Development of 30 Novel Polymorphic Expressed Sequence Tags (EST)-Derived Microsatellite Markers for the Miiuy Croaker, Miichthys miiuy
Abstract
:1. Introduction
2. Materials and Methods
3. Results and Discussion
4. Conclusions
Acknowledgements
References
- Zhang, QY; Hong, WS. Status and prospects of artificial propagation and breeding technique of marine fish in China in the 1990s. Mod Fish Inform 2000, 15, 3–6. (in Chinese). [Google Scholar]
- Shan, XJ; Cao, L; Huang, W; Dou, SZ. Feeding, morphological changes and allometric growth during starvation in miiuy croaker larvae. Environ. Biol. Fishes 2008, 86, 121–130. [Google Scholar]
- Shan, XJ; Xiao, ZZ; Huang, W; Dou, SZ. Effects of photoperiod on growth, mortality and digestive enzymes in miiuy croaker larvae and juveniles. Aquaculture 2008, 281, 70–76. [Google Scholar]
- Liu, YG; Liu, CY; Li, FZ; Li, ZX; Wang, L. Development of microsatellite markers in sea perch, Lateolabrax Japonicus, from codominant amplified fragment length polymorphism bands. J. World Aquacult. Soc 2009, 40, 522–530. [Google Scholar]
- Wang, RX; Xu, TJ; Sun, YN; He, GY. Polymorphic microsatellite loci from two enriched genomic libraries for the genetic analysis of the miiuy croaker, Miichthys miiuy. Genet. Mol. Res 2010, 9, 931–934. [Google Scholar]
- Xu, TJ; Shao, CW; Liao, XL; Ji, XS; Chen, SL. Isolation and characterization of polymorphic microsatellite DNA markers in the rock bream (Oplegnathus fasciatus). Conserv. Genet 2009, 10, 527–529. [Google Scholar]
- Liu, YG; Bao, BL; Liu, LX; Wang, L; Lin, H. Isolation and characterization of polymorphic microsatellite loci from RAPD product in half-smooth tongue sole (Cynoglossus semilaevis) and a test of cross-species amplification. Mol. Ecol. Res 2007, 8, 202–204. [Google Scholar]
- Ji, XS; Chen, SL; Ma, HY; Xu, TJ; Liao, XL; Jiang, YL. Isolation and characterization of 19 EST-linked polymorphic microsatellite loci for olive flounder (Paralichthys olivaceus). Aquacult. Res 2009, 40, 980–983. [Google Scholar]
- Edwards, KJ; Barker, JHA; Daly, A; Jones, C; Karp, A. Microsatellite libraries enriched for several microsatellite sequences in plants. Biotechniques 1996, 20, 758–760. [Google Scholar]
- Xu, TJ; Meng, FX; Sun, YN; Shi, G; Wang, RX. Identification of immune genes of the miiuy croaker (Miichthys miiuy) by sequencing and bioinformatic analysis of ESTs. Fish Shellfish Immunol 2010, 29, 1099–1105. [Google Scholar]
- Yeh, FC; Boyle, TJB. Population genetic analysis of co-dominant and dominant markers and quantitative traits. Belg. J. Bot 1997, 129, 157. [Google Scholar]
- Schneider, S; Roessli, D; Excoffier, L. ARLEQUIN: A Software for Population Genetics Date Analysis, Version 2.000; Genetics and Biometry Laboratory, Department of Anthropology, University of Geneva: Geneva, Switzerland, 2000. [Google Scholar]
- Rice, WE. Analyzing tables of statistical tests. Evolution 1989, 43, 223–225. [Google Scholar]
- van Oosterhout, C; Hutchinson, WF; Wills, DPM; Shipley, P. MICRO-CHECKER: software for identifying and correcting genotyping errors in mirosatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar]
Locus | GenBank Accession No. | Repeat Motif | Gene | Primer (5′-3′) [Forward (above) and Reverse (below)] | Tm (°C) | No. of Alleles | Size range (bp) | No. of Null Alleles | HO HE | P-Value |
---|---|---|---|---|---|---|---|---|---|---|
Mimi-4-C07 | GW668081 | (GAA)5 | Ras-related protein Rab-35 | TGAGGCACAATATGATGG ACCGAGGACTTGGCTACT | 52 | 5 | 249–288 | 1 | 0.1481 0.2732 | 0.0286 |
Mimi-5-B04 | GW668148 | (AGTCAG)3 | unknown | CTACCGCTGCTCTTCTGG GATGGCTGGTCTACTTCG | 49 | 4 | 144–162 | 0 | 0.4286 0.4662 | 0.0143 |
Mimi-5-G02 | GW668197 | (AGA)5 | NADH-cytochrome b5 reductase 2 | TGTCCGTGCTGTTCTTCC ATGGCTTATGTCCTGTTTCT | 49 | 5 | 157–169 | 0 | 0.2800 0.3502 | 0.5507 |
Mimi-8-D03 | GW668391 | (T)14 | unknown | TTCAGTCAGGAGATTCAGGGTG CAGCGGTTCAAACGGTCA | 48 | 6 | 119–128 | 1 | 0.4231 0.7360 | 0.0020 |
Mimi-13-G10 | GW668718 | (TTTG)5 | unknown | GCGACAACGCAGACAGGA CTTGGGCGGATGGTAGGA | 52 | 3 | 108–116 | 0 | 0.5217 0.6309 | 0.1552 |
Mimi-16-A03 | GW668869 | (T)15 | Cytochrome c | TGGAGAACCCAAAGAAAT CCACAAAGGAGCGTCATA | 52 | 7 | 282–297 | 1 | 0.3793 0.8119 | 0.0000 * |
Mimi-16-E10 | GW668916 | (TAGCT)5 | unknown | GTTCTTTCACTGGCATCT GCTGTTTCCACCTGTTTT | 50 | 6 | 189–224 | 1 | 0.4483 0.6062 | 0.0262 |
Mimi-16-H01 | GW668939 | (T)12 | unknown | CAGTTGTGGGTTTGTTTG TGTGGCGATGTTTCTTGT | 52 | 7 | 137–150 | 1 | 0.5909 0.8478 | 0.0117 |
Mimi-21-G10 | GW669314 | (TTTAT)3 | phosphatidic acid phosphatase type 2B | GAGCGGGCTTTCCATTCA TTCCCAAATCTGGTGTCTCG | 52 | 2 | 177–182 | 1 | 0.2222 0.3522 | 0.0636 |
Mimi-28-G08 | GW669768 | (A)14 | unknown | GGGGAAGCACTTTATG TCTTAGCGTGTTCTCGT | 52 | 5 | 199–203 | 1 | 0.1538 0.6380 | 0.0000 * |
Mimi-29-C05 | GW669810 | (AGG)5…(T)16 | similar to transmembrane protein | AGCCCTCCTCTGCTGTGA CTGTTGCCTCCTGCCTGT | 52 | 5 | 119–126 | 1 | 0.2759 0.5590 | 0.0311 |
Mimi-32-A10 | GW669955 | (A)14N12(T)17 | Transmembrane protein 32 precursor | GAACCACCCATCCTTTTA CTTTGCCCCTTCTGTCTA | 52 | 6 | 226–246 | 1 | 0.4348 0.7739 | 0.0008 |
Mimi-32-B08 | GW669962 | (A)14…(T)14 | unknown | CGTCGCACCAAGAATGAG TGAAACCTACCGTCTACAAAT | 50 | 5 | 236–245 | 1 | 0.3846 0.7398 | 0.0006 * |
Mimi-33-G06 | GW670085 | (CT)10N20(CA)9 | unknown | GGTAGGAGACTGGGTGGT CAATGTTTCAGGCAAATGTA | 50 | 5 | 259–279 | 1 | 0.4815 0.6723 | 0.0581 |
Mimi-34-A09 | GW670103 | (A)13 | unknown | TTTGGGTCACTAAATGGT CGTCTGTAAAGCAGGTAA | 50 | 6 | 221–242 | 1 | 0.5172 0.7992 | 0.0244 |
Mimi-35-E08 | GW670215 | (T)12 | unknown | ACGCACCCAACAACTCAG ATGCTCATCTCCGCCTTA | 50 | 3 | 175–182 | 1 | 0.1923 0.3288 | 0.0995 |
Mimi-36-C02 | GW670261 | (TTTTC)3 | ATPase, Ca++ transporting, plasma membrane 1a | AATATCCCTGCCCTGCTA TGTTCGCCATTGTCTTGC | 50 | 4 | 207–227 | 1 | 0.1034 0.3575 | 0.0001 * |
Mimi-40-C05 | GW670563 | (A)13 | unknown | GTGTAACAAATAACCCTCG TGCTGCTCGTCACAATAA | 50 | 4 | 131–143 | 1 | 0.4800 0.7224 | 0.0152 |
Mimi-40-E05 | GW670585 | (AAT)5 | Krueppel-like factor 6 | AGGGCTCTGATCCATACA TTCCGAAGTGCTCTACAA | 50 | 6 | 219–243 | 1 | 0.1333 0.4418 | 0.0037 |
Mimi-40-H12 | GW670618 | (CCT)5 | unknown | TCATCAGCACCAGCCTCT CACATCCTCTTACCTCCTATCT | 55 | 3 | 233–239 | 0 | 0.3704 0.3934 | 0.0136 |
Mimi-41-E11 | GW670665 | (GAA)5 | unknown | CCTCCTTCACCTCACCTT ACATCTGTCCAGCCGTTT | 52 | 3 | 238–244 | 1 | 0.1379 0.4120 | 0.0002 * |
Mimi-42-E04 | GW670734 | (ATA)7 | interleukin-8 receptor CXCR1 | CATTCATCACGGCTCCTT TTCCCACTCTTATCTATCCA | 48 | 6 | 163–181 | 0 | 0.7200 0.8196 | 0.1213 |
Mimi-42-G06 | GW670752 | (TCC)6 | unknown | TTGTTGTCTCGGTGATGG GACTCCTGCTGTTGCTCC | 52 | 6 | 139–181 | 0 | 0.3750 0.4787 | 0.4739 |
Mimi-43-H04 | GW670839 | (TTTC)6 | unknown | GCTTCCTGTCCCGTTTAT TTTGCTCCCGTGGGTTAT | 52 | 13 | 141–217 | 1 | 0.6552 0.8845 | 0.6188 |
Mimi-49-C10 | GW671186 | (A)26 | eIF5A | CGGCTTTACTTCAGTGGTT TCTCCTCCTCGGTTGTCG | 54 | 7 | 180–190 | 1 | 0.4583 0.8032 | 0.0192 |
Mimi-52-H10 | GW671455 | (GA)9(CTGT)4… (T)14 | unknown | ACGCATTTGTTTACTTTCTC CACCACCATTCAGTTTCT | 50 | 4 | 188–202 | 1 | 0.4074 0.7939 | 0.0001 * |
Mimi-54-A11 | GW671541 | (CTGGTC)6 | unknown | AACCAAAGGGACCAAACG GGAGCAGGCAGGTAAACG | 52 | 5 | 128–152 | 0 | 0.6207 0.7042 | 0.0000 * |
Mimi-54-D06 | GW671567 | (T)13…(A)15 | unknown | TCCTCCCATACAAACTAA GGTGGAAGACCGAAAA | 50 | 3 | 159–163 | 0 | 0.5769 0.6750 | 0.0000 * |
Mimi-56-G05 | GW671751 | (AGC)5 | unknown | AGACACCCGACCAGAACC ACAGCCTCCATCCACAAA | 54 | 4 | 154–160 | 0 | 0.7917 0.6764 | 0.5599 |
Mimi-57-A05 | GW671772 | (T)14 | unknown | CTCCTGCCCTTCGTGATT TCTTTCCCTGCTTGTTGTA | 50 | 6 | 113–133 | 1 | 0.1429 0.4292 | 0.0011 * |
© 2011 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Xu, T.; Sun, D.; Sun, Y.; Wang, R. Development of 30 Novel Polymorphic Expressed Sequence Tags (EST)-Derived Microsatellite Markers for the Miiuy Croaker, Miichthys miiuy. Int. J. Mol. Sci. 2011, 12, 4021-4026. https://doi.org/10.3390/ijms12064021
Xu T, Sun D, Sun Y, Wang R. Development of 30 Novel Polymorphic Expressed Sequence Tags (EST)-Derived Microsatellite Markers for the Miiuy Croaker, Miichthys miiuy. International Journal of Molecular Sciences. 2011; 12(6):4021-4026. https://doi.org/10.3390/ijms12064021
Chicago/Turabian StyleXu, Tianjun, Dianqiao Sun, Yuena Sun, and Rixin Wang. 2011. "Development of 30 Novel Polymorphic Expressed Sequence Tags (EST)-Derived Microsatellite Markers for the Miiuy Croaker, Miichthys miiuy" International Journal of Molecular Sciences 12, no. 6: 4021-4026. https://doi.org/10.3390/ijms12064021