Sixteen Polymorphic Simple Sequence Repeat Markers from Expressed Sequence Tags of the Chinese Mitten Crab Eriocheir sinensis
Abstract
:1. Introduction
2. Results and Discussion
3. Experimental Section
Acknowledgements
References
- Zhu, ZY; Shi, YH; Le, GW. Isolation and characterization of polymorphic microsatellites from Chinese mitten crab, Eriocheir sinensis. Mol. Ecol. Notes 2006, 6, 838–839. [Google Scholar]
- Chang, YM; Liang, LQ; Ma, HT; He, JG; Sun, XW. Microsatellite analysis of genetic diversity and population structure of Chinese mitten crab (Eriocheir sinensis). J. Genet. Genomics 2008, 35, 171–176. [Google Scholar]
- Sui, LY; Zhang, FM; Wang, XM; Bossier, P; Sorgeloos, P; Hanfling, B. Genetic diversity and population structure of the Chinese mitten crab Eriocheir sinensis in its native range. Mar. Biol 2009, 156, 1573–1583. [Google Scholar]
- Toth, G; Gaspari, Z; Jurka, J. Microsatellites in different eukaryotic genomes: Survey and analysis. Genome Res 2000, 10, 967–981. [Google Scholar]
- Liu, ZJ; Cordes, JF. DNA marker technologies and their applications in aquaculture genetics. Aquaculture 2004, 238, 1–37. [Google Scholar]
- Pérez, F; Ortiz, J; Zhinaula, M; Gonzabay, C; Calderón, J; Volckaert, F. Development of ESTSSR markers by data mining in three species of shrimp: Litopenaeus vannamei, Litopenaeus stylirostris and Trachypenaeus birdy. Mar. Biotechnol 2005, 7, 554–569. [Google Scholar]
- Li, HJ; Liu, X; Hu, JJ; Bao, ZM; Zhang, GF. A set of polymorphic microsatellite loci for the bay scallop, Argopecten irradians. Mol. Ecol. Notes 2007, 7, 422–424. [Google Scholar]
- Li, HJ; Liu, WD; Gao, XG; Zhu, D; Wang, J; Li, FY; He, CB. Identification of hostdefense genes and development of microsatellite markers from ESTs of hard clam Meretrix meretrix. Mol. Biol. Rep 2010. [Google Scholar] [CrossRef]
- Li, HJ; Zhu, D; Gao, XG; Li, YF; Wang, J; He, CB. Mining single nucleotide polymorphisms from EST data of hard clam Meretrix meretrix. Conserv. Genet. Resour 2010. [Google Scholar] [CrossRef]
- Yeh, FC; Yang, R; Boyle, TJ; Ye, Z; Xiyan, JM. POPGENE 32, Microsoft Window-based Freeware for Population Genetic Analysis; Version 1.32; Molecular Biology and Biotechnology Centre, University of Alberta: Edmonton, Canada, 2000. [Google Scholar]
Locus (Acc. No.) | Repeat motif | Primer pair sequence (5′-3′) | Expected Size (bp) | T (°C) | NA | HO | HE | PHW |
---|---|---|---|---|---|---|---|---|
ESMS03 (FG359457) | (AC)18 | F:CTGACGGCTACCTCCACTTC | 223 | 53 | 7 | 0.966 | 0.848 | 0.000 |
R:TTTCCTTCCATCCTGAGTCC | 7 | 6 | 0 | |||||
ESMS04 (FG359097) | (AGG)6 | F:GCCTGCCTCAAGAATGGGTT | 133 | 62 | 3 | 0.066 | 0.066 | 0.998 |
R:GGTTGGTCTCCAGGAAGTGAAT | 7 | 1 | 3 | |||||
ESMS05 (FG359055) | (TCA)7... | F:ACGATACCCAAAGCAGAGGAC | 211 | 62 | 3 | 0.333 | 0.287 | 0.612 |
(CCT)6 | R:ATGATGACGGAGACGACGAA | 3 | 6 | 1 | ||||
ESMS07 (FL574574) | (ACT)12 | F:GTCACCACTGCTGCTTCTGC | 168 | 60 | 3 | 0.333 | 0.552 | 0.065 |
R:ACATTTGACGGTGGGACTGC | 3 | 0 | 7 | |||||
ESMS11 (FG983239) | (AC)10 | F:TAGAGGTGGAAGATACTAGATGG | 246 | 57 | 3 | 0.466 | 0.424 | 0.504 |
R:TTGGAGGGTGGTAGGTTGAT | 7 | 9 | 3 | |||||
ESMS13 (FG981455) | (AC)15 | F:CGCACGGGAAATGGAACAGA | 249 | 53 | 6 | 0.966 | 0.814 | 0.000 |
R:GAGGCATTTGAAAAGATGAAGCAC | 7 | 7 | 5 | |||||
ESMS15 (FG982058) | (CCA)6 | F:GTGAAAGGACGGACGTATTGA | 217 | 62 | 3 | 0.133 | 0.243 | 0.012 |
R:GGAGGAAGAGGAGTGCGAGT | 3 | 5 | 8 | |||||
ESMS16 (FG982584) | (CCA)9 | F:ACTGATGCCTGACGAAGACTACCA | 184 | 62 | 6 | 0.866 | 0.774 | 0.486 |
(ACA)8 | R:CCTTTATGCCTTTATTGACCGAGAC | 7 | 0 | 7 | ||||
ESMS17 (FG983201) | (CA)13 | F:GTATCCACAAGAGCATAAAGCAA | 183 | 57 | 3 | 0.200 | 0.187 | 0.906 |
R:AGCCAAACCTGAGAACCACT | 0 | 6 | 2 | |||||
ESMS19 (FG360290) | (TG)13 | F:CTGAAGGTTTGCCTCGTGTT | 205 | 60 | 7 | 0.900 | 0.842 | 0.005 |
R:GGTGAAATGGACCAAATGAC | 0 | 9 | 0 | |||||
ESMS20 (FG359986) | (TC)35 | F:TTGCGGTATCTTGCGTCTCG | 220 | 62 | 10 | 0.966 | 0.905 | 0.000 |
R:ATGTACCACAGCAACGCCTC | 7 | 1 | 0 | |||||
ESMS21 (FG359967) | (AC)37 | F:GCAAACGAACTGATAAGCAC | 192 | 56 | 9 | 0.933 | 0.852 | 0.039 |
R:CTTTATGTTCCCAGGTGATG | 3 | 0 | 6 | |||||
ESMS24 (FG358074) | (CAC)6 | F:CTTATCTCAGCGATGATTTGC | 239 | 62 | 2 | 0.100 | 0.096 | 0.745 |
R:AGCAGTGCCTGGTTTGTATT | 0 | 6 | 5 | |||||
ESMS25 (FG360197) | (TG)17 | F:AACAGTTTGTAAGGTTCAGCAC | 203 | 56 | 7 | 0.966 | 0.833 | 0.020 |
R:TAGGGTGTAAATCCTCTGGC | 7 | 9 | 5 | |||||
ESMS26 (GE339913) | (AC)17... | F:ACGCACAAAGGCAACAAACTG | 153 | 62 | 2 | 0.333 | 0.333 | 0.999 |
(CGCA)5 | R:AGGAAACGGCTGGCGAGACAA | 3 | 3 | 7 | ||||
ESMS35 (GE340314) | (GAG)8 | F:TTGCCGAGAAGATCGCTTTGG | 184 | 62 | 5 | 0.266 | 0.587 | 0.005 |
R:GCCCGTCGCAGATACTGGTTT | 7 | 0 | 8 |
© 2010 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Gao, X.-G.; Li, H.-J.; Li, Y.-F.; Sui, L.-J.; Zhu, B.; Liang, Y.; Liu, W.-D.; He, C.-B. Sixteen Polymorphic Simple Sequence Repeat Markers from Expressed Sequence Tags of the Chinese Mitten Crab Eriocheir sinensis. Int. J. Mol. Sci. 2010, 11, 3035-3038. https://doi.org/10.3390/ijms11083035
Gao X-G, Li H-J, Li Y-F, Sui L-J, Zhu B, Liang Y, Liu W-D, He C-B. Sixteen Polymorphic Simple Sequence Repeat Markers from Expressed Sequence Tags of the Chinese Mitten Crab Eriocheir sinensis. International Journal of Molecular Sciences. 2010; 11(8):3035-3038. https://doi.org/10.3390/ijms11083035
Chicago/Turabian StyleGao, Xiang-Gang, Hong-Jun Li, Yun-Feng Li, Li-Jun Sui, Bao Zhu, Yu Liang, Wei-Dong Liu, and Chong-Bo He. 2010. "Sixteen Polymorphic Simple Sequence Repeat Markers from Expressed Sequence Tags of the Chinese Mitten Crab Eriocheir sinensis" International Journal of Molecular Sciences 11, no. 8: 3035-3038. https://doi.org/10.3390/ijms11083035