woodiana (Lea, 1834) is a large Unionid species with a real invasion success. It colonized Europe, Central America, the Indonesian Islands and recently North America. The species life cycle involves a larval parasitic stage on freshwater fish species which contributes to the spread of the mussel. In this paper we describe, for the first time, eight polymorphic microsatellite loci for the species Sinanodonta woodiana. The genetic screening of individuals confirmed that all loci were highly polymorphic. The number of alleles per locus ranged from 7 to 14 and the observed heterozygosity ranged from 0.650 to 0.950. These loci should prove useful to study the species population genetics which could help to infer important aspects of the invasion process.

1. Introduction

The freshwater mussel Sinanodonta woodiana (Lea, 1834) (Chinese Huge Mussel or Swan Mussel) is one of the largest Unionid species present in the European Fauna. The species is native to South Eastern Asia, specifically Indochina and Southern China to Korea, Japan, Taiwan and the Amur Basin in Eastern Russia [1].
The life cycle of Sinanodonta woodiana includes a parasitic larval stage—glochidium—which lives for a short time attached to freshwater fish species. The attached glochidia obtain nourishment from their host [2], but the relationship is more phoretic than nutritive [3].
Across Europe, the spread of the swan mussel was correlated with the introduction in the aquaculture of the East Asian cyprinids species (Ctenopharyngodon idella, Hypophthalmichthys molitrix) from the Amur River, between 1963–1965 [4,5]. Exports of the host fish species between different countries and regions helped the mussel to penetrate new environments. Physiological, ecological and biological peculiarities of the species offer it some advantages compared with the native unionid species and can explain its invasive success. S. woodiana has a particular physiological predisposition, associated with cholinesterase enzyme activity, to tolerate a variety of unsuitable environmental conditions, like pollution and hypoxia, in comparison with the autochthonous species [6]. This is the main cause that allowed the species to colonize Europe in less than 20 years. The expansion of S. woodiana is well documented in Europe [5,79], Central America [1], Indonesian Islands [10] and recently in North America [11]. In Romania, S. woodiana has spread in almost all important aquatic basins [7,12], and it became the prevalent species in the Unionidae communities in terms of biomass, especially in the lower flow of aquatic basins. Studies concerning the population genetics of S. woodiana are limited to alozymes analysis of several populations in Poland [13]. No other data are available in the literature about the genetic diversity of S. woodiana populations in the native or invaded areas.
Population genetic studies could help to infer important aspects of the invasion process of the species, like the route(s) of invasion, the time and number of colonization events, etc., and DNA microsatellite markers are one of the most useful tools to investigate these processes. In this paper we describe, for the first time, eight polymorphic microsatellite loci for the species Sinanodonta woodiana.

2. Results and Discussion

We selected 95 positive clones (that generated two bands on an agarose gel) by screening the microsatellite enriched genomic library. These were further sequenced using the LICOR 4300L Genetic Analyzer. All of the sequenced clones contained repetitive motifs, but only 30 of the sequenced clones were suitable for primer design. Eight out of 30 primer pairs gave consistent amplification and were subsequently used for polymorphism screening (Table 1). We tested the degree of polymorphism of the isolated loci in 20 individuals of Sinanodonta woodiana collected from the Prut River, at Vădeni, Romania. The number of alleles per locus ranged from 7 to 14 and the observed heterozygosity ranged from 0.650 to 0.950 (Table 2). All loci exhibited Hardy-Weinberg equilibrium and no linkage disequilibrium was observed between the markers. The results of the Micro-Checker testing showed no evidence for an excess of homozygotes, or for the presence of null alleles.
The loci described here are important molecular markers that may solve several issues regarding the invasive process of this species, like determining the source populations of invasive species, ways of introduction, initial size of invasive population, sustainability and variability of populations of S. woodiana.

3. Experimental Section

The microsatellite loci were developed using a modified enrichment protocol [14,15] which was also used to isolate DNA markers for Hypanis colorata [16]. Samples of Sinanodonta woodiana were collected in 2010 from the Prut River at Vădeni, Romania (46°03′48.44″N, 28°05′16.54″E) and tissue samples were preserved in 95% ethanol.
The PCR primers for each microsatellite locus were designed with the Primer3 program [17]. The PCR genotyping reaction was performed in a 10 μL total volume containing about 50 ng of DNA template, 10 mM Tris-HCl (pH 8.8 at 25 °C), 50 mM KCl, 0.08% (v/v) Nonidet P40, 2.5 mM MgCl2, (see Table 1 for details for each locus), each dNTP at 0.1 mM, each primer at 0.1 μM, 0.02 μM of IRD700 or IRD800 labeled M13 primer and 0.5 units of Taq DNA polymerase (Fermentas UAB, Vilnius, Lithuania). The temperature profile of the PCR reaction consisted of an initial denaturation step at 95 °C for 3 min followed by 30 cycles of denaturation at 95 °C for 30 s, annealing at a specific temperature for each locus (see Table 1 for details for each locus) for 30 s and extension at 72 °C for 45 s, followed by a final extension step at 72 °C for 5 min. The genotyping process was performed using SagaGT ver. 3.1 software package.
GenAlEx 6.4 [18] was used to estimate the number of alleles per locus (Na), observed heterozygosity (Hobs) and expected heterozygosity (Hexp). Deviation from the Hardy-Weinberg equilibrium (HWE) was tested using the same software package. The presence of null alleles was tested using Micro-Checker (ver. 2.2.3) [19] while linkage disequilibrium test was carried out using Arlequin ver. 3.1 [20].

4. Conclusions

In the present study we described eight polymorphic microsatellite loci for the highly invasive Asian mussel Sinanodonta woodiana. These loci would be useful to determine the source populations of this invasive species, potential ways of introduction, the number of colonization events, initial size of the established population and variability of populations of S. woodiana in native and invaded areas.

Acknowledgments

The study was supported by the National Council of Scientific Research from Romania (Grant PC no.32107/2008), allotted to Dumitru Murariu. Oana Paula Popa was supported by the strategic grant POSDRU/89/1.5/S/58852, Project “Postdoctoral programme for training scientific researchers” co-financed by the European Social Found within the Sectorial Operational Program Human Resources Development 2007–2013″. Luis Popa was supported from the project “Transnational Network for Integrated Management of Postdoctoral Research in Communicating Sciences. Institutional building (postdoctoral school) and fellowships program (CommScie)”—POSDRU/89/1.5/S/63663, financed under the Sectorial Operational Programme Human Resources Development 2007–2013. We thank Gabriel Chişamera for supplying the mussels.

References

  1. Watters, TG. A synthesis and review of the expanding range of the Asian freshwater mussel Anodonta woodiana (Lea, 1834) (Bivalvia:Unionidae). Veliger 1997, 40, 152–156. [Google Scholar]
  2. Wachtler, K; Dreher-Mansur, MC; Richter, T. Larval Types and Early Postlarval Biology in Naiads (Unionoida). In Ecology and Ecolution of Freshwater Mussels Unionoida; Bauer, G, Wachtler, K, Eds.; Springer: Berlin, German, 2001; pp. 93–125. [Google Scholar]
  3. Barnhart, MC; Haag, WR; Roston, WN. Adaptation to host infection and larval parasitism in Unionida. J. N. Am. Benthol. Soc 2008, 27, 370–394. [Google Scholar]
  4. Petro, E. The occurance of Anodonta woodiana woodiana in Hungary. Állaltani Közl 1984, 71, 189–191. [Google Scholar]
  5. Sarkany-Kiss, A. Anodonta woodiana (Lea, 1834) a new species in Romania (Bivalvia, Unionacea). Trav Mus Hist Nat Grigore Antipa 1986, XXVIII, 15–17. [Google Scholar]
  6. Corsi, I; Pastore, AM; Lodde, A; Palmerini, E; Castagnolo, L; Focardi, S. Potential role of cholinesterases in the invasive capacity of the freshwater bivalve, Anodonta woodiana (Bivalvia:Unionacea): a comparative study with the indigenous species of the genus Anodonta sp. Comp. Biochem. Phys. C 2007, 145, 413–419. [Google Scholar]
  7. Popa, O-P; Kelemen, SB; Murariu, D; Popa, LO. New records of Sinanodonta woodiana (Lea, 1834) (Mollusca: Bivalvia) from Eastern Romania. Aquat. Invasions 2007, 2, 155–157. [Google Scholar]
  8. Paunovic, M; Csanyi, B; Simic, V; Stojanovic, B; Predrag, C. Distribution of Anodonta (Sinanodonta) woodiana (Lea, 1834) in inland waters of Serbia. Aquat. Invasions 2006, 1, 154–160. [Google Scholar]
  9. Cappelletti, C; Cianfanelli, S; Beltrami, ME; Ciutti, F. Sinanodonta woodiana (Lea, 1834) (Bivalvia:Unionidae): a new non-indigenous species in Lake Garda (Italy). Aquat. Invasions 2009, 4, 685–688. [Google Scholar]
  10. Djajasasmita, M. The occurrence of Anodonta woodiana Lea, 1837 in Indonesia (Pelecypoda, Unionidae). Veliger 1982, 25, 175. [Google Scholar]
  11. Benson, AJ. Sinanodonta woodiana. Available online: http://nas.er.usgs.gov/queries/FactSheet.aspx?speciesID=2824 (accessed on 28 June 2011).
  12. Popa, OP; Popa, LO. Sinanodonta woodiana (Lea, 1834), Corbicula fluminea (O.F.Muller, 1774) and Dreissena bugensis (Andrusov, 1897) (Mollusca:Bivalvia): Alien invasive species in Romanian Fauna. Trav. Mus. Hist. Nat. Grigore Antipa 2006, 49, 7–12. [Google Scholar]
  13. Soroka, M. Genetic variability among freshwater mussel Anodonta woodiana (Lea, 1834) (Bivalvia:Unionidae) populations recently introduced in Poland. Zool. Sci 2005, 22, 1137–1144. [Google Scholar]
  14. Bloor, PA; Barker, FS; Watts, PC; Noyes, HA; Kemp, SJ. Microsatellite Libraries by Enrichment. Available online: http://www.genomics.liv.ac.uk/animal/research/microsatellite.pdf (accessed on 28 June 2011).
  15. Carleton, KL; Streelman, JT; Lee, BY; Garnhart, N; Kidd, M; Kocher, TD. Rapid isolation of CA microsatellites from the tilapia genome. Anim. Genet 2002, 33, 140–144. [Google Scholar]
  16. Popa, OP; Iorgu, EI; Krapal, AM; Kelemen, SB; Murariu, D; Popa, LO. Isolation and Characterization of the First Microsatellite Markers for the Endangered Relict Mussel Hypanis colorata (Mollusca: Bivalvia: Cardiidae). Int. J. Mol. Sci 2011, 12, 456–461. [Google Scholar]
  17. Rozen, S; Skaletsky, H. Primer3 on the WWW for General Users and for Biologist Programmers. In Bioinformatics Methods and Protocols; Krawetz, S, Misener, S, Eds.; Humana Press: Totowa, NJ, USA, 2000; pp. 365–386. [Google Scholar]
  18. Peakall, R; Smouse, PE. GENALEX 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar]
  19. Van Oosterhout, C; Hutchinson, WF; Wills, DPM; Shipley, P. Micro-checker: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar]
  20. Excoffier, L; Laval, G; Schneider, S. Arlequin ver. 3.0: An integrated software package for population genetics data analysis. Evol. Bioinforma. Online 2005, 1, 47–50. [Google Scholar]
Table 1. Primer sequences and characteristics of eight microsatellite loci successfully amplified in Sinanodonta woodiana. Ta, annealing temperature; [MgCl2], MgCl2 concentration in the PCR reaction; Size, size range of alleles.
Table 1. Primer sequences and characteristics of eight microsatellite loci successfully amplified in Sinanodonta woodiana. Ta, annealing temperature; [MgCl2], MgCl2 concentration in the PCR reaction; Size, size range of alleles.
MarkerGenebank Accession numberRepeat motifPrimer sequenceTa[MgCl2]Size
SW2JN180655CAF: caaaaatgaaccggacacct512.5152–194
R: cccaaactcgttttcattgg
SW3JN180656ATF: tgaaactggtgtccaatcca532.5154–184
R: ctcccgaaagagcacaacat
SW4JN180657TGF: agcgcaattaccagtggttt512.5215–229
R: ttgattgcgatgactggaaa
SW7JN180658CAF: ctgccacactgcagatattgt512.5213–233
R: aacacgttcgaaatccgagt
SW13JN180659ACF: cgccatgtcaaaaatcaaag552.5237–283
R: gccacaagcatgagatgtgt
SW14JN180660TGF: cccgtgttgtcaaaggaaat532.5178–222
R: tttttctggcgactttccac
SW15JN180661CAF: aaccgacaagtccttgcaata532.5307–345
R:cagctgagtcgattaggacaga
SW18JN180662GTTTF: gtaacgtctcgtcgggtcat532.5142–220
R: gcctcggtgctagacatcac
Table 2. Variation across 8 microsatellite loci in a population of 20 Sinanodonta woodiana individuals. Na: number of alleles; Hobs: observed heterozygosity; Hexp: expected heterozygosity; HWE-p: p- value of chi square test for Hardy-Weinberg equilibrium.
Table 2. Variation across 8 microsatellite loci in a population of 20 Sinanodonta woodiana individuals. Na: number of alleles; Hobs: observed heterozygosity; Hexp: expected heterozygosity; HWE-p: p- value of chi square test for Hardy-Weinberg equilibrium.
MarkerNaHobsHexpHWE-p
SW2140.9500.8740.245
SW380.6500.7100.338
SW470.7000.7650.104
SW780.7500.7910.523
SW13110.8000.8410.248
SW14110.9000.8640.810
SW15100.9000.8590.273
SW1890.9500.8490.176

Share and Cite

MDPI and ACS Style

Popa, O.P.; Popa, L.O.; Krapal, A.-M.; Murariu, D.; Iorgu, E.I.; Costache, M. Sinanodonta woodiana (Mollusca: Bivalvia: Unionidae): Isolation and Characterization of the First Microsatellite Markers. Int. J. Mol. Sci. 2011, 12, 5255-5260. https://doi.org/10.3390/ijms12085255

AMA Style

Popa OP, Popa LO, Krapal A-M, Murariu D, Iorgu EI, Costache M. Sinanodonta woodiana (Mollusca: Bivalvia: Unionidae): Isolation and Characterization of the First Microsatellite Markers. International Journal of Molecular Sciences. 2011; 12(8):5255-5260. https://doi.org/10.3390/ijms12085255

Chicago/Turabian Style

Popa, Oana Paula, Luis Ovidiu Popa, Ana-Maria Krapal, Dumitru Murariu, Elena Iulia Iorgu, and Marieta Costache. 2011. "Sinanodonta woodiana (Mollusca: Bivalvia: Unionidae): Isolation and Characterization of the First Microsatellite Markers" International Journal of Molecular Sciences 12, no. 8: 5255-5260. https://doi.org/10.3390/ijms12085255

APA Style

Popa, O. P., Popa, L. O., Krapal, A.-M., Murariu, D., Iorgu, E. I., & Costache, M. (2011). Sinanodonta woodiana (Mollusca: Bivalvia: Unionidae): Isolation and Characterization of the First Microsatellite Markers. International Journal of Molecular Sciences, 12(8), 5255-5260. https://doi.org/10.3390/ijms12085255

Article Metrics

Back to TopTop