Synthesis and Characterization of Curcumin-Loaded Nanoparticles of Poly(Glycerol Sebacate): A Novel Highly Stable Anticancer System
Abstract
:1. Introduction
2. Results
2.1. Synthesis and Characterization of Poly(Glycerol Sebacate)
2.2. PGS-NPs Fabrication
2.3. PGS-NPs Stability Analysis in Cells Culture Medium
2.4. PGS-NPs Morphological Characterization
2.5. Curcumin Release in Cell Culture Medium
2.6. Cytotoxic Effects of Unloaded and Curcumin-Loaded PGS-NPs in HeLa Cervical Cancer Cells
2.7. Effect of Curcumin-Loaded PGS-NPs in Inducing Apoptosis of HeLa Cells
3. Materials and Methods
3.1. Materials
3.2. Polymer Preparation
3.2.1. PGS Synthesis
3.2.2. PGS Characterization
3.3. PGS-NPs Preparation
3.3.1. Formulation Method
3.3.2. Procedure Optimization
3.4. Curcumin Encapsulation Efficiency
3.5. PGS-NPs Morphological Characterization
3.6. Curcumin In Vitro Release Studies
3.7. UPLC Analysis
3.8. Cell Culture Assays—Cytotoxicity Study
3.8.1. Cell Culture and MTT Assay
3.8.2. RNA Extraction and Real-Time RT-PCR Analysis
3.8.3. Western Blotting
3.8.4. Statistics
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Cancer: Data and Statistics. Available online: https://www.euro.who.int/en/health-topics/noncommunicable-diseases/cancer/data-and-statistics (accessed on 1 September 2022).
- Cai, S.; Yang, Q.; Bagby, T.R.; Forrest, M.L. Lymphatic drug delivery using engineered liposomes and solid lipid nanoparticles. Adv. Drug Deliv. Rev. 2011, 63, 901–908. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, K.; Li, D.; Shi, C.; Ma, X.; Rong, G.; Kang, H.; Wang, X.; Sun, B. Biodegradable Polymeric Nanoparticles as the Delivery Carrier for Drug. Curr. Drug Deliv. 2016, 13, 494–499. [Google Scholar] [CrossRef] [PubMed]
- Masserini, M. Nanoparticles for Brain Drug Delivery. ISRN Biochem. 2013, 2013, 238428. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Owens, D.E.; Peppas, N.A. Opsonization, biodistribution, and pharmacokinetics of polymeric nanoparticles. Int. J. Pharm. 2006, 307, 93–102. [Google Scholar] [CrossRef]
- Stylianopoulos, T. EPR-effect: Utilizing size-dependent nanoparticle delivery to solid tumors. Ther. Deliv. 2013, 4, 421–423. [Google Scholar] [CrossRef]
- Cho, K.; Wang, X.; Nie, S.; Chen, Z.; Shin, D.M. Therapeutic nanoparticles for drug delivery in cancer. Clin. Cancer Res. 2008, 14, 1310–1316. [Google Scholar] [CrossRef] [Green Version]
- Maeda, H.; Nakamura, H.; Fang, J. The EPR effect for macromolecular drug delivery to solid tumors: Improvement of tumor uptake, lowering of systemic toxicity, and distinct tumor imaging in vivo. Adv. Drug Deliv. Rev. 2013, 65, 71–79. [Google Scholar] [CrossRef]
- Chiellini, E.; Covolan, V.L.; Orsini, L.M.; Solaro, R. Polymeric nanoparticles based on polylactide and related copolymers. In Macromolecular Symposia; Wiley: Weinheim, Germany, 2003; Volume 197, pp. 345–354. [Google Scholar]
- Vogt, L.; Ruther, F.; Salehi, S.; Boccaccini, A.R. Poly(Glycerol Sebacate) in Biomedical Applications—A Review of the Recent Literature. Adv. Healthc. Mater. 2021, 10, 2002026. [Google Scholar] [CrossRef]
- Wu, Z.; Jin, K.; Wang, L.; Fan, Y. A Review: Optimization for Poly(glycerol sebacate) and Fabrication Techniques for Its Centered Scaffolds. Macromol. Biosci. 2021, 21, 2100022. [Google Scholar] [CrossRef]
- Loh, X.J.; Abdul Karim, A.; Owh, C. Poly(glycerol sebacate) biomaterial: Synthesis and biomedical applications. J. Mater. Chem. B 2015, 3, 7641–7652. [Google Scholar] [CrossRef]
- Sha, D.; Wu, Z.; Zhang, J.; Ma, Y.; Yang, Z.; Yuan, Y. Development of modified and multifunctional poly(glycerol sebacate) (PGS)-based biomaterials for biomedical applications. Eur. Polym. J. 2021, 161, 110830. [Google Scholar] [CrossRef]
- Louage, B.; Tack, L.; Wang, Y.; De Geest, B.G. Poly(glycerol sebacate) nanoparticles for encapsulation of hydrophobic anti-cancer drugs. Polym. Chem. 2017, 8, 5033–5038. [Google Scholar] [CrossRef]
- Sivanesan, D.; Verma, R.S.; Prasad, E. 5FU encapsulated polyglycerol sebacate nanoparticles as anti-cancer drug carriers. RSC Adv. 2021, 11, 18984–18993. [Google Scholar] [CrossRef] [PubMed]
- Hawley, A.E.; Davis, S.S.; Illum, L. Targeting of colloids to lymph nodes: Influence of lymphatic physiology and colloidal characteristics. Adv. Drug Deliv. Rev. 1995, 17, 129–148. [Google Scholar] [CrossRef]
- Tamvakopoulos, C.; Dimas, K.; Sofianos, Z.D.; Hatziantoniou, S.; Han, Z.; Liu, Z.L.; Wyche, J.H.; Pantazis, P. Metabolism and anticancer activity of the curcumin analogue, dimethoxycurcumin. Clin. Cancer Res. 2007, 13, 1269–1277. [Google Scholar] [CrossRef] [Green Version]
- Subramani, P.A.; Panati, K.; Narala, V.R. Curcumin Nanotechnologies and Its Anticancer Activity. Nutr. Cancer 2017, 69, 381–393. [Google Scholar] [CrossRef]
- Allegra, A.; Innao, V.; Russo, S.; Gerace, D.; Alonci, A.; Musolino, C. Anticancer Activity of Curcumin and Its Analogues: Preclinical and Clinical Studies. Cancer Investig. 2017, 35, 1–22. [Google Scholar] [CrossRef]
- Aggarwal, B.B.; Kumar, A.; Bharti, A.C. Anticancer potential of curcumin: Preclinical and clinical studies. Anticancer Res. 2003, 23, 363–398. [Google Scholar]
- Basniwal, R.K.; Khosla, R.; Jain, N. Improving the anticancer activity of curcumin using nanocurcumin dispersion in water. Nutr. Cancer 2014, 66, 1015–1022. [Google Scholar] [CrossRef]
- Yallapu, M.M.; Khan, S.; Maher, D.M.; Ebeling, M.C.; Sundram, V.; Chauhan, N.; Ganju, A.; Balakrishna, S.; Gupta, B.K.; Zafar, N.; et al. Anti-cancer activity of curcumin loaded nanoparticles in prostate cancer. Biomaterials 2014, 35, 8635–8648. [Google Scholar] [CrossRef] [Green Version]
- D’Angelo, N.A.; Noronha, M.A.; Kurnik, I.S.; Câmara, M.C.C.; Vieira, J.M.; Abrunhosa, L.; Martins, J.T.; Alves, T.F.R.; Tundisi, L.L.; Ataide, J.A.; et al. Curcumin encapsulation in nanostructures for cancer therapy: A 10-year overview. Int. J. Pharm. 2021, 604, 120534. [Google Scholar] [CrossRef] [PubMed]
- Hornig, S.; Heinze, T.; Becer, C.R.; Schubert, U.S. Synthetic polymeric nanoparticles by nanoprecipitation. J. Mater. Chem. 2009, 19, 3838–3840. [Google Scholar] [CrossRef]
- Errico, C.; Goñi-De-Cerio, F.; Alderighi, M.; Ferri, M.; Suarez-Merino, B.; Soroka, Y.; Frǔié-Zlotkin, M.; Chiellini, F. Retinyl palmitate-loaded poly(lactide-co-glycolide) nanoparticles for the topical treatment of skin diseases. J. Bioact. Compat. Polym. 2012, 27, 604–620. [Google Scholar] [CrossRef]
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: Globocan Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- Burmeister, C.A.; Khan, S.F.; Schäfer, G.; Mbatani, N.; Adams, T.; Moodley, J.; Prince, S. Cervical cancer therapies: Current challenges and future perspectives. Tumour Virus Res. 2022, 13, 200238. [Google Scholar] [CrossRef]
- Maleki Dana, P.; Sadoughi, F.; Asemi, Z.; Yousefi, B. The role of polyphenols in overcoming cancer drug resistance: A comprehensive review. Cell. Mol. Biol. Lett. 2022, 27, 1–26. [Google Scholar] [CrossRef]
- Wang, Y.; Ameer, G.A.; Sheppard, B.J.; Langer, R. A tough biodegradable elastomer. Nat. Biotechnol. 2002, 20, 602–606. [Google Scholar] [CrossRef]
- Chen, Q.Z.; Bismarck, A.; Hansen, U.; Junaid, S.; Tran, M.Q.; Harding, S.E.; Ali, N.N.; Boccaccini, A.R. Characterisation of a soft elastomer poly(glycerol sebacate) designed to match the mechanical properties of myocardial tissue. Biomaterials 2008, 29, 47–57. [Google Scholar] [CrossRef]
- Rai, R.; Tallawi, M.; Grigore, A.; Boccaccini, A.R. Synthesis, properties and biomedical applications of poly(glycerol sebacate) (PGS): A review. Prog. Polym. Sci. 2012, 37, 1051–1078. [Google Scholar] [CrossRef]
- Rafiee, Z.; Nejatian, M.; Daeihamed, M.; Jafari, S.M. Application of different nanocarriers for encapsulation of curcumin. Crit. Rev. Food Sci. Nutr. 2019, 59, 3468–3497. [Google Scholar] [CrossRef]
- Mukerjee, A.; Vishwanatha, J.K. Formulation, characterization and evaluation of curcumin-loaded PLGA nanospheres for cancer therapy. Anticancer Res. 2009, 29, 3867–3875. [Google Scholar] [PubMed]
- Sari, T.P.; Mann, B.; Kumar, R.; Singh, R.R.B.; Sharma, R.; Bhardwaj, M.; Athira, S. Preparation and characterization of nanoemulsion encapsulating curcumin. Food Hydrocoll. 2015, 43, 540–546. [Google Scholar] [CrossRef]
- De Moraes Carvalho, D.; Takeuchi, K.P.; Geraldine, R.M.; de Moura, C.J.; Torres, M.C.L. Production, solubility and antioxidant activity of curcumin nanosuspension. Food Sci. Technol. 2015, 35, 115–119. [Google Scholar] [CrossRef] [Green Version]
- Deng, L.; Kang, X.; Liu, Y.; Feng, F.; Zhang, H. Effects of surfactants on the formation of gelatin nanofibres for controlled release of curcumin. Food Chem. 2017, 231, 70–77. [Google Scholar] [CrossRef] [PubMed]
- Petroni, K.; Trinei, M.; Fornari, M.; Calvenzani, V.; Marinelli, A.; Micheli, L.A.; Pilu, R.; Matros, A.; Mock, H.P.; Tonelli, C.; et al. Dietary cyanidin 3-glucoside from purple corn ameliorates doxorubicin-induced cardiotoxicity in mice. Nutr. Metab. Cardiovasc. Dis. 2017, 27, 462–469. [Google Scholar] [CrossRef] [PubMed]
Run | Mean Diameter (nm) | ||
---|---|---|---|
0 Days | 7 Days | 14 Days | |
PGS0.1Blank | 89 ± 1 PdI: 0.21 | 92 ± 2 PdI: 0.21 | 96 ± 2 PdI: 0.04 |
PGS0.1C0.01 | 81 ± 1 PdI: 0.25 | 225 ± 14 PdI: 0.73 (presence of macroaggregates) | - |
PGS0.5Blank | 123 ± 1 PdI: 0.01 | 120 ± 3 PdI: 0.01 | 119 ± 3 PdI: 0.08 |
PGS0.5C0.05 | 106 ± 2 PdI:0.21 | 136 ± 4 PdI:0.82 (presence of macroaggregates) | - |
PGS1.0Blank | 164 ± 4 PdI: 0.01 | 165 ± 3 PdI: 0.01 | 163 ± 4 PdI: 0.03 |
PGS1.0C0.1 | 158 ± 4 PdI:0.03 | 159 ± 6 PdI:0.03 | 130 ± 4 PdI: 0.05 |
PGS5.0Blank | 234 ± 6 PdI: 0.02 | 229 ± 6 PdI: 0.03 | 230 ± 6 PdI: 0.01 |
PGS5.0C0.5 | 211 ± 2 PdI: 0.001 | 173 ± 4 PdI: 0.02 | 169 ± 2 PdI: 0.02 |
Run in Deionized Water | Mean Diameter (nm) | |||
Day 0 | Day 1 | Day 2 | Day 3 | |
PGS1.0C0.1 [0.2 mg/mL] | 108 ± 3 PdI: 0.23 | 87 ± 1 PdI: 0.05 | 85 ± 2 PdI: 0.06 | 84 ± 2 PdI: 0.06 |
PGS5.0C0.5 [0.2 mg/mL] | 136 ± 2 PdI: 0.07 | 136 ± 2 PdI: 0.07 | 136 ± 1 PdI: 0.02 | 135 ± 1 PdI: 0.02 |
Run in DMEM | Mean Diameter (nm) | |||
Day 0 | Day 1 | Day 2 | Day 3 | |
PGS1.0C0.1 [0.2 mg/mL] | 148 ± 2 PdI: 0.20 | 137 ± 2 PdI: 0.21 | 129 ± 1 PdI: 0.22 | 127 ± 1 PdI: 0.24 |
PGS5.0C0.5 [0.2 mg/mL] | 137 ± 1 PdI: 0.17 | 129 ± 1 PdI: 0.19 | 129 ± 1 PdI: 0. 21 | 129 ± 1 PdI: 0.19 |
Organic Phase Composition | ||
---|---|---|
Sample | PGS | Curcumin |
PGS0.1Blank | 1 mg [0.1 mg/mL] | \ |
PGS0.1C0.01 | 1 mg [0.1 mg/mL] | 0.1 mg [0.01 mg/mL] |
PGS0.5Blank | 5 mg [0.5 mg/mL] | \ |
PGS0.5C0.05 | 5 mg [0.5 mg/mL] | 0.5 mg [0.05 mg/mL] |
PGS1.0Blank | 10 mg [1 mg/mL] | \ |
PGS1.0C0.1 | 10 mg [1 mg/mL] | 1 mg [0.1 mg/mL] |
PGS5.0Blank | 50 mg [5 mg/mL] | \ |
PGS5.0C0.5 | 50 mg [5 mg/mL] | 5 mg [0.5 mg/mL] |
Primer | Primer Sequence 5′–3′ |
---|---|
hs-HPV18-E6 fw | GTGCCAGAAACCGTTGAATCC |
hs-HPV18-E6 rv | AGTCTTTCCTGTCGTGCTCG |
hs-p53 fw | GAGGGATGTTTGGGAGATGTAA |
hs-p53 rv | CCCTGGTTAGTACGGTGAAGTG |
hs-p21 fw | GTCACTGTCTTGTACCCTTGTG |
hs-p21 rv | AGAAATCTGTCATGCTGGTCTGC |
hs-Bax fw | CATGGGCTGGACATTGGACTT |
hs-Bax rv | AGGGACATCAGTCGCTTCAGT |
hs-Gapdh fw | GCCTCAAGATCATCAGCAATGC |
hs-Gapdh rv | CCACGATACCAAAGTTGTCATGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Massironi, A.; Marzorati, S.; Marinelli, A.; Toccaceli, M.; Gazzotti, S.; Ortenzi, M.A.; Maggioni, D.; Petroni, K.; Verotta, L. Synthesis and Characterization of Curcumin-Loaded Nanoparticles of Poly(Glycerol Sebacate): A Novel Highly Stable Anticancer System. Molecules 2022, 27, 6997. https://doi.org/10.3390/molecules27206997
Massironi A, Marzorati S, Marinelli A, Toccaceli M, Gazzotti S, Ortenzi MA, Maggioni D, Petroni K, Verotta L. Synthesis and Characterization of Curcumin-Loaded Nanoparticles of Poly(Glycerol Sebacate): A Novel Highly Stable Anticancer System. Molecules. 2022; 27(20):6997. https://doi.org/10.3390/molecules27206997
Chicago/Turabian StyleMassironi, Alessio, Stefania Marzorati, Alessandra Marinelli, Marta Toccaceli, Stefano Gazzotti, Marco Aldo Ortenzi, Daniela Maggioni, Katia Petroni, and Luisella Verotta. 2022. "Synthesis and Characterization of Curcumin-Loaded Nanoparticles of Poly(Glycerol Sebacate): A Novel Highly Stable Anticancer System" Molecules 27, no. 20: 6997. https://doi.org/10.3390/molecules27206997