Next Article in Journal
Iridium-Catalysed ortho-Directed Deuterium Labelling of Aromatic Esters—An Experimental and Theoretical Study on Directing Group Chemoselectivity
Next Article in Special Issue
Potential Mechanism of Action of 3′-Demethoxy-6-O-demethyl-isoguaiacin on Methicillin Resistant Staphylococcus aureus
Previous Article in Journal
Anion Recognition by Pyrylium Cations and Thio-, Seleno- and Telluro- Analogues: A Combined Theoretical and Cambridge Structural Database Study
Previous Article in Special Issue
Antibacterial Activities and Antibacterial Mechanism of Polygonum cuspidatum Extracts against Nosocomial Drug-Resistant Pathogens
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antibacterial Activity and Mechanism of Action of Sulfone Derivatives Containing 1,3,4-Oxadiazole Moieties on Rice Bacterial Leaf Blight

State Key Laboratory Breeding Base of Green Pesticide and Agricultural Bioengineering, Key Laboratory of Green Pesticide and Agricultural Bioengineering, Ministry of Education, Guizhou University, Huaxi District, Guiyang 550025, China
*
Author to whom correspondence should be addressed.
Molecules 2015, 20(7), 11660-11675; https://doi.org/10.3390/molecules200711660
Submission received: 29 April 2015 / Revised: 4 June 2015 / Accepted: 12 June 2015 / Published: 24 June 2015

Abstract

In this study, sulfone derivatives containing 1,3,4-oxadiazole moieties indicated good antibacterial activities against rice bacterial leaf blight caused by the pathogen Xanthomonas oryzaepv. pv. oryzae (Xoo). In particular, 2-(methylsulfonyl)-5-(4-fluorobenzyl)-1,3,4-oxadiazole revealed the best antibacterial activity against Xoo, with a half-maximal effective concentration (EC50) of 9.89 μg/mL, which was better than those of the commercial agents of bismerthiazole (92.61 μg/mL) and thiodiazole copper (121.82 μg/mL). In vivo antibacterial activity tests under greenhouse conditions and field trials demonstrated that 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole was effective in reducing rice bacterial leaf blight. Meanwhile, 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole stimulate the increase in superoxide dismutase (SOD) and peroxidase (POD) activities in rice, causing marked enhancement of plant resistance against rice bacterial leaf blight. It could also improve the chlorophyll content and restrain the increase in the malondialdehyde (MDA) content in rice to considerably reduce the amount of damage caused by Xoo. Moreover, 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole, at a concentration of 20 μg/mL, could inhibit the production of extracellular polysaccharide (EPS) with an inhibition ratio of 94.52%, and reduce the gene expression levels of gumB, gumG, gumM, and xanA, with inhibition ratios of 94.88%, 68.14%, 86.76%, and 79.21%, respectively.

1. Introduction

Rice is one of the most important staple crops around the world. Unfortunately, grain yield has decreased significantly because of rice bacterial leaf blight, which is caused by the pathogen Xanthomonas oryzae pv. oryzae (Xoo), the most important and well-known bacterial disease of rice in rice-growing regions. Bacterial leaf blight can cause leaf wilting, affect photosynthesis, reduce 1000-grain weight, and generally result in yield losses by 20%–30% and even 100% under severe conditions [1,2,3,4,5]. Although bismerthiazole and streptomycin are the main tools for controlling rice bacterial leaf blight in China, Xoo has developed high resistance to both these bactericides [6,7]. Therefore, the search for new antibacterial agents remains a difficult task, and such agents are greatly needed in the field of agricultural bactericides.
Sulfone derivatives containing 1,3,4-oxadiazole moieties have a broad spectrum of bioactivities, such as antibacterial [8,9,10], antifungal [11,12], insecticidal [13], herbicidal [14], anticancer [15], and anti-HIV-1 [16] properties. Over the past few years, studies on the synthesis and bioactivity of sulfone derivatives containing 1,3,4-oxadiazole moieties have attracted considerable attention. We previously demonstrated that such sulfone derivatives (Figure 1) display potent antibacterial activities. Specifically, 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole (CAS Registry Number: 142225-95-4) showed the best antibacterial activity against tobacco and tomato bacterial wilts caused by Ralstonia solanacearum (R. solanacearum) with half-maximal effective concentration (EC50) values of 8.29 and 19.77 μg/mL, respectively [8]. However, in our previous work, we only reported and discussed the compound’s activities in the control of R. solanacearum. The biological effects of these sulfone derivatives containing 1,3,4-oxadiazole moieties against rice bacterial leaf blight were not reported, and the underlying mechanism of these compounds on rice bacterial leaf blight remained unclear.
Figure 1. Compounds previously reported against tobacco and tomato bacterial wilts.
Figure 1. Compounds previously reported against tobacco and tomato bacterial wilts.
In this study, we found that 1,3,4-oxadiazole-containg sulfone derivatives, which demonstrate potent antibacterial activities against R. solanacearum, were highly effective against rice bacterial leaf blight in vitro and in vivo. Meanwhile, 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole could stimulate an increase in superoxide dismutase (SOD) and peroxidase (POD) activities in rice, causing a marked enhancement of plant resistance against rice bacterial leaf blight. It could also improve the chlorophyll content and restrain the increase in the malondialdehyde (MDA) content in rice to considerably reduce the amount of damage caused by Xoo. Moreover, 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole could obviously inhibit the production of extracellular polysaccharide (EPS) and reduce the gene expression levels of gumB, gumG, gumM, and xanA.

2. Results and Discussion

2.1. In Vitro Antibacterial Bioassay

As shown in Table 1, all the tested compounds demonstrated potent antibacterial activities against Xoo, with half-maximal effective concentration (EC50) values ranging from 9.89 μg/mL to 63.59 μg/mL, which were even better than those of bismerthiazole (92.61 μg/mL) and thiodiazole copper (121.82 μg/mL). The antibacterial tests showed that when small electron-with-drawing groups (e.g., -F) at the 4-position and a methyl substituted sulfonyl substituent were attached to the oxadiazole 2,5-positions, the corresponding compound 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole presented the best antibacterial activity compared to the rest of the test compounds. Meanwhile, the in vitro activity against Xoo of the compound 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole, with an EC50 value of 9.89 μg/mL, was better than the activity against tomato bacterial wilt (19.77 μg/mL) and slightly below the activity against tobacco bacterial wilt (8.29 μg/mL).
Table 1. Antibacterial activities against Xanthomonas oryzae pv. oryzaeof the title compounds.
Table 1. Antibacterial activities against Xanthomonas oryzae pv. oryzaeof the title compounds.
Compds.Toxic Regression EquationREC50 (μg/mL)
2-(Methylsulfonyl)-5-phenyl-1,3,4-oxadiazoley = 2.16x + 2.180.9820.07 ± 1.21
2-(Ethylsulfonyl)-5-phenyl-1,3,4-oxadiazoley = 1.52x + 2.770.9829.00 ± 1.25
2-(Methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazoley = 4.13x + 0.890.959.89 ± 1.52
2-(Ethylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazoley = 3.28x + 1.610.9610.80 ± 1.43
2-(Methylsulfonyl)-5-(4-chlorophenyl)-1,3,4-oxadiazoley = 1.72x + 2.640.9923.21 ± 0.98
2-(Ethylsulfonyl)-5-(4-chlorophenyl)-1,3,4-oxadiazoley = 1.60x + 2.250.9952.61 ± 1.08
2-(Methylsulfonyl)-5-(2,4-dichlorophenyl)-1,3,4-oxadiazoley = 1.04x + 3.210.9952.14 ± 1.05
2-(Ethylsulfonyl)-5-(2,4-dichlorophenyl)-1,3,4-oxadiazoley = 1.43x + 2.420.9763.95 ± 1.05
Bismerthiazoley = 1.50x + 2.050.9892.61 ± 2.15
Thiodiazole coppery = 1.54x + 1.790.98121.82 ± 3.59

2.2. In Vivo Antibacterial Bioassay

The results are listed in Table 2. At 15th day after spraying, 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole had potent curative activity of 38.17% against rice bacterial leaf blight at 200 μg/mL, which was better than those of bismerthiazole (30.21%) and thiodiazole copper (29.51%). At 28th day after spraying, the protective activity of 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole against rice bacterial leaf blight at 200 μg/mL was 41.82%, which was superior to those of bismerthiazole (37.51%) and thiodiazole copper (25.58%).
Table 2. Control efficiency of the testing compounds against rice bacterial leaf blight under greenhouse conditions at the concentration of 200 μg/mL.
Table 2. Control efficiency of the testing compounds against rice bacterial leaf blight under greenhouse conditions at the concentration of 200 μg/mL.
Compds.15 Days after Spraying 28 Days after Spraying
Disease Index (%)Curative Activity (%) cDisease Index (%)Protection Activity (%) c
2-(Methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole57.63 ± 3.5138.17 ± 2.15 A54.79 ± 2.7841.82 ± 2.45 A
Bismerthiazole a65.05 ± 2.2630.21 ± 3.43 B58.85 ± 3.1237.51 ± 2.54 C
Thiodiazole copper b65.70 ± 2.7329.51 ± 4.76 C70.08 ± 3.6725.58 ± 2.42 B
Untreated blank control93.21 ± 1.790 94.17 ± 2.550
a: 20% WP; b: 3% WP; c: Statistical analysis was conducted via the ANOVA method at a condition of equal variances assumed (p > 0.05) and equal variances not assumed (p < 0.05). Different capital letters indicate the values of control efficiency with significant difference among different treatment groups at p < 0.05.

2.3. Field Trial against Rice Bacterial Leaf Blight

The results are summarized in Table 3. At 15th day after the third spraying, the control efficiency of 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole at 150 g ai/ha against rice bacterial leaf blight was 81.34%, which was better than those of bismerthiazole (76.19%) and zhongshengmycin (71.87%).
Table 3. Field trials of the testing compounds against rice bacterial leaf blight.
Table 3. Field trials of the testing compounds against rice bacterial leaf blight.
Compds.Dosage (g ai/ha) d15 Days after the Third Spraying
Disease Index (%)Control Efficiency (%) e
2-(Methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole a1502.03 ± 1.2281.34 ± 2.76 A
Bismerthiazole b3752.59 ± 1.5476.19 ± 3.54 C
Zhongshengmycin c453.06 ± 1.8671.87 ± 4.33 B
Untreated blank control010.88 ± 2.320
a: 20% SC; b:20% WP; c: 3% WP; d: Active ingredient; e: Statistical analysis was conducted via the ANOVA method at a condition of equal variances assumed (p > 0.05) and equal variances not assumed (p < 0.05). Different capital letters indicate the values of control efficiency with significant difference among different treatment groups at p < 0.05.

2.4. Determination of SOD and POD Activities

SOD, a key enzyme that resists biological oxidation in plant, catalyzes the reduction of superoxide anions (O2) to hydrogen peroxide (H2O2). The diminished capacity for O2 removal causes a decreased ability of progeria cells to minimize oxidative damage may be a key factor in the disease. It plays a critical role in the defense of cells against the toxic effects of oxygen radicals [17].
POD constitutes a class of enzymes extensively distributed in plants and it has been shown that POD plays an active role in metabolism. An important function attributed to POD in plants concerns lignin synthesis. In many cases, particularly for plant-microbe interactions, this has been suggested as defense responses of plants to the stress [18].
As shown in Figure 2, SOD and POD activities in rice were enhanced by 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole at all sampling times, and the contents changed approximately in a Λ-shape manner and peaked on the 5th day with a rate of increase of 62.67% and 50.65%, respectively. Nevertheless, SOD and POD activities showed a declining tendency as time progressed from 5th day to 7th day. The value during this period was observed to be higher than the one inoculated by Xoo and treated with water. These results showed that 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazolecould improve the disease resistance of plants, which rely on inducible defense responses in the form of enzymes that are activated for controlling rice bacterial leaf blight.
Figure 2. The changes of SOD (a) and POD (b) activities (The data presented are the mean ± SD). T1: Xoo + Compound 2-(methyl sulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole; T2: Xoo + Bismerthiazol; T3: Xoo; T4: Untreated blank control.
Figure 2. The changes of SOD (a) and POD (b) activities (The data presented are the mean ± SD). T1: Xoo + Compound 2-(methyl sulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole; T2: Xoo + Bismerthiazol; T3: Xoo; T4: Untreated blank control.

2.5. Determination of Chlorophyll Content in Rice

Photosynthesis is a special, and the most basic, life process of green plants providing themselves necessary growth and energy [19]. Chlorophyll is the photosynthetic organelle of green plants whose content is closely related to photosynthesis, extent of bacterial infection in plants leading to proliferation and destruction of the plant chloroplasts and factors retarding the synthesis of chlorophyll causing leaf chlorosis [20].
As shown in Figure 3, after rice leaves were inoculated with Xoo, the chlorophyll content decreased during days 1–7 and reached the lowest value on the 7th day. However, the chlorophyll content of rice leaves treated with 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole was higher than those of leaves inoculated with Xoo and treated by bismerthiazole, but lower than those of leaves treated with water during days 1–7. Figure 3 also shows that Xoo infection of rice lowered the chlorophyll content, but rice treated by 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole showed an enhancement in chlorophyll content. This finding indicated that 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole may destroy Xoo in rice, thereby enhancing the host’s resistance to disease. However, the chlorophyll content of rice treated with 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole in each treatment period was found to be lower than that in the healthy control, indicating that 2-(methyl- sulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole may not completely suppress Xoo-induced chloroplast damage.
Figure 3. The changes of chlorophyll content in rice (The data presented are the mean ± SD). T1: Xoo + Compound 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole; T2: Xoo + Bismerthiazole; T3: Xoo; T4: Untreated blank control.
Figure 3. The changes of chlorophyll content in rice (The data presented are the mean ± SD). T1: Xoo + Compound 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole; T2: Xoo + Bismerthiazole; T3: Xoo; T4: Untreated blank control.

2.6. Determination of MDA Content in Rice

Increasing appreciation of the causative role of oxidative injury in many disease states places great importance on the reliable assessment of lipid peroxidation. MDA is one of several low-molecular-weight end products formed via the decomposition of certain primary and secondary lipid peroxidation products [21].
As shown in Figure 4, the MDA content in rice was increased in different treatment groups at all sampling times. It reached the highest value at 7th day, and it increased to 6.39 μM/L after treatment with 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole. This value was higher than that in rice treated with water (6.39 μM/L) but lower than the one inoculated with Xoo (7.30 μM/L) and the one treated with bismerthiazole (7.17 μM/L) during 1–7 days. The MDA content demonstrated that 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole could restrain the increase in the MDA content in rice, thereby enhancing the host’s resistance to the disease.
Figure 4. The changes of MDA content in rice (The data presented are the mean ± SD). T1: Xoo + Compound 2-(methyl sulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole; T2: Xoo + Bismerthiazol; T3: Xoo; T4: Untreated blank control.
Figure 4. The changes of MDA content in rice (The data presented are the mean ± SD). T1: Xoo + Compound 2-(methyl sulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole; T2: Xoo + Bismerthiazol; T3: Xoo; T4: Untreated blank control.

2.7. Biofilm Formation

2-(Methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole was hypothesized to be involved in biofilm formation. As shown in Figure 5, less biofilm was observed for the treatment of 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole than the blank control. The absorbance of crystal violet in the biofilm-staining assay for the blank control (optical density at 570 nm (OD570), 0.300) was 1.5 times greater than that of the treatment group (OD570, 0.204).Three replicates were used for quantitative measurements of biofilm.
Figure 5. Effect on the biofilm formation. A: Untreated blank control; B: Xoo + Compound 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole.
Figure 5. Effect on the biofilm formation. A: Untreated blank control; B: Xoo + Compound 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole.

2.8. Quantitative Determination of EPS Production

EPS, high-molecular weight compounds secreted by microorganisms into their environment, establish the functional and structural integrity of biofilms. EPS are considered the fundamental component that determines the physiochemical properties of a biofilm. EPS can protect pathogenic bacteria and contribute to their pathogenicity. A previous study reported that EPS, one pathogenic factor of Xoo, can lead to wilting of rice leaves and reduce EPS production to decrease the pathogenicity.
As shown in Figure 6, 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole, at the concentrations of 2.5, 5, 10, and 20 μg/mL, could obviously inhibit the EPS production of Xoo, with inhibition rates of 12.76%, 34.29%, 56.47%, and 94.52%, respectively. These results demonstrated that 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazolecould reduce EPS production to lower the pathogenic ability of Xoo.
Figure 6. Inhibition rate of EPS of Xoo (The data presented are the mean ± SD). T1: Xoo + Compound 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole; T2: Untreated blank control.
Figure 6. Inhibition rate of EPS of Xoo (The data presented are the mean ± SD). T1: Xoo + Compound 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole; T2: Untreated blank control.

2.9. EPS Gene Expression Level in Xoo

The biosynthetic pathway by which EPS is produced involves three steps: the first step is the conversion of simple sugars to nucleotidyl derivative precursors; the second step is the assembly of pentasaccharide subunits attached to an inner-membrane polyprenol phosphate carrier, with addition of acetyl and pyruvate groups; and the third step is the polymerization of the pentasaccharide repeating units and secretion of EPS [22]. XanA coding for phosphoglucomutase/phosphomannomutase, which can be glucose-6-phosphate into glucose-1-phosphate in the first step of EPS biosynthesis [23]. The genes encoding the proteins related to the last two steps of EPS biosynthesis are encoded by the gum gene cluster [24]. GumM (the protein of gumM) plays an important role in the process of the biosynthesis of the pentasaccharide, GumG (the protein of gumG) is partly responsible for modification of the pentasaccharide, and GumB (the protein of gumB) is a key role in the process of EPS polymerization and transport [25].
In this study, the expression levels of four EPS genes (gumB, gumG, gumM, and xanA) in Xoo were determined by RT-qPCR. As evident from Figure 7, all four genes of Xoo treated with 2-(methyl- sulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole, showed lower expression levels than the untreated blank control. Meanwhile, Table 4 shows that the expression of xanA was lowest at 20 μg/mL, with the inhibition rate of 79.21%, which implied that compound 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole may hindered the biosynthesis of phosphoglucomutase/phosphomannomutase in Xoo, and then reduced glucose-6-phosphate into glucose-1-phosphate in the first step of EPS biosynthesis.
Figure 7. Expression of EPS gene of Xoo (The data presented are the mean ± SD). T1: Untreated blank control; T2: gumB; T3: gumG; T4: gumM; T5: xanA.
Figure 7. Expression of EPS gene of Xoo (The data presented are the mean ± SD). T1: Untreated blank control; T2: gumB; T3: gumG; T4: gumM; T5: xanA.
The expression of gumM was lowest at 20 μg/mL, with the inhibition rate of 86.76%, which suggested that compound 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole may impeded the biosynthesis of the pentasaccharide of Xoo. Meanwhile, Table 4 showed that the expression of gumG was lowest at 20 μg/mL, with the inhibition rate of 68.14%, which suggested that compound 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole possibly receded the modification of the pentasaccharide of Xoo. The expression of gumB was lowest at 20 μg/mL, with the inhibition rate of 94.88%, which meant that compound 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole could destroy the process of EPS polymerization and transport of Xoo.
Table 4. Inhibition rates of 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole on EPS gene expression at 20 μg/mL.
Table 4. Inhibition rates of 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole on EPS gene expression at 20 μg/mL.
GenesInhibition Rate (%)
gumB94.88 ± 0.39
gumG68.14 ± 1.15
gumM86.76 ± 0.28
xanA79.21 ± 1.14

3. Experimental Section

3.1. Bacterial Strains and Culture Conditions

PXO99A strain of Xoo was grown at 28 ± 1 °C in nutrient broth (NB) medium in conical flasks or on nutrient agar (NA) medium in Petri dishes [6]. NA medium was prepared with 1 g of yeast extract, 3 g of beef extract, 5 g of polypeptone, 10 g of sucrose, and 15 g of agar powder per 1000 mL of distilled water, pH 7.0–7.2. NB medium contained the same components but lacked agar powder.

3.2. In Vitro Antibacterial Activity

In this study, eight sulfone derivatives containing 1,3,4-oxadiazole moieties were evaluated for their antibacterial activities against Xoo via the turbidimeter test [26] in vitro. Dimethylsulfoxide (DMSO) in sterile distilled water served as an untreated blank control. Bismerthiazole and thiodiazole copper which are the principal tools used for controlling rice bacterial leaf blight in China at present served as positive controls,. Approximately 40 μL of solvent NB containing Xoo, incubated on the phase of logarithmic growth, was added to 5 mL of solvent NB containing the test compounds. The inoculated test tubes were incubated at 28 °C and continuously shaken at 180 rpm for 24–48 h until the bacteria were incubated on the logarithmic growth phase. The growth of the cultures was monitored on a Model 680 microplate reader (BIO-RAD, Hercules, CA, USA) by measuring the optical density at 595 nm (OD595). The inhibition rate I was calculated by the following formula:
Inhibition rate I (%) = (C − T)/C × 100
where C is the corrected turbidity values of bacterial growth on untreated NB (blank control), T is the corrected turbidity values of bacterial growth on treated NB, and I represents the inhibition rate.
Based on previous bioassays, the results of antibacterial activities (expressed by EC50) of the title compounds against Xoo were also evaluated and calculated with SPSS 17.0 software. The experiment was repeated three times.

3.3. In Vivo Antibacterial Activity

To determine the control efficiency of antibacterial potency in vivo at the greenhouse condition, the curative activity of 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole against rice bacterial leaf blight was analyzed in potted plants using a complete randomized block design [27]. Seeds of Nipponbare were sowed in plastic pots that contained field soil and thinned to six to ten rice seedlings. Xoo, the pathogen of the rice disease of bacterial leaf blight, was cultured in solvent NB at 28 ± 1 °C overnight at 180 rpm, and the concentrations were then adjusted to 108 CFU/mL. Five weeks after sowing, Xoo of rice bacterial leaf blight was inoculated on the rice plant. We used scissors, which were sterilized using 70% ethanol prior to use and then dipped in bacterial solution, to inoculate the rice plant with Xoo. After 7 d of Xoo inoculation, 200 μg/mL 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole solution was sprayed until run-off onto the leaves, whereas the control plants were sprayed with the same volume of distilled water. All inoculated plants were incubated in a growth chamber at 28 °C and 90% relative humidity. At 15th day after inoculation, the average lesion length was observed and scored, and the control efficiency was calculated. The experiment was repeated three times.
Meanwhile, the protective activity of 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole against rice bacterial leaf blight was also analyzed under greenhouse conditions. Five weeks after sowing the rice plant, 200 μg/mL 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole solution was sprayed onto the leaves until run-off, whereas the control plants were sprayed with the same volume of distilled water. Seven d after 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole spraying, Xoo rice bacterial leaf blight was inoculated on the rice plant. All inoculated plants were incubated in a growth chamber at 28 °C and 90% relative humidity. At 28th day after inoculation, the average lesion length was observed and scored, and the experiment was repeated three times. The control efficiency was calculated as follows:
Control efficiency I (%) = (C − T)/C × 100
where C represents the disease incidence of the untreated blank control, T represents the disease incidence of the treatment, and I represents the control efficiency.

3.4. Field Trial against Rice Bacterial Leaf Blight

To further determine the activities of 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole, field trials against rice bacterial leaf blight were conducted. The effect of the natural infection of Xoo was studied in a field with rice having suffered rice bacterial leaf blight for several years. Sterile distilled water served as an untreated blank control, whereas the commercial bactericides bismerthiazole and zhongshengmycin were the positive controls. 2-(Methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole (150 g ai/ha) and the commercial bactericides bismerthiazole (375 g ai/ha) and zhongshengmycin solutions (45 g ai/ha) were sprayed on the foliage of the rice once every 7 days three times. For each treatment, three replicates were conducted. The disease incidence of the rice plants was investigated 15th day after the third spraying. The control efficiency was calculated using the following formula:
Control efficiency I (%) = (C − T)/C × 100
where C represents the disease incidence of the untreated blank control, T represents the disease incidence of the treatment, and I represents the control efficiency.

3.5. Determination of SOD Activity

Rice samples (0.5 g) were homogenized in 0.05 M phosphate buffer (5 mL, pH 7.8) and centrifuged at 4000 g for 10 min. The supernatant was used as an enzyme source. The reaction mixture (3 mL) contained phosphate buffer (1.5 mL, 0.05 M, pH 7.8), methionine (0.3 mL, 130 mM), nitroblue tetrazolium (0.3 mL, 750 μM), ethylene diaminetetraaceticacid (EDTA) (0.3 mL, 100 μM), and riboflavin (0.3 mL, 20 μM). Phosphate buffer instead of enzyme liquid was set as blank control. The mixture was illuminated under a fluorescent lamp (4000 LUX, Ningbo Jiangnan Instrument Plant, Ningbo, China) for 20 min, and the absorbance was read at 560 nm. For the blank, identical solutions were kept under the dark. SOD activity was expressed as the change in absorbance g−1 fresh tissue [28].

3.6. Determination of POD Activity

Rice samples (1 g) were homogenized in 20 mM KH2PO4 (5 mL) and then centrifuged at 4000 g for 15 min at 4 °C. The supernatant was used as an enzyme source. The mixed reaction solution of POD consisted of 0.1 M phosphate buffer (500 mL, pH 6.0), guaiacol (280 μL), 30% H2O2 (190 μL) and 20 mM KH2PO4. To initiate the reaction, mixed reaction solution of POD (3 mL) and enzyme solution (0.1 mL) were added to the sample cuvette. Mixed reaction solution of POD and KH2PO4 were set as blank control. The absorbance was read at 470 nm about once a minute. POD activity was expressed as U·g−1 FW min−1 [29].

3.7. Determination of Chlorophyll Content

According to the work conducted by Peng [30], rice samples (10 mg) were homogenized in a 5 mL mixture of acetone and ethanol with a volume ratio of 4:1. Dark extraction was carried out for 1 h, and the extract was centrifuged at 4000 g for 5 min. The chlorophyll extract was then placed in a 1 cm-thick cuvette, a mixture of acetone and ethanol with a volume ratio of 4:1 was used as a reference. The absorbance was read at 645 and 663 nm:
Ca (mg·L−1) = 0.0127 A663 − 0.00269 A645
Cb (mg·L1) = 0.0229A645 − 0.00468 A663
Total chlorophyll content = Ca + Cb
In the above equation, A645 and A663 are the absorbance values at the wavelengths 645 and 663 nm, respectively.

3.8. Determination of MDA Content

Rice samples (0.5 g) were homogenized in 5% trichloroacetic acid (TCA) (5 mL) and then centrifuged at 3000 g for 10 min. Subsequently, 0.67% barbituric acid (TBA) (2 mL) was added to the supernatant (2 mL). The mixture (4 mL) was boiled for 30 min at 100 °C and then centrifuged at 3000 g for 10 min. The absorbance was read at 450, 532, and 600 nm. The MDA content was expressed as C (μM·L−1):
C (μM·L1) = 6.45(A532 − A600) − 0.56A450 [31]

3.9. Biofilm Assays

Biofilm formation in glass test tube was quantified as described previously [32,33]. Bacteria were grown in NB with shaking to the mid-exponential growth phase and then diluted to 1:100 in fresh NB. About 2 mL of a diluted bacterial suspension was placed in each glass tube, incubated with 10 μg/mL 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole, and shaken at 28 °C for 72 h. The culture medium was poured out, and attached bacterial cells were gently washed three times with distilled water. The cells were then stained with 0.1% crystal violet (2 mL) for 15 min. Unbound crystal violet was poured out, and the glass tubes were washed three times with water. The crystal violet-stained cells were solubilized in DMSO (2 mL). Biofilm formation was quantified by measuring the absorbance at 570 nm using a Synergy H1 detector (BioTek, Winooski, VT, USA). Three replicates were used for quantitative measurement.

3.10. Quantitative Determination of EPS Production

To measure the influence of EPS production of Xoo in culture supernatants, bacterial cells were grown in NB supplemented with different concentrations (20, 10, 5, and 2.5 μg/mL) of 2-(methyl- sulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole at 28 °C for 72 h. Subsequently, 10 mL portions of the cultures were collected, and the cells were removed by centrifugation at 8000 g for 20 min [34]. Finally, three volumes of ethyl alcohol were added to the supernatants [35]. The precipitated EPS were pelleted via centrifugation, dried, and weighed. The test was performed three times independently.

3.11. RNA Extraction, cDNA Synthesis, and RT-qPCR Analysis

Bacteria were grown in NB medium at 28 °C with shaking at 180 rpm, and 1 mL samples of Xoo strain cultures were collected at 12 h after bacterial cells were incubated with different concentrations (20, 10, 5, and 2.5 μg/mL) of 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole. Bacterial cells were centrifuged at 12,000 g for 10 min, and the cell pellets were treated with a Trizol reagent kit (TaKaRa, Dalian, China) [36]. Total RNA purity was estimated by calculating OD260/OD280 using an ultraviolet spectrophotometer (ACTGene, Piscataway, NJ, USA). All OD260/OD280 values of RNA were between 1.8 and 2.2. The concentration of total RNA was calculated according to the dilution ratio and OD260.
cDNAs were synthesized using a cDNA synthesis kit (TaKaRa). H2O was added up to 6 μL to the solution containing 1000 ng of RNA and 1 μL of random primers, and heated to 70 °C for 10 min. The solution was rapidly placed on ice for 2 min. Up to 2 μL of MLV buffer, 0.5 μL of 10 mM each dNTP, 0.25 μL of RRI, and 0.25 μL of M-MLV were added. The reaction mixture was heated to 30 °C for 10 min, 42 °C for 1 h, and to 70 °C for 15 min.
RT-qPCR was carried out using SYBR Premix Ex TaqII (TaKaRa). The reaction solution contained 10 μL of SYBR, 0.8 μL of primer pair, 1 μL of cDNA, and 8.2 μL of H2O. Four target genes were chosen for expression analysis with 16S rRNA as the endogenous control. The primers, shown in Table 5, were designed using the sequences of the Xoo genome. The PCR cycle consisted of the following steps: 30 s at 95 °C and 40 cycles of 20 s at 95 °C and 30 s at 59 °C. After each run, a dissociation curve was designed to confirm specificity of the product and avoid production of primer dimers. Relative amounts of amplification products were calculated with the comparative 2−∆∆Ct method. A total of three independent biological replicates were used for each treatment.
Table 5. Groups of RT-qPCR primers used to amplify gene-specific regions.
Table 5. Groups of RT-qPCR primers used to amplify gene-specific regions.
Gene NameGenBank Acc. No.Primers (5′–3′)
gumB [32]3265197Forward: CTGACCGAAATCGAGAAGGGCACCAATC
Reverse: GCGCCACACCATCACAAGAGGAGTCAGTTC
gumGAF147035Forward: GTCACAATGCTTGCTTACA
Reverse: ATGGCGATGAAGAACAAC
gumMAF231924Forward: GTTCTTCGCCAATACCAAT
Reverse: TCTCACGACACAGATACG
xanA999354Forward: GCAGCGGCGAGATCAACT
Reverse: AAACGCCATTCGCCAAAA

4. Conclusions

Sulfone derivatives containing 1,3,4-oxadiazole moieties have indicated good antibacterial activities against rice bacterial leaf blight in vitro. In particular, 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole revealed the best antibacterial activity against Xoo, which was better than those of the commercial agents bismerthiazole and thiodiazole copper. In vivo antibacterial activity tests under greenhouse conditions and field trials demonstrated that 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole was effective in reducing rice bacterial leaf blight. This study also demonstrated that 2-(methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole could stimulate the increase in SOD and POD activities in rice, causing a marked enhancement of plant resistance against rice bacterial leaf blight. 2-(Methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole also improved the chlorophyll content and restrained the increase in the MDA content to considerably reduce the amount of damage caused by Xoo. 2-(Methylsulfonyl)-5-(4-fluorophenyl)-1,3,4-oxadiazole could inhibit the production of EPS, resulting in weaker pathogenicity in the bacterial strain. It also induced the gene expression levels of gumB, gumG, gumM, and xanA, whose products are involved in the biosynthesis of the EPS.

Acknowledgments

The authors gratefully acknowledge financial support from the Key Technologies R & D Program (No. 2011BAE06 B05-6) and the Special Fund for Agro-scientific Research in the Public Interest (No. 201203022).

Author Contributions

Li Shi performed the experiments, collected the test materials and strains and wrote the paper. Deyu Hu designed the project. Deyu Hu and Pei Li analyzed the results and revised the paper. Wenli Wang, Manni Gao, Zengxue Wu and Xianpeng Song made some experiments. All authors discussed the results and commented on the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Mew, T.W. Current status and future prospects of research on bacterial blight of rice. Annu. Rev. Phytopathol. 1987, 25, 359–382. [Google Scholar] [CrossRef]
  2. Nayak, D.; Shanti, M.L.; Bose, L.K.; Singh, U.D.; Nayak, P. Pathogenicity association in Xanthomonas oryzae pv. oryzae the causal organism of rice bacterial blight disease. ARPN J. Agric. Biol. Sci. 2008, 3, 12–26. [Google Scholar]
  3. Shanti, M.L.; Devi, G.L.; Kumar, G.N.; Shashidhar, H.E. Molecular marker-assisted selection: A tool for insulating parental lines of hybrid rice against bacterial leaf blight. Int. J. Plant Pathol. 2010, 1, 114–123. [Google Scholar] [CrossRef]
  4. Evidente, A.; Venturi, V.; Masi, M.; Degrassi, G.; Cimmino, A.; Maddau, L.; Andolfi, A. In vitro antibacterial activity of sphaeropsidins and chemical derivatives toward Xanthomonas oryzae pv. oryzae, the causal agent of rice bacterial blight. J. Nat. Prod. 2011, 74, 2520–2525. [Google Scholar] [CrossRef] [PubMed]
  5. Khoshkdaman, M.; Ebadi, A.A.; Kahrizi, D. Evaluation of pathogencity and race classification of Xanthomonas oryzae pv. oryzae in guilan province-Iran. Agric. Sci. 2012, 3, 557–561. [Google Scholar]
  6. Zhu, X.F.; Xu, Y.; Peng, D.; Zhang, Y.; Huang, T.T.; Wang, J.X.; Zhou, M.G. Detection and characterization of bismerthiazol-resistance of Xanthomonas oryzae pv. oryzae. Crop Prot. 2013, 47, 24–29. [Google Scholar] [CrossRef]
  7. Xu, Y.; Zhu, X.F.; Zhou, M.G.; Kuang, J.; Zhang, Y.; Shang, Y.; Wang, J.X. Status of streptomycin resistance development in Xanthomonas oryzae pv. oryzae and Xanthomonas oryzae pv. oryzicola in China and their resistance characters. J. Phytopathol. 2010, 158, 601–608. [Google Scholar]
  8. Li, P.; Yin, J.; Xu, W.M.; Wu, J.; He, M.; Hu, D.Y.; Song, B.A. Synthesis, antibacterial activities, and 3D-QSAR of sulfone derivatives containing 1,3,4-oxadiazole moiety. Chem. Biol. Drug Des. 2013, 82, 546–556. [Google Scholar] [CrossRef] [PubMed]
  9. Li, P.; Shi, L.; Yang, X.; Yang, L.; Chen, X.W.; Wu, F.; Song, B.A. Design, synthesis, and antibacterial activity against rice bacterial leaf blight and leaf streak of 2,5-substituted-1,3,4-oxadiazole/thiadiazole sulfone derivative. Bioorg. Med. Chem. Lett. 2014, 24, 1677–1680. [Google Scholar] [CrossRef] [PubMed]
  10. Xu, W.M.; Han, F.F.; He, M.; Hu, D.Y.; He, J.; Yang, S.; Song, B.A. Inhibition of tobacco bacterial wilt with sulfone derivatives containing 1,3,4-oxadiazole moiety. J. Agric. Food Chem. 2012, 60, 1036–1041. [Google Scholar] [CrossRef] [PubMed]
  11. Xu, W.M.; He, J.; He, M.; Han, F.F.; Chen, X.H.; Pan, Z.X.; Wang, J.; Tong, M.G. Synthesis and antifungal activity of novel sulfone derivatives containing 1,3,4-oxadiazole moieties. Molecules 2011, 16, 9129–9141. [Google Scholar] [CrossRef] [PubMed]
  12. Xu, W.M.; Yang, S.; Bhadury, P.; He, J.; He, M.; Gao, L.L.; Song, B.A. Synthesis and bioactivity of novel sulfone derivatives containing 2,4-dichlorophenyl substituted 1,3,4-oxadiazole/thiadiazole moiety as chitinase inhibitors. Pestic. Biochem. Physiol. 2011, 101, 6–15. [Google Scholar] [CrossRef]
  13. Scarf, M.E.; Siegfried, B.D.; Meinke, L.J.; Chandler, L.D. Fipronil metabolism, oxidative sulfone formation and toxicity among organophosphate- and carbamate- resistant and susceptible western corn rootworm populations. Pest Manag. Sci. 2000, 56, 757–766. [Google Scholar] [CrossRef]
  14. Oliveira, C.S.; Lira, B.F.; Barbosa-Filho, J.M.; Fernandez Lorenzo, J.G.; Athayde-Filho, P.F. Synthetic approaches and pharmacological activity of 1,3,4-oxadiazoles: A review of the literature from 2000–2012. Molecules 2012, 17, 10192–10231. [Google Scholar] [CrossRef] [PubMed]
  15. Vedula, M.S.; Pulipaka, A.B.; Venna, C.V.; Chintakunta, K.; Jinnapally, S.; Kattuboina, V.A. New styryl sulfones as anticancer agents. Eur. J. Med. Chem. 2003, 38, 811–824. [Google Scholar] [CrossRef]
  16. Silvestri, R.; Artico, M.; la Regina, G.; de Martino, G.; la Colla, M.; Loddo, R.; la Colla, P. Anti-HIV-1 activity of pyrryl aryl sulfone (PAS) derivatives: Synthesis and SAR studies of novel esters and amides at the position 2 of the pyrrole nucleus. Farmaco 2004, 59, 201–210. [Google Scholar] [CrossRef] [PubMed]
  17. Hermes-Lima, M. Oxygen in biology and biochemistry: Role of free radicals. In Functional Metabolism: Regulation and Adaptation; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2004; Volume 1, pp. 319–366. [Google Scholar]
  18. Moura, J.C.M.S.; Bonine, C.A.V.; de Oliveira Fernandes Viana, J.; Dornelas, M.C.; Mazzafera, P. Abiotic and biotic stresses and changes in the lignin content and composition in plants. J. Integr. Plant Biol. 2010, 52, 360–376. [Google Scholar] [CrossRef] [PubMed]
  19. Fan, H.T.; Song, B.A.; Bhadury, P.S.; Jin, L.H.; Hu, D.Y.; Yang, S. Antiviral activity and mechanism of action of novel thiourea containing chiral phosphonate on tobacco mosaic virus. Int. J. Mol. Sci. 2011, 12, 4522–4535. [Google Scholar] [CrossRef] [PubMed]
  20. Ghasemie, E.; Kazempour, M.; Padasht, F. Isolation and identification of Xathomonas oryzae pv. oryzae the causal agent of bacterial blight of rice in Iran. Eur. J. Plant Pathol. 2008, 48, 53–62. [Google Scholar] [CrossRef]
  21. Janero, D.R. Malondialdehyde and thiobarbituric acid-reactivity as diagnostic indices of lipid peroxidation and peroxidative tissue injury. Free Radic. Biol. Med. 1990, 9, 515–540. [Google Scholar] [CrossRef]
  22. Ielpi, L.; Couso, R.O.; Dankert, M.A. Sequential assembly and polymerization of the polyprenol-linked pentasaccharide repeating unit of the xanthan polysaccharide in Xanthomonas campestris. J. Bacteriol. 1993, 175, 2490–2500. [Google Scholar] [PubMed]
  23. Hung, C.H.; Wu, H.C.; Tseng, Y.H. Mutation in the Xanthomonas campestrisxan A gene required for synthesis of xanthan and lipopolysaccharide drastically reduces the efficiency of bacteriophage φL7 adsorption. Biochem. Biophys. Res. Commun. 2002, 291, 338–343. [Google Scholar] [CrossRef] [PubMed]
  24. Lee, B.M.; Park, Y.J.; Park, D.S.; Kang, H.W.; Kim, J.G.; Song, E.S.; Go, S.J. The genome sequence of Xanthomonas oryzae pathovar oryzae KACC10331, the bacterial blight pathogen of rice. Nucleic Acids Res. 2005, 33, 577–586. [Google Scholar] [CrossRef] [PubMed]
  25. Kim, S.Y.; Kim, J.G.; Lee, B.M.; Cho, J.Y. Mutational analysis of the gum gene cluster required for xanthan biosynthesis in Xanthomonas oryzae pv oryzae. Biotechnol. Lett. 2009, 31, 265–270. [Google Scholar] [CrossRef] [PubMed]
  26. Dalgaard, P.; Ross, T.; Kamperman, L.; Neumeyer, K.; McMeekin, T.A. Estimation of bacterial growth rates from turbidimetric and viable count data. Int. J. Food Microbiol. 1994, 23, 91–404. [Google Scholar] [CrossRef]
  27. Schaad, N.W.; Wang, Z.K.; Di, M.; McBeath, J.; Peterson, G.L.; Bonde, M.R. An improved infiltration technique to test the pathogenicity of Xanthomonas oryzae pv. oryzae in rice seedlings. Seed Sci. Technol. 1996, 24, 449–456. [Google Scholar]
  28. Constantine, N.G.; Stanley, K.R. Superoxide dismutases. Plant Physiol. 1977, 59, 309–314. [Google Scholar]
  29. Rathmell, W.G.; Sequeira, L. Soluble peroxidase in fluid from the intercellular spaces of tobacco leaves. Plant Physiol. 1974, 53, 317–318. [Google Scholar] [CrossRef] [PubMed]
  30. Peng, Y.S.; Liu, E. Studies of method on extract chlorophyll a and b. Acta Agric. Univ. Pekin. 1992, 18, 247–250. [Google Scholar]
  31. Draper, H.H.; Hadley, M. Malondialdehyde determination as index of lipid Peroxidation. Methods Enzymol. 1990, 186, 421–431. [Google Scholar] [PubMed]
  32. Pratt, L.A.; Kolter, R. Genetic analysis of Escherichia coli biofilm formation: Roles of flagella, motility, chemotaxis and type I pili. Mol. Microbiol. 1998, 30, 285–293. [Google Scholar] [CrossRef] [PubMed]
  33. Wang, S.; Zhang, K.; Zhou, X.; Xu, N.; Xu, H.H.K.; Weir, M.D.; Ge, Y.; Wang, S.; Li, M.; Li, Y.; et al. Antibacterial Effect of Dental Adhesive Containing Dimethylaminododecyl Methacrylate on the Development of Streptococcus mutans Biofilm. Int. J. Mol. Sci. 2014, 12791, 12791–12806. [Google Scholar] [CrossRef] [PubMed]
  34. Guo, Y.; Sagaram, U.S.; Kim, J.S.; Wang, N. Requirement of the galU gene for polysaccharide production by and pathogenicity and growth in planta of Xanthomonascitri subsp. Appl. Environ. Microbiol. 2010, 76, 2234–2242. [Google Scholar] [CrossRef] [PubMed]
  35. Vojnov, A.A.; Zorreguieta, A.; Dow, J.M.; Daniels, M.J.; Dankert, M.A. Evidence for a role for the gumB and gumC gene products in the formation of xanthan from its pentasaccharide repeating unit by Xanthomonas campestris. Microbiology 1998, 144, 1487–1493. [Google Scholar] [CrossRef] [PubMed]
  36. Xu, S.; Pan, X.; Luo, J.; Wu, J.; Zhou, Z.; Liang, X.; Zhou, M.G. Effects of phenazine-1-carboxylic acid on the biology of the plant-pathogenic bacterium Xanthomonas oryzae pv. oryzae. Pestic. Biochem. Physiol. 2015, 117, 39–46. [Google Scholar] [CrossRef] [PubMed]
  • Sample Availability: Samples of the compounds are available from the authors.

Share and Cite

MDPI and ACS Style

Shi, L.; Li, P.; Wang, W.; Gao, M.; Wu, Z.; Song, X.; Hu, D. Antibacterial Activity and Mechanism of Action of Sulfone Derivatives Containing 1,3,4-Oxadiazole Moieties on Rice Bacterial Leaf Blight. Molecules 2015, 20, 11660-11675. https://doi.org/10.3390/molecules200711660

AMA Style

Shi L, Li P, Wang W, Gao M, Wu Z, Song X, Hu D. Antibacterial Activity and Mechanism of Action of Sulfone Derivatives Containing 1,3,4-Oxadiazole Moieties on Rice Bacterial Leaf Blight. Molecules. 2015; 20(7):11660-11675. https://doi.org/10.3390/molecules200711660

Chicago/Turabian Style

Shi, Li, Pei Li, Wenli Wang, Manni Gao, Zengxue Wu, Xianpeng Song, and Deyu Hu. 2015. "Antibacterial Activity and Mechanism of Action of Sulfone Derivatives Containing 1,3,4-Oxadiazole Moieties on Rice Bacterial Leaf Blight" Molecules 20, no. 7: 11660-11675. https://doi.org/10.3390/molecules200711660

APA Style

Shi, L., Li, P., Wang, W., Gao, M., Wu, Z., Song, X., & Hu, D. (2015). Antibacterial Activity and Mechanism of Action of Sulfone Derivatives Containing 1,3,4-Oxadiazole Moieties on Rice Bacterial Leaf Blight. Molecules, 20(7), 11660-11675. https://doi.org/10.3390/molecules200711660

Article Metrics

Back to TopTop