Previous Article in Journal / Special Issue
Comprehensive Analysis of Biomass, Nutrient, and Heavy Metal Contributions of Pelagic Sargassum Species (Phaeophyceae) Inundations in South Florida
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Phycology
Volume 4
Issue 2
10.3390/phycology4020014
phycology-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Morphological and Molecular Characters Differentiate Common Morphotypes of Atlantic Holopelagic Sargassum

by
Amy N. S. Siuda
1,*,
Aurélie Blanfuné
2,
Skye Dibner
1,
Marc Verlaque
2,
Charles-François Boudouresque
2,
Solène Connan
3,
Deborah S. Goodwin
4,
Valérie Stiger-Pouvreau
3,
Frédérique Viard
5,
Florence Rousseau
6,
Valérie Michotey
2,
Jeffrey M. Schell
7,
Thomas Changeaux
2,
Didier Aurelle
2 and
Thierry Thibaut
2
1
Eckerd College, Marine Science Discipline, 4200 54th Ave. S, St. Petersburg, FL 33711, USA
2
Aix Marseille University, CNRS, IRD, MIO (Mediterranean Institute of Oceanography), UM 110, 13288 Marseille, France
3
Univ Brest, CNRS, IRD, Ifremer, LEMAR, IUEM, 29280 Plouzané, France
4
Independent Researcher, Bozeman, MT 59718, USA
5
ISEM, University of Montpellier, CNRS, EPHE, IRD, 34095 Montpellier, France
6
Institut de Systématique, Evolution, Biodiversité (ISYEB), Sorbonne Université, Muséum national d’Histoire naturelle (MNHN), CNRS, EPHE, Université des Antilles, CP 39, 57 Rue Cuvier, 75005 Paris, France
7
Sea Education Association, P.O. Box 6, Woods Hole, MA 02543, USA
*
Author to whom correspondence should be addressed.
Phycology 2024, 4(2), 256-275; https://doi.org/10.3390/phycology4020014
Submission received: 28 February 2024 / Revised: 25 April 2024 / Accepted: 27 April 2024 / Published: 7 May 2024
(This article belongs to the Collection Sargassum Golden Tides, a Global Problem)
Browse Figures
Review Reports Versions Notes

Abstract

:
Since 2011, massive new strandings of holopelagic Sargassum have been reported on the coasts of the Caribbean, northern Brazil, Guiana, and West Africa, causing severe economic and ecological damage. Three common morphotypes (S. fluitans III, S. natans I, and S. natans VIII) were identified as responsible for these catastrophic events, with dominance shifts between them over time. However, the taxonomic status of these holopelagic Sargassum morphotypes remains unclear. Using an integrative taxonomy framework, combining a morphological study and molecular analyses, this study aimed to clarify their taxonomic status. Morphological analyses of 54 characters revealed no intermediate form between the three morphotypes, with the overall shape, nature of the axis, and size and shape of blades and vesicles being the most discriminating. An analysis of mitochondrial (IGS, cox2, cox3, mt16S rRNA, and nad6) and plastid (rbcL) markers confirmed the genetic divergence among the three morphotypes, with a lower level of divergence between the two S. natans morphotypes. Without additional molecular characterization, these morphotypes cannot be classified as three distinct species. However, due to their distinct morphological characteristics and sympatry within drifting aggregations, a revision of holopelagic species names is proposed, with Sargassum fluitans var. fluitans (for S. fluitans III), Sargassum natans var. natans (for S. natans I), and S. natans var. wingei (for S. natans VIII). This revision provides necessary clarity on the species involved in inundations of the tropical Atlantic.

1. Introduction

Bloom-forming macroalgae are of global concern, causing ecological, economic, and health issues [1,2,3,4,5]. Among the most widely proliferating seaweeds, several species of the genus Sargassum C. Agardh (Phaeophyceae, Fucales) are threatening coastal ecosystems in temperate [6,7,8] and tropical [9,10,11,12,13,14] areas. Most Sargassum species are benthic, colonizing rocky reefs, pebbles, detritic sediments, or coral reefs from the sea surface to several dozen meters in depth [15,16,17]. In the Atlantic Ocean, however, two holopelagic species have been characterized: Sargassum natans (Linnaeus) Gaillon and Sargassum fluitans (Børgesen) Børgesen [18,19]. Winge [20] described several morphotypes of these species, and their delineation was refined by Parr [21], although still absent from current taxonomic keys.
Holopelagic Sargassum species, historically most abundant in the Sargasso Sea and open Gulf of Mexico [21,22], float and grow at the sea surface during their entire lifetime, as they have no benthic stage. Individual thalli decay and sink to depth [23] or can wash ashore, removing them from the pelagic system. At the sea surface, Sargassum thalli tend to aggregate and form mats of different structure and density [24], which host a diverse community of marine organisms [25,26,27,28]. These drifting aggregations can travel long distances under the action of winds, waves, and currents [22,24,29]. Since 2011, unprecedented massive strandings of holopelagic Sargassum have been reported on the coasts of the eastern and western Caribbean, northern Brazil, Guiana, and West Africa (reviewed in Fidai et al. [30]). These recurrent strandings are associated with extensive Sargassum aggregations in the tropical North Atlantic, as reported by satellite imagery [31], hydrographic modeling [32], and field campaigns [24,33]. Satellite images and direct observations show that the Great Atlantic Sargassum Belt (GASB) phenomenon has been annually variable in magnitude [31]. Thus, the absence of reliable growth and dispersion models for holopelagic Sargassum complicates bloom forecasting efforts [34,35,36,37] and the establishment of suitable management procedures.
Species identification adds another level of complexity to understanding the origins and composition of these recent massive standings. The growth response [38,39,40,41,42,43] and morphology-induced windage [44,45] indeed differ between Sargassum morphotypes. In addition, in the aggregations, the most abundant morphotype has shifted across annual blooms. Schell et al. [33] reported, in the North Atlantic Ocean between 10 and 30° N, three dominant morphotypes described by Parr [21], namely, Sargassum natans VIII, Sargassum natans I, and Sargassum fluitans III, with S. natans VIII noted as the predominant form inundating eastern Caribbean coasts. Later, S. fluitans III dominated beached Sargassum in Mexico during 2016 and S. natans I contributed substantially to the community composition in the same location in 2018 [46]. On a finer temporal scale, the morphotype composition of beached holopelagic Sargassum in Barbados switched from S. fluitans III dominating during spring/summer 2021 to S. natans VIII-dominated during autumn 2021/winter 2022 [27].
Integrative taxonomy [47], combining a morphological study with molecular analyses, can clarify whether the different holopelagic Sargassum morphotypes observed in recent years correspond to different species or to intra-specific variants. As Winge [20] and Parr’s [21] morphotype descriptions did not follow the Botanical Code (International Code of Nomenclature for algae, fungi, and plants; [48]) for species description and the subsequent discontinuity in classification based on inconsistent character selection [49], a comprehensive morphological description of each common morphotype is warranted. Moreover, molecular analysis challenged traditional taxonomic divisions within the genus and questioned the use of some morphological or chemical characters for species delineation and taxonomy [50,51]. Even the monophyly of the Sargassum genus has been disputed [52].
Early sequencing efforts revealed no divergence between holopelagic species nor between holopelagic and some benthic species [53,54,55,56]. Such results may have arisen from the selection of markers that, while standard for macroalgal studies, did not capture the regions where polymorphisms among holopelagic Sargassum were located [53,54,55,56]. Moreover, some included the incorrect identification of the specimens sequenced [54,56]. Subsequent comparisons of full-length mitogenomes, with a documented correct morphotype identification, indicated a closer proximity between S. natans I and S. natans VIII when compared to S. fluitans III; the divergence levels were around 0.02% at the mitogenome level between S. natans I and S. natans VIII and 0.3% between S. natans I/VIII and S. fluitans III [57]. In a more extended temporal and geographic analysis of holopelagic Sargassum, targeting multiple mitochondrial gene segments each with multiple polymorphisms, genetic distances among holopelagic morphotypes were in the range of those between pelagic and benthic species and on the same order as divergence among some benthic species [58].
The present study aimed to clarify the taxonomic status of holopelagic Sargassum morphotypes presently found in the Atlantic Ocean. A broad suite of morphological characters and multi-gene molecular analyses were conducted across a large sample of individuals representing all three common holopelagic morphotypes. With this deeper understanding of Sargassum taxonomy, the scientific record can be rectified and an appropriate level of differentiation can be incorporated into future modeling, forecasting, and ecological studies.

2. Materials and Methods

2.1. Sample Collection

Holopelagic Sargassum specimens were randomly collected during two scientific cruises in the North and tropical Atlantic Ocean in 2017, with the goal of studying the composition and characteristics of Sargassum aggregations. The Caribbean expedition (http://dx.doi.org/10.17600/17004300, accessed on 28 March 2024) used the R/V Antea from 19th June to 13th July 2017, and extended from the area of extensive Sargassum bloom development off northeast Brazil up to the Sargasso Sea (25° N), with a focus along French Caribbean islands. The Transatlantic expedition (http://dx.doi.org/10.17600/17016900, accessed on 28 March 2024) used the M/Y Yersin from 6th to 24th October 2017, and crossed the Atlantic between 8° and 12° N, from Cape Verde to Martinique (see [24] for details).
Holopelagic Sargassum aggregations were randomly sampled at 31 of 49 stations during the two oceanographic cruises (Figure 1). The three morphotypes were simultaneously present at all 31 sampling stations, but proportions differed by site. Sargassum fluitans III was dominant nearly everywhere (around 70%), with ~15% each for S. natans VIII and S. natans I. However, at two stations (18 and 20) in the south Sargasso Sea, S. natans VIII dominated (~70%) and S. natans I and S. fluitans III contributed ~15% each.
At each station, collected Sargassum thalli were identified and sorted by morphotype. For each Sargassum morphotype, two to three replicate fronds were randomly selected for analysis. A total of 264 individuals of holopelagic Sargassum were collected to carry out joint morphological and genetic analyses. All specimens have been kept as vouchers with a corresponding fragment stored in silica gel at room temperature for further molecular analysis. Eight specimens of benthic Sargassum, five of S. hystrix, two of S. furcatum, and one of S. polyceratium var. ovatum were also collected by scuba-diving and snorkeling in the French Caribbean islands of Guadeloupe and Martinique and used as out-groups in phylogenetic analyses. All specimens are kept in the Herbarium of the Mediterranean Institute of Oceanography at Aix-Marseille University, Marseille, France (HCOM). Herbarium abbreviations follow Thiers [59].

2.2. Morphological Analyses

Measurements were made on dried specimens for comparison with dried specimens stored in different herbaria housed in HCOM. Fifty-four characters were identified and selected based on analysis of all available descriptions from the literature of Sargassum identification keys from the North Atlantic Ocean [49,60,61,62,63,64,65] (Table S1). These 54 characters were observed and measured on 264 individuals; they correspond to all the specimens collected during the cruises.
Non-Multi-Dimensional Scaling (nMDS) was performed based on the resulting 54 characters (coding 0, 1) and 264 individual matrices (Table S1), using S17 Bray–Curtis similarity distance. PERMANOVA and pair-wise tests were applied to detect significant differences between the three examined morphotypes. P-values were obtained by 999 permutations of residuals under a reduced model [66,67,68].

2.3. DNA Processing and Phylogenetic Analyses

2.3.1. Amplification and Sequencing of Mitochondrial and Plastid Loci

Total DNA was extracted with the Qiagen DNeasy Plant Mini Kit or Macherey-Nagel NucleoSpin 96 Plant II kit according to manufacturer’s instructions. Before extraction, samples were disrupted with a FastPrep®-24 by 2.381 mm using inox beads (CIMAP). Using 1/50 dilution of DNA solutions, five mitochondrial markers (mt spacer IGS, cox2, cox3, mt16S rRNA, and nad6) and two plastid markers (psbA and rbcL) were amplified. Primer names, sequences, and PCR programs for all loci are presented in Table 1.
The final number of sequences obtained for each marker depended on PCR and sequencing success, and on the observed levels of variability between Sargassum morphotypes; fewer samples for psbA were sequenced, because that marker exhibited the lowest level of variability. The numbers of sequences analyzed per marker and morphotype are presented in the resulting phylogenetic trees and haplotype networks (see Results). The PCR reaction mix for all loci was prepared for a final volume of 20 µL with GoTaq® Flexi Buffer 1X, GoTaq® DNA Polymerase 0.02 U/µL, dNTP 0.2 mM, MgCl2 5 mM, forward and reverse primers 0.5 µM each, BSA 0.8 mg/mL, and 2 µL of diluted DNA. All PCR programs included 3 min at 94 °C, 35 cycles with [1 min at 94 °C, 1 min or 1 min 30 s at annealing temperature (Table 1), and 1 to 2 min at 72 °C], and 5 min at 72 °C. The PCR products were sent for Sanger sequencing at Eurofins Genomics. Each unique sequence (i.e., haplotype) obtained in this study is available in GenBank under accession numbers MT422788 to MT422805, and the final sequence alignments have been submitted in Zenodo.

2.3.2. Analysis of Sequence Data

Sequences were visualized and aligned with UGENE v 1.31.1 [71]. For each marker, all Sargassum sequences available were retrieved from Genbank and aligned with the new sequences obtained here. Sequence alignments were performed with MUSCLE [72] in UGENE. Markers were first analyzed separately, then some were concatenated for tree or network construction. Concatenation was not always possible because of the very unbalanced distribution of Sargassum species across markers in Genbank.
For phylogenetic analyses, two datasets were used: a psbA alignment allowing a comparison with distant Phaeophyceae taxa, and a rbcL-cox3 concatenated alignment for the Sargassum genus. Other markers were not used because of the lack of corresponding sequences in Genbank or difficulty aligning evolutionary distant taxa (as in the case of mitochondrial IGS). A Maximum Likelihood (ML) phylogenetic reconstruction was performed with IQ-TREE 1.6.8 [73] and a Bayesian Inference (BI) with MrBayes 3.2 [74,75]. With IQ-TREE, 1000 ultrafast bootstraps were used, along with the bnni option to reduce risk of overestimating branch support with ultrafast bootstrap [76]. In the case of combined datasets, the ModelFinder option of IQ-TREE was used to find the best partition scheme [77]. For BI, a sample frequency of 100 over 106 generations (burnin 250,000) was used for rbcL-cox3 and 2·106 generations (burnin 106) was used for psbA. Convergence of the MCMC analysis was assumed when the average standard of split frequency was below 0.01, when the log probability of the data did not show any trend, and when the potential scale reduction factor was close to 1.0. Trees were visualized with FigTree 1.4.4 [78]. For the analyses based on psbA sequences, Cutleria and Bachelotia sequences were used as outgroups [79]. For rbcL-cox3, according to the present results and to Mattio and Payri [51], the tree was rooted with the clade containing two species, Sargassum ringgoldianum Harvey and Sargassum thunbergii (Mertens ex Roth) Kuntze, belonging to the subgenus Bactrophycus. Because of different representation in Genbank, the psbA and rbcL-cox3 dataset did not lead to the same species lists; previous S. fluitans and S. natans rbcL sequences were not included, as available sequences for these taxa were only partially aligned with the ones obtained in this present study.
As a complementary approach, haplotype networks were built with the TCS 1.21 software [80], in order to study relationships among the most closely related sequences, to include indels in the analysis, and to visualize the frequency of the different haplotypes. Indels longer than one base pair were transformed into a single base-pair indel before analysis. Networks were built independently for five datasets: mt spacer IGS, a concatenation of partial cox2 and cox3, nad6, and 16S rRNA mitochondrial sequences, as well as part of the plastidial rbcL.

3. Results

3.1. Morphological Analyses

According to the morphological analysis of the 54 characters (Table S1), all individuals of Sargassum examined during the oceanographic cruises unambiguously belonged to one of three dominant morphotypes described by Parr [21], namely, Sargassum fluitans III, Sargassum natans I, and Sargassum natans VIII. Importantly, no intermediate morphology was observed. Analysis of all collected individuals (n = 264) based on all characters showed three distinct, clearly separated clusters, matching with the three morphotypes (Figure 2). In addition, these clusters differed significantly, as a whole and by pairs (Table 2).
Among the 54 characters analyzed, several were particularly discriminating: the overall shape, the nature of the axis (thorny or smooth), the blades (size and shape), and the vesicles (air bladders; size, presence or absence of apical spine-like appendage; length of pedicel) (Figure 3 and Figure 4). Briefly, Sargassum fluitans III was characterized by (1) a short to loose, globular or cylindrical, open, and stringy shape, (2) a thorny axis, (3) blades that are lanceolate with an asymmetrical base, and (4) short pedicellate, oblong vesicles without an apical spine-like appendage but frequently with a foliaceous margin. Sargassum natans I was characterized by (1) a mostly cylindrical, sometimes pyramidal shape, (2) a smooth axis, (3) linear blades that are narrow with a symmetrical base, and (4) vesicles, frequently with a long pedicel, a foliaceous margin, and an apical spine-like or reduced foliaceous appendage. S. natans VIII was well-characterized by (1) its measurements larger than those of the two other morphotypes and a mostly pyramidal shape, (2) a smooth axis, (3) lanceolate and broad blades with a symmetrical base, and (4) vesicles that are shortly pedicellate, usually without an apical spine-like appendage (Figure 3 and Figure 4; see key for identification).

3.2. Genetic Analyses

Molecular phylogenetic analyses were conducted for pbsA and rbcL-cox3 concatenated sequences. The phylogenetic tree made with psbA did not reveal any variation among the three morphotypes, and the sequences were identical to benthic species such as Sargassum vulgare (Figure S2). Thus, the tree did not clarify the phylogenetic position of the holopelagic samples but confirmed that they belong to the Sargassum genus. Identical psbA sequences were also observed between close species within the Sargassaceae family, like between Polycladia indica (Schiffner) Draisma, Ballesteros, F. Rousseau & T. Thibaut and P. heinii [52] or Ericaria amentacea (C.Agardh) Molinari & Guiry and E. selaginoides (Hudson) Molinari & Guiry. With the concatenated fragment rbcL-cox3, sequences from the holopelagic samples were placed, with good support, in the same monophyletic group as Sargassum yendoi Okamura & Yamada, S. vachellianum Greville and S. piluliferum (Turner) C. Agardh (Figure 5). The separation of holopelagic morphotypes S. natans VIII and S. natans I was well-supported (bootstraps of 96%). The morphotype S. fluitans III appeared in the sister position to this group, though with lower support (76/0.89).
The molecular identification of the three holopelagic Sargassum morphotypes, among each other and in comparison with benthic species, was dependent upon the marker used for analysis. The new mt spacer IGS for the S. fluitans III morphotype was identical to previous sequences from S. fluitans III. New mt spacer IGS sequences for the S. natans VIII and S. natans I morphotypes were identical to each other and to S. natans VIII and S. natans I sequences from Amaral-Zettler et al. [57]. The TCS network showed a divergence of six mutations between the S. natans complex and S. fluitans III, including two indels of two base pairs (bps) each (Figure 6). For plastidial rbcL, the fragment sequenced did not completely match with the ones previously sequenced for S. natans and S. fluitans. Therefore, no comparisons could be made beyond this dataset. The morphotypes S. natans VIII and S. natans I shared the same haplotype with the benthic Sargassum analyzed in this study. This haplotype was separated by two substitutions in rbcL and a 9 bp deletion in the spacer (not shown) from the morphotype S. fluitans III haplotype (Figure 6). One haplotype of morphotype S. fluitans III (station 20) was separated from other morphotype S. fluitans III samples by four mutations, and from the other multi-species haplotypes by one mutation and a 6 bp indel. The mitochondrial 16S rRNA, cox2-cox3 concatenated, and nad6 sequences separated the three morphotypes and confirmed matches between the sequences obtained in this study and earlier published sequences for all three holopelagic morphotypes. The 16S rRNA sequences for S. fluitans III differed from the benthic species and from S. natans I by a single substitution and from S. natans VIII by two substitutions (Figure 6). Two S. natans VIII sequences from the current dataset matched the S. natans I sequences, and one S. hystrix sequence matched the S. fluitans III sequences. In the cox2-cox3 network, haplotypes from morphotypes S. natans VIII and S. natans I were only separated by one substitution in the cox3 partial fragment (Figure 6). Haplotypes from morphotypes S. natans VIII and S. fluitans III were separated by four substitutions, one in cox3 and three in cox2. The nad6 network was composed of multiple grouped haplotypes representing each holopelagic Sargassum morphotype, with one dominant haplotype in each group (Figure 6). Two S. natans VIII and one S. fluitans III matched the dominant S. natans I haplotype, which differed from the dominant S. fluitans III haplotype by two nucleotide substitutions and from the dominant S. natans VIII by one nucleotide substitution.

4. Discussion

Morphology strongly supports the delineation between the three holopelagic Sargassum morphotypes (S. fluitans III, S. natans I, and S. natans VIII). No individuals displayed intermediate characters, and individuals defined by their morphotype were clearly separated into groups specific to each (Figure 2). S. fluitans III, described by Parr [21], morphologically corresponds to the description of S. fluitans (Børgesen) Børgesen [18,19]. Consequently, S. fluitans III can be renamed as Sargassum fluitans var. fluitans. S. fluitans X, the other described S. fluitans morphotype [21], is rare; upon further analysis, it should be assigned the appropriate nomenclature. Moreover, S. natans I and S. natans VIII are syntopic, i.e., living together in the same habitat at each station, which ruled out the hypothesis that the observed morphological differences were related to their habitat differences. These two taxa, namely, S. natans I and S. natans VIII, could be in an early stage of speciation (i.e., the gray zone following de Queiroz’s terminology [81]). Thus, we conservatively propose their formal separation into varieties as Sargassum natans var. natans (S. natans I) and Sargassum natans var. wingei (S. natans VIII).
Molecular results confirmed the phylogenetic positioning of Atlantic holopelagic Sargassum species, in close proximity to each other and among benthic species within a group corresponding to the section Sargassum of the subgenus Sargassum, as previously suggested (e.g., [51,54]). Nevertheless, within the section Sargassum, the low divergence of the sequences used as well as the reduced taxonomic sampling were not sufficient to unambiguously resolve the phylogenetic affinities of holopelagic species and, therefore, do not allow the discussion of the question of a single or multiple evolutionary origin of holopelagic Sargassum. The difficulty in resolving the phylogeny of this group could be due to a combination of a relatively recent evolution of the pelagic lifestyle, along with the slow molecular evolution of mitochondrial and plastidial genes considered.
In other Sargassum species, mitochondrial cox3 or plastidial rbcL showed intraspecific variation, sometimes useful for phylogeographic studies [50,70,82]. Therefore, the lack of diversity inside holopelagic Sargassum species and observed with our marker set may not be a fixed rule. The discrepancy between morphological differentiation and low molecular divergence may be explained by this slow rate of molecular evolution of cytoplasmic genomes in Sargassum species. More generally, the observation of morphological differences can usually be explained by the interaction between genetic and environmental factors, but not in this case. There are also cases where species that are very similar genetically may exhibit significant morphological differences due to environmental influences or other factors (e.g., [83,84]), but holopelagic Sargassum taxa live in sympatry and are always found mixed together, even if their abundance can vary from year to year and/or place to place [27].
Regarding species/morphotype delineation using molecular markers, the examined genes exhibited only a few mutations separating the three morphotypes, as reported by Amaral-Zettler et al. [57] and Dibner et al. [58] and demonstrated in previous studies on nuclear, mitochondrial, and chloroplastic markers dedicated to the genus Sargassum [85,86,87]. The present study confirmed weak but clear genetic differences (three to six mutations) for the mitochondrial IGS, cox2, cox3, and plastid rbcL genes, between morphotypes S. natans I and VIII, and S. fluitans III [57]. An additional analysis of the mitochondrial 16S rRNA and nad6 genes also confirmed weak but clear genetic differences between S. natans I and S. natans VIII [58]. In all cases, genetic data from these 2017 samples were consistent with previous sampling efforts between 2012 and 2016 [57] and between 2015 and 2019 [58], which seems to indicate a relative stability of composition at that scale. The fact that observed genetic differences between S. natans I and S. natans VIII were low may be the result of the aforementioned low rate of evolution for cytoplasmic genomes. In future studies, other more polymorphic markers may reveal a higher divergence between the two morphotypes.
Within the genus Sargassum, similarities in molecular marker sequences between distinct species are frequent. Yoshida et al. [86] demonstrated similarities in the nuclear ITS2 sequences of four allied Sargassum species belonging to the subgenus Bactrophycus: Sargassum boreale, S. confusum, S. microceratium, and S. pallidum. In that work, S. boreale was identified as a new species because of the presence of a large deletion of 28 bp, which was stable in all specimens of S. boreale studied [86]. No nucleotide difference was observed in the ITS2 sequences of Sargassum mcclurei and S. quinhonense belonging to the subgenus Sargassum although their morphology is totally different [85]. The separation of the two species was not supported by the ITS2 phylogeny; nevertheless, S. mcclurei and S. quinhonense are distinct species as no intermediate morphological form has been reported [85]. On another Sargassaceae genus, Rohfritsch et al. [88] demonstrated that a divergence of almost 17 mutations on 2102 concatenated base pairs was enough to confirm that Turbinaria ornata and T. conoides were separate species.
The proposed revision is particularly critical at this time, as considerable confusion exists regarding the morphological identification of holopelagic Sargassum species in the literature. To address and resolve these inconsistencies, a thorough historic review of holopelagic Sargassum taxonomy is presented here. Early taxonomic classification of holopelagic Sargassum recognized two species, Sargassum natans (L.) and S. hystrix (Agardh) var. fluitans, based on several morphological traits that clearly distinguished one species from the other [18,19]. In addition to differences in the shape of blades and vesicles, S. hystrix var. fluitans was notable for branches that are “provided with short spinules.” Winge [20], based on hundreds of preserved samples collected from numerous cruises across the North Atlantic between 1911–1922, identified “8 different drifting Sargassum-species.” Parr [21], based on several cruises in the North Atlantic from 1933–1935, advanced Winge’s [20] Sargassum taxonomy and provided the first dichotomous key for drifting Sargassum species, as well as detailing their unique distributional patterns. Notably, the second couplet in Parr’s [21] key addresses the nature of Sargassum branches as ‘thorny’ for all S. fluitans morphological types (III and X) versus branches as ‘smooth’ for all S. natans morphotypes (I, II, VIII, and IX). S. natans morphotypes are further distinguished by the presence (S. natans I) or absence (S. natans II, VIII, and IX) of an apical spine on the vesicles, and then the size and shape of blades.
Parr [21] is recognized as the definitive source on holopelagic Sargassum taxonomy. Indeed, early reviews of Sargasso Sea science always referenced Parr’s [21] taxonomic and distribution studies [89,90,91]. Investigations examining the changing distribution and abundance of holopelagic Sargassum [22,92,93] compared their findings to Parr [21]. Investigations of the epibionts [94,95,96,97] and motile fauna [98,99,100] that live on different types of holopelagic Sargassum looked to Parr [21] for proper species identification. Studies examining the growth and production of different holopelagic Sargassum species [101,102] also reference Parr [21]. Even though these studies were familiar with the true diversity of holopelagic Sargassum morphotypes, in practice, S. natans I and S. fluitans III were consistently the most abundant, and the need to consider rare morphotypes (S. natans II, VIII, and IX, and S. fluitans X) waned over time. Eventually, Parr’s [21] numeric system was dropped and S. natans I and S. fluitans III were simply referred to as S. natans and S. fluitans.
The contemporary definitive source for benthic algae taxonomy in the western North Atlantic and Caribbean has been Taylor [49], which naturally includes a thorough account of benthic Sargassum species. However, Taylor’s [49] approach to the taxonomy of holopelagic Sargassum was overly simplified and only recognized two species: S. natans and S. fluitans, making no mention of the other morphotypes. Critically, Taylor [49] did not distinguish the two Sargassum species in his dichotomous key based on the presence or absence of thorns on the branches, the well-established historical precedent, but instead used the blade and vesicle shape. In fact, Taylor [49] describes S. fluitans as having a “…stem smooth or very sparingly spinulose,” which contradicts the historical descriptions of S. fluitans III [18,19,20,21], and the accompanying illustration of S. fluitans (see Plate 39, Figure 2) shows smooth branches and spherical vesicles that more closely resembles Winge’s [20] and Parr’s [21] descriptions and illustrations of S. natans VIII. A more recent authority on benthic algae in the Caribbean, Wynne’s [103] checklist, also adopted Taylor’s [49] simplified view of holopelagic Sargassum diversity and did not reference Winge [20] or Parr [21]. Schneider and Searles [104] and Littler and Littler [63] also described two species, making no mention of additional holopelagic Sargassum morphotypes, and simplified their dichotomous keys by removing any mention of thorns along the branches. Notably, Littler and Littler [63] provide an accurate photograph of S. fluitans III with thorns evident on the branches.
When Wynne [103] and subsequent revisions are consulted as the authoritative catalog of currently accepted nomenclature for species in the region and Taylor [49], Schneider and Searles [104], or Littler and Littler [63] are the only source material used for holopelagic Sargassum identification, specimens of S. natans VIII, with smooth branches and large, spherical vesicles lacking an apical spine-like appendage, can be mistakenly identified as S. fluitans III. de Szechy et al. [105] collected drift Sargassum off the coast of Brazil during the first GASB bloom and misidentified S. fluitans as S. natans (see Table 1, Figure 4 and Figure 5). The extensive morphological and molecular assessment of benthic Sargassum in the Caribbean by Camacho et al. [54] appears to have used a specimen of S. natans VIII for their analysis of S. fluitans (see Figures 16 and 17 in [54]). Other studies at the time provided photographs or illustrations of S. natans VIII specimens but identified them as S. fluitans [106,107]. This is not surprising, considering sample collection occurred during the 2014–15 GASB event, when the composition of the bloom was dominated by S. natans VIII [33]. Sissini et al. [55] in their analysis of Sargassum washing up on Brazilian beaches in 2014–15 used Taylor [49], de Szechy et al. [105], and Camacho et al. [54] to make their morphological determinations (S. natans and S. fluitans), thus calling into question their morphological identification of Sargassum specimens and the validity of their molecular results. Similarly, Gonzalez-Nieto et al. [56], in their molecular assessment of Sargassum in the Gulf of Mexico and Caribbean region, included a misidentification of S. natans VIII, labeled as S. fluitans (see Figure 4, Panel D; open habitus, spherical vesicles, and low vesicle-to-blade ratio indicate S. natans VIII). Given the likelihood that their holopelagic Sargassum samples have been improperly categorized, the merits of their molecular analyses cannot be critically assessed.
These errors in identification have persisted without much cause for concern due to the rarity of several of Parr’s [21] Sargassum morphotypes and, thus, had little meaningful consequence for misidentification. However, the landscape has changed since 2011, with the development of the GASB and re-emergence of S. natans VIII [33]. The improper identification of holopelagic Sargassum samples now has significant consequences and limits our ability to understand the driving mechanisms of the GASB, as recent studies have observed annual and seasonal fluctuations in the composition of holopelagic Sargassum morphotypes [27,33,46]. For example, the proposal that ten species with their varieties should be synonymized under S. cymosum [56], a recognized benthic species, was accepted by Wynne [108], resulting in the removal of S. fluitans from the checklist.
We strongly reject the conclusions of Gonzalez-Nieto et al. [56] and Wynne [108] that holopelagic Sargassum are in a polytomy with benthic Sargassum species. First, all holopelagic Sargassum morphotypes are considered sterile, as no receptacles have ever been observed; thus, grouping them with sexually reproductive benthic species with well-documented receptacles is nonsensical. Second, the three most common holopelagic Sargassum morphotypes (S. fluitans III, and S. natans I and VIII) co-occur across broad geographic and environmental ranges and, yet, their morphological and molecular differences are conserved as demonstrated in the present study and Dibner et al. [58]. Given the new research presented in this study, we maintain the continued species delineation between S. fluitans III and S. natans I and now formally recognize S. natans VIII as a separate variety of S. natans.
Recognition of a greater, not less, amount of diversity in holopelagic Sargassum is further supported by the research across ecological, biochemical, and physiological fields of study. Govindarajan et al. [109] observed population-level differences in the hydroid Aglaophenia latecarinata among S. fluitans III and S. natans VIII samples, despite the significant geographic overlap in their distribution. Martin et al. [110] observed differences in motile fauna abundance, diversity, and species composition across the three morphotypes. Garcia-Sanchez et al. [46] observed shifts in the abundance of holopelagic Sargassum morphotypes reaching beaches in Mexico over several years. Similarly, seasonal shifts in Sargassum morphotype abundance were observed in Barbados [27]. McGillicuddy et al. [111] observed differences in the nutrient and arsenic biogeochemistry among S. fluitans III and S. natans I morphotypes. Finally, several studies have documented the different growth and environmental tolerance among holopelagic Sargassum morphotypes to varying nutrient, temperature, and salinity conditions [39,40,41,42,43].
Taxonomy is not an end in itself, but a tool allowing researchers to propose species hypotheses [47,112]. Most often, accepted species are distinguished by a set of morphological characters and/or specific characteristics. In addition to the need for name agreement among scientists to help in research communications, environmental managers also need definitive and consistent names to designate the populations they administer, even if the biodiversity is generally more complex than nomenclatural partitioning, notably because speciation processes are gradual. Terrestrial botany, especially studies carried out on Magnoliophytes, offers thousands of examples of taxa that are distinguished even though intermediate forms, in particular hybrids, unite them. In the case of S. natans VIII and S. natans I, we showed that no intermediate forms exist. In addition, hybridization is, a priori, irrelevant insofar as sexual reproduction has never been observed in these holopelagic macroalgae, despite the major sampling effort that has occurred. Nevertheless, the discord between the genetic differentiation (i.e., very low) and the morphological differences (i.e., high) for S. natans I and S. natans VIII makes it challenging to propose that the two morphotypes correspond to different species.
Current morphotype naming, associated with the lack of a formal description, leads to uncertainties in the description of the holopelagic Sargassum. We, therefore, propose a taxonomic framework, with the description of a new variety and an identification key. The type specimen of Sargassum natans belongs to the morphotype Sargassum natans I (Figure S1). The Sargassum natans VIII morphotype was well-identified by Winge [20] and Parr [21], but neither with a formal diagnosis nor a creation of different taxon. Although this name was taken up later (e.g., [33,57,58] and in most of the recent papers on Sargassum inundation since 2015), it remains undescribed according to the rules of botanical taxonomy (International Code of Nomenclature of algae, fungi, and plants [48]). It is, therefore, described below, under the name of Sargassum natans var. wingei, in tribute to Professor Ö. Winge who first recognized the originality of this form.
  • Species description
  • We propose the following new name for the morphotype Sargassum natans VIII.
  • Sargassum natans var. wingei Thibaut, Blanfuné, Boudouresque, Siuda & Verlaque var. nov.
  • Figures: Figures 3 and 4.
  • Holotype: Specimen HCOM S10-S1-3 (Holotype deposited in HCOM Herbarium)
  • Isotypes: Specimens S10-S1-1 and S10-S1-2, deposited in HCOM Herbarium.
  • Type locality: Station 10, tropical Atlantic Ocean, geographic co-ordinates: 14°58.440′ N 59°07.230′ W.
  • Etymology: Named for Professor Öjvind Winge, who was the first scientist to distinguish this taxon (as Sargassum sp. VIII) among the pelagic Sargassum specimens.
  • Representative material: All samples of Sargassum natans var. wingei collected during the two expeditions (Caribbean and transatlantic expeditions). All samples are deposited in HCOM Herbarium (Table S2).
  • Specimens sequenced and Genbank references: New haplotypes produced here are available in GenBank under accession numbers MT422788 to MT422805, and final sequence alignments have been submitted in Zenodo.
  • Other descriptions and illustrations: Winge [20] (1923, Figure 13, as Sargassum sp. VIII); Parr [21] (1939, figs 9-10, 12-17, as S. natans (VIII) Winge); Schell et al. [33] (2015, Figure 1 in ref [33], as S. natans VIII Parr); Amaral-Zettler et al. [57] (2017, figs 2c and 2d, as S. natans form VIII); Martin (2016); Govindarajan et al. [109] (2019, Figure 1c, as S. natans VIII) (Table S1).
  • Websites: as S. natans VIII: Sea Education Association, Woods Hole (https://www.sea.edu/sea_research/sargassum_ecosystem, accessed on 28 March 2024). Sailors for the Sea (https://sailorsforthesea.org/blog/conservation-heading-towards-bermuda/, accessed on 28 March 2024). Center for Resource Management and Environmental Studies (CERMES), University of West Indies Cave Hill, Barbados.
  • (https://www.cavehill.uwi.edu/cermes/research-projects/sargassum/tools-and-guidance.aspx, accessed on 28 March 2024)
  • Diagnosis: Plant holopelagic, brown to yellow-brown, without a holdfast or a distinct main axis; branches smooth without cryptostomata, 1–1.5 mm diam., ramified several times; blades simple, shortly pedicellate, flat, lanceolate to broadly lanceolate, without cryptostomata (13) 30–55 (–65) mm long and 3–10 mm wide (L/W ratio: 3–10, typically: 7–8), with coarsely irregularly serrated margins, symmetrical base, and midrib; vesicles (air bladders), more, less, or as much as the blades, smooth, without cryptostomata, spherical, rarely oblong, 2–5 (–7) mm diam., usually without foliaceous margin or apical spine-like appendage; pedicels short, 0.5–2.5 mm long, cylindrical, sometimes foliaceous with toothed margins; receptacles never observed.
  • Distribution: Tropical Atlantic Ocean, between 7° and 26° N.
  • Habitat: It is one of the three holopelagic taxa of the tropical Atlantic Ocean, with S. fluitans (Børgesen) Børgesen and S. natans (Linnaeus) Gaillon.
  • Key for the identification of Atlantic Sargassum species
  • 1a. Plants fixed to the substrate; main axis distinct; cryptostomata and receptacles present……………………………………………………….… Benthic species (not treated here)
  • 1b. Plants floating, without holdfast and distinct main axis; receptacles absent and cryptostomata absent………………………………………………………..…... Pelagic species (2)
    • 2a. Branches thorny; blades lanceolate, 3–8 mm wide and 11–60 mm long (L/W: 4–13), with asymmetrical base; vesicles oblong without apical spine-like or foliaceous appendage but frequently with foliaceous margin, usually more numerous than blades, 1–6 mm diam., with a short pedicel, 0.5–2.5 mm long, cylindrical to winged, sometimes with toothed margins ……………………S. fluitans (Børgesen) Børgesen
    • 2b. Branches smooth; blades with symmetrical base; vesicles more spherical, fewer or as numerous as blades ……………………………..……………..………………… (3)
      • 3a. Blades linear, narrow, 1–4 mm wide and 13–70 mm long (L/W: 5–22); vesicles, 2–5 mm diam., frequently with a foliaceous margin and an apical spine-like or reduced foliaceous appendage, and with a long pedicel, 1–5 mm long ……………………………………......…S. natans var. natans (Linnaeus) Gaillon
      • 3b. Blades lanceolate, broad, 3–10 mm wide and 13–65 mm long (L/W: 3–10); vesicles, 2–7 mm diam., usually without foliaceous margin and apical spine-like appendages, and with a short pedicel, 0.5–2.5 mm long …………S. natans var. wingei nov. var.
The decision to place S. natans VIII at the level of variety, and not to elevate the morphotype to the status of a new species, is somewhat conservative. Beyond the question of renaming these taxa, the clear morphological differences between the three holopelagic Sargassum and the weak genetic differences raise significant doubts about the speciation stage of these taxa; their assignment to a species rank is even more complex as they most likely rely on asexual reproduction as their primary method of propagation, so that the biological species concept can hardly be used for delineation. Our genetic results on S. natans suggest that the two varieties could correspond to different fixed clones from a single species, where asexual lineages fixed morphological differences. However, the use of mitochondrial and plastidial DNA together is not sufficient to investigate this hypothesis. Fucales are oogamous [113], and, in oogamous brown algae, chloroplasts and mitochondria are thought to be maternally inherited [114]. Therefore, these two cytoplasmic genomes are not independently inherited, and, alone, they do not correspond to independent markers. Further investigation of the species’ evolutionary history could be accomplished by using nuclear markers, polymorphic within each of the two varieties. This approach would allow for a more in-depth analysis of the extent of clonality, as well as species delineation and speciation scenarios. For example, it would be interesting to test if the pelagic way of life originated once or several times in the Sargassum genus. Finally, the phylogeny of the genus Sargassum must be profoundly clarified considering that the holotype specimen defining the genus Sargassum was Sargassum bacciferum Turner (C. Agardh) currently named for the type species as S. natans (Agardh, 1820), a clonal holopelagic taxa lacking sexual reproductive apparatus.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/phycology4020014/s1, Figure S1: Sargassum natans (L.) Gaillon. Type-specimen of Fucus natans L. from the Linnean Herbarium (Figure from Børgesen [18,19]); Figure S2: Phylogenetic tree obtained with psbA; Table S1: Morphological characters used to identify the North Atlantic Sargassum species applied to the holopelagic taxa; Table S2: All samples of Sargassum wingei collected during the two expeditions.

Author Contributions

Conceptualization, T.T. and A.N.S.S.; methodology, T.T., A.N.S.S., S.D. and D.A.; validation, T.T., M.V. and C.-F.B.; formal analysis, A.B. and D.A.; investigation, A.B., S.C., V.S.-P. and T.C.; writing—original draft preparation, T.T. and F.V.; writing—review and editing, T.T., A.N.S.S., A.B., S.D., C.-F.B., S.C., V.S.-P., F.V., D.S.G., V.M., F.R., J.M.S., T.C. and D.A.; visualization, T.T., A.N.S.S., S.D. and D.A.; supervision, T.T.; project administration, T.T.; funding acquisition, T.T. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the French Ministry for the Ecological and Inclusive Transition, agreement number 17-MOTEC-SARGASSES-1-CVS-001. The project leading to this publication has received funding from the Ministry for the Ecological and Inclusive Transition, agreement number 17-MOTEC-SARGASSES-1-CVS-001, European FEDER Fund under project 1166-39417 and ANR-19-SARG-0004-01, CNRS LEFE SAREDA-SWO, and TOSCA-CNES SAREDA_DA.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

New haplotypes produced here are available in GenBank under accession numbers MT422788 to MT422805, and final sequence alignments have been submitted in Zenodo.

Acknowledgments

We thank the Flotte Oceanographique Française (FOF), Captain Pierre Samuel and the crew of N/O ANTEA, Captain Jean Dumarais and the crew of Y/V YERSIN, Juerg Lichtenegger and Club Sentinel for helping routing the boats to the Sargassum rafts, M. Brossard and team from IRD Guyane, and C. Bouchon (UMR BOREA) who provided the logistics and implementation. The authors acknowledge the support of Monaco-Expéditions. We thank Jean Blanchot, Léo Berline, Cristele Chevalier, Mathilde Guéné, Anouck Ody, Sandrine Ruitton, and Dorian Guillemin for their precious help during the Antea and Yersin expeditions. We deeply thank François Bordeyne, Sarah Bouchemousse, and Quentin Langevin for their help on the morphological and genetics analysis. The Marine Biological Laboratory—Wood Hole Oceanographic Institution (MBL-WHOI) Library staff assisted with critical access to historical taxonomic references. The platforms Macrophytes and Omics of the MIO have been used in this work. This is publication ISEM 2024-098.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of the data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Liu, F.; Pang, S.; Chopin, T.; Gao, S.; Shan, T.; Zhao, X.; Li, J. Understanding the Recurrent Large-Scale Green Tide in the Yellow Sea: Temporal and Spatial Correlations between Multiple Geographical, Aquacultural and Biological Factors. Mar. Environ. Res. 2013, 83, 38–47. [Google Scholar] [CrossRef] [PubMed]
  2. Smetacek, V.; Zingone, A. Green and Golden Seaweed Tides on the Rise. Nature 2013, 504, 84–88. [Google Scholar] [CrossRef] [PubMed]
  3. Mineur, F.; Arenas, F.; Assis, J.; Davies, A.J.; Engelen, A.H.; Fernandes, F.; Malta, E.; Thibaut, T.; Van Nguyen, T.; Vaz-Pinto, F.; et al. European Seaweeds under Pressure: Consequences for Communities and Ecosystem Functioning. J. Sea Res. 2015, 98, 91–108. [Google Scholar] [CrossRef]
  4. Lapointe, B.E.; Burkholder, J.M.; Van Alstyne, K.L. Harmful Macroalgal Blooms in a Changing World: Causes, Impacts, and Management. In Harmful Algal Blooms; Shumway, S.E., Burkholder, J.M., Morton, S.L., Eds.; Wiley: Hoboken, NJ, USA, 2018; pp. 515–560. ISBN 978-1-118-99467-2. [Google Scholar]
  5. Dominguez Almela, V.; Addo, K.A.; Corbett, J.; Cumberbatch, J.; Dash, J.; Marsh, R.; Oxenford, H.; Tonon, T.; Van Der Plank, S.; Webber, M.; et al. Science and Policy Lessons Learned from a Decade of Adaptation to the Emergent Risk of Sargassum Proliferation across the Tropical Atlantic. Environ. Res. Commun. 2023, 5, 061002. [Google Scholar] [CrossRef]
  6. Le Lann, K.; Connan, S.; Stiger-Pouvreau, V. Phenology, TPC and Size-Fractioning Phenolics Variability in Temperate Sargassaceae (Phaeophyceae, Fucales) from Western Brittany: Native versus Introduced Species. Mar. Environ. Res. 2012, 80, 1–11. [Google Scholar] [CrossRef] [PubMed]
  7. Engelen, A.H.; Serebryakova, A.; Ang, P.; Britton-Simmons, K.; Mineur, F.; Pedersen, M.F.; Arenas, F.; Fernandez, C.; Steen, H.; Svenson, R.; et al. Circumglobal Invasion by the Brown Seaweed Sargassum Muticum. Oceanogr. Mar. Biol. Annu. Rev. 2015, 53, 81–126. [Google Scholar]
  8. Marks, L.; Salinas-Ruiz, P.; Reed, D.; Holbrook, S.; Culver, C.; Engle, J.; Kushner, D.; Caselle, J.; Freiwald, J.; Williams, J.; et al. Range Expansion of a Non-Native, Invasive Macroalga Sargassum horneri (Turner) C. Agardh, 1820 in the Eastern Pacific. BioInvasions Rec. 2015, 4, 243–248. [Google Scholar] [CrossRef]
  9. Bouchon, C.; Bouchon-Navaro, Y.; Louis, M. A First Record of a Sargassum (Phaeophyta, Algae) Outbreak in a Caribbean Coral Reef Ecosystem. Proc. Gulf Caribb. Fish. Inst. 1992, 41, 171–188. [Google Scholar]
  10. Done, T.J. Phase Shifts in Coral Reef Communities and Their Ecological Significance. Hydrobiologia 1992, 247, 131–132. [Google Scholar] [CrossRef]
  11. Stiger, V.; Payri, C.E. Spatial and Seasonal Variations in the Biological Characteristics of Two Invasive Brown Algae, Turbinaria ornata (Turner) J. Agardh and Sargassum mangarevense (Grunow) Setchell (Sargassaceae, Fucales) Spreading on the Reefs of Tahiti (French Polynesia). Bot. Mar. 1999, 42, 295–306. [Google Scholar] [CrossRef]
  12. De Ramon N’Yeurt, A.; Iese, V. The Proliferating Brown Alga Sargassum polycystum in Tuvalu, South Pacific: Assessment of the Bloom and Applications to Local Agriculture and Sustainable Energy. J. Appl. Phycol. 2015, 27, 2037–2045. [Google Scholar] [CrossRef]
  13. Van Tussenbroek, B.I.; Hernández Arana, H.A.; Rodríguez-Martínez, R.E.; Espinoza-Avalos, J.; Canizales-Flores, H.M.; González-Godoy, C.E.; Barba-Santos, M.G.; Vega-Zepeda, A.; Collado-Vides, L. Severe Impacts of Brown Tides Caused by Sargassum spp. on near-Shore Caribbean Seagrass Communities. Mar. Pollut. Bull. 2017, 122, 272–281. [Google Scholar] [CrossRef] [PubMed]
  14. Velázquez-Ochoa, R.; Enríquez, S. Environmental Degradation of the Mexican Caribbean Reef Lagoons. Mar. Pollut. Bull. 2023, 191, 114947. [Google Scholar] [CrossRef] [PubMed]
  15. Stiger-Pouvreau, V.; Mattio, L.; De Ramon N’Yeurt, A.; Uwai, S.; Dominguez, H.; Flórez-Fernández, N.; Connan, S.; Critchley, A.T. A Concise Review of the Highly Diverse Genus Sargassum C. Agardh with Wide Industrial Potential. J. Appl. Phycol. 2023, 35, 1453–1483. [Google Scholar] [CrossRef]
  16. Thibaut, T.; Blanfuné, A.; Verlaque, M.; Boudouresque, C.-F.; Ruitton, S. The Sargassum Conundrum: Very Rare, Threatened or Locally Extinct in the NW Mediterranean and Still Lacking Protection. Hydrobiologia 2016, 781, 3–23. [Google Scholar] [CrossRef]
  17. Aouissi, M.; Sellam, L.N.; Boudouresque, C.F.; Blanfuné, A.; Derbal, F.; Frihi, H.; Perret-Boudouresque, M.; Rebzani-Zahaf, C.; Verlaque, M.; Thibaut, T. Insights into the Species Diversity of the Genus Sargassum (Phaeophyceae) in the Mediterranean Sea, with a Focus on a Pre-Viously Unnoticed Taxon from Algeria. Medit. Mar. Sci. 2018, 19, 48. [Google Scholar] [CrossRef]
  18. Børgesen, F. The Species of Sargassum Found Along the Coasts of the Danish West Indies With Remarks Upon the Floating Forms of the Sargasso Sea. In Mindeskrift I Anledning af Hundredaaret for Japetus Steenstrups Fødsel; Jungersen, F.E., Warming, E., Eds.; Bianco Luno Bogtrykkeri: Kobenhavn, Denmark, 1914; Volume 32, pp. 1–20. [Google Scholar]
  19. Børgesen, F. Marine Algae of the Danish West Indies. Part II. Phaeophyceae.; Dansk Bot. Arkiv, Bianco Luno Copenhagen, Denmark, 1914; Volume 2.
  20. Winge, Ø. The Sargasso Sea, Its Boundaries and Vegetation. Report on the Danish Oceanographical Expeditions 1908–1910 to the Mediterranean and Adjacent Seas.; A.F. Høst&søn.: Copenhagen, Denmark, 1923. [Google Scholar]
  21. Parr, A.E. Quantitative Observations on the Pelagic Sargassum Vegetation of the Western North Atlantic. Bull. Bingham Oceanogr. Collect. 1939, 6, 1–94. [Google Scholar]
  22. Butler, J.N.; Morris, B.F.; Cadwallader, J.; Stoner, A.W. Studies of Sargassum and the Sargassum Community; Bermuda Biological Station for Research, Special Publication: Bermuda, UK, 1983; pp. 1–307. [Google Scholar]
  23. Baker, P.; Minzlaff, U.; Schoenle, A.; Schwabe, E.; Hohlfeld, M.; Jeuck, A.; Brenke, N.; Prausse, D.; Rothenbeck, M.; Brix, S.; et al. Potential Contribution of Surface-Dwelling Sargassum Algae to Deep-Sea Ecosystems in the Southern North Atlantic. Deep. Sea Res. Part II Top. Stud. Oceanogr. 2018, 148, 21–34. [Google Scholar] [CrossRef]
  24. Ody, A.; Thibaut, T.; Berline, L.; Changeux, T.; André, J.-M.; Chevalier, C.; Blanfuné, A.; Blanchot, J.; Ruitton, S.; Stiger-Pouvreau, V.; et al. From In Situ to Satellite Observations of Pelagic Sargassum Distribution and Aggregation in the Tropical North Atlantic Ocean. PLoS ONE 2019, 14, e0222584. [Google Scholar] [CrossRef]
  25. Coston-Clements, L.; Settle, L.R.; Hoss, D.E.; Cross, F.A. Utilization of the Sargassum Habitat by Marine Invertebrates and Vertebrates, a Review; US Department of Commerce, National Oceanic and Atmospheric Administration, National Marine Fisheries Service, Southeast Fisheries Science Center, Beaufort Laboratory: St. Petersburg, FL, USA, 1991; Volume 296. [Google Scholar]
  26. Huffard, C.L.; Von Thun, S.; Sherman, A.D.; Sealey, K.; Smith, K.L. Pelagic Sargassum Community Change over a 40-Year Period: Temporal and Spatial Variability. Mar. Biol. 2014, 161, 2735–2751. [Google Scholar] [CrossRef] [PubMed]
  27. Alleyne, K.S.T.; Johnson, D.; Neat, F.; Oxenford, H.A.; Vallѐs, H. Seasonal Variation in Morphotype Composition of Pelagic Sargassum Influx Events Is Linked to Oceanic Origin. Sci. Rep. 2023, 13, 3753. [Google Scholar] [CrossRef] [PubMed]
  28. Theirlynck, T.; Mendonça, I.R.W.; Engelen, A.H.; Bolhuis, H.; Collado-Vides, L.; Van Tussenbroek, B.I.; García-Sánchez, M.; Zettler, E.; Muyzer, G.; Amaral-Zettler, L. Diversity of the Holopelagic Sargassum Microbiome from the Great Atlantic Sargassum Belt to Coastal Stranding Locations. Harmful Algae 2023, 122, 102369. [Google Scholar] [CrossRef] [PubMed]
  29. Marmorino, G.O.; Miller, W.D.; Smith, G.B.; Bowles, J.H. Airborne Imagery of a Disintegrating Sargassum Drift Line. Deep. Sea Res. Part I Oceanogr. Res. Pap. 2011, 58, 316–321. [Google Scholar] [CrossRef]
  30. Fidai, Y.A.; Dash, J.; Tompkins, E.L.; Tonon, T. A Systematic Review of Floating and Beach Landing Records of Sargassum beyond the Sargasso Sea. Environ. Res. Commun. 2020, 2, 122001. [Google Scholar] [CrossRef]
  31. Wang, M.; Hu, C.; Barnes, B.B.; Mitchum, G.; Lapointe, B.; Montoya, J.P. The Great Atlantic Sargassum Belt. Science 2019, 365, 83–87. [Google Scholar] [CrossRef] [PubMed]
  32. Franks, J.S.; Johnson, D.R.; Ko, D.S. Pelagic Sargassum in the Tropical North Atlantic. GCR 2016, 27, SC6–SC11. [Google Scholar] [CrossRef]
  33. Schell, J.M.; Goodwin, D.S.; Siuda, A.N.S. Recent Sargassum Inundation Events in the Caribbean: Shipboard Observations Reveal Dominance of a Previously Rare Form. Oceanography 2015, 28, 8–10. [Google Scholar] [CrossRef]
  34. Wang, M.; Hu, C. Predicting Sargassum Blooms in the Caribbean Sea from MODIS Observations. Geophys. Res. Lett. 2017, 44, 3265–3273. [Google Scholar] [CrossRef]
  35. Marsh, R.; Addo, K.A.; Jayson-Quashigah, P.-N.; Oxenford, H.A.; Maxam, A.; Anderson, R.; Skliris, N.; Dash, J.; Tompkins, E.L. Seasonal Predictions of Holopelagic Sargassum Across the Tropical Atlantic Accounting for Uncertainty in Drivers and Processes: The SARTRAC Ensemble Forecast System. Front. Mar. Sci. 2021, 8, 722524. [Google Scholar]
  36. Jouanno, J.; Moquet, J.-S.; Berline, L.; Radenac, M.-H.; Santini, W.; Changeux, T.; Thibaut, T.; Podlejski, W.; Ménard, F.; Martinez, J.-M.; et al. Evolution of the Riverine Nutrient Export to the Tropical Atlantic over the Last 15 Years: Is There a Link with Sargassum Proliferation? Environ. Res. Lett. 2021, 16, 034042. [Google Scholar] [CrossRef]
  37. Trinanes, J.; Putman, N.F.; Goni, G.; Hu, C.; Wang, M. Monitoring Pelagic Sargassum Inundation Potential for Coastal Communities. J. Oper. Oceanogr. 2023, 16, 48–59. [Google Scholar] [CrossRef]
  38. Hanisak, M.D.; Samuel, M.A. Growth Rates in Culture of Several Species of Sargassum from Florida, USA; Springer Netherlands: Sao Paulo, Brazil, 1987; pp. 399–404. [Google Scholar]
  39. Changeux, T.; Berline, L.; Podlejski, W.; Guillot, T.; Stiger-Pouvreau, V.; Connan, S.; Thibaut, T. Variability in Growth and Tissue Composition (CNP, Natural Isotopes) of the Three Morphotypes of Holopelagic Sargassum. Aquat. Bot. 2023, 187, 103644. [Google Scholar] [CrossRef]
  40. Corbin, M.; Oxenford, H.A. Assessing Growth of Pelagic Sargassum in the Tropical Atlantic. Aquat. Bot. 2023, 187, 103654. [Google Scholar] [CrossRef]
  41. Magaña-Gallegos, E.; García-Sánchez, M.; Graham, C.; Olivos-Ortiz, A.; Siuda, A.N.S.; Van Tussenbroek, B.I. Growth Rates of Pelagic Sargassum Species in the Mexican Caribbean. Aquat. Bot. 2023, 185, 103614. [Google Scholar] [CrossRef]
  42. Magaña-Gallegos, E.; Villegas-Muñoz, E.; Salas-Acosta, E.R.; Barba-Santos, M.G.; Silva, R.; Van Tussenbroek, B.I. The Effect of Temperature on the Growth of Holopelagic Sargassum Species. Phycology 2023, 3, 138–146. [Google Scholar] [CrossRef]
  43. Schell, J.M.; Goodwin, D.S.; Volk, R.H.; Siuda, A.N.S. Preliminary Explorations of Environmental Tolerances and Growth Rates of Holopelagic Sargassum Morphotypes. Aquat. Bot. 2024, 190, 103723. [Google Scholar] [CrossRef]
  44. Miron, P.; Olascoaga, M.J.; Beron-Vera, F.J.; Putman, N.F.; Triñanes, J.; Lumpkin, R.; Goni, G.J. Clustering of Marine-Debris- and Sargassum -Like Drifters Explained by Inertial Particle Dynamics. Geophys. Res. Lett. 2020, 47, e2020GL089874. [Google Scholar] [CrossRef]
  45. Olascoaga, M.J.; Beron-Vera, F.J.; Beyea, R.T.; Bonner, G.; Castellucci, M.; Goni, G.J.; Guigand, C.; Putman, N.F. Physics-Informed Laboratory Estimation of Sargassum Windage. Phys. Fluids 2023, 35, 111702. [Google Scholar] [CrossRef]
  46. García-Sánchez, M.; Graham, C.; Vera, E.; Escalante-Mancera, E.; Álvarez-Filip, L.; Van Tussenbroek, B.I. Temporal Changes in the Composition and Biomass of Beached Pelagic Sargassum Species in the Mexican Caribbean. Aquat. Bot. 2020, 167, 103275. [Google Scholar] [CrossRef]
  47. Pante, E.; Puillandre, N.; Viricel, A.; Arnaud-Haond, S.; Aurelle, D.; Castelin, M.; Chenuil, A.; Destombe, C.; Forcioli, D.; Valero, M.; et al. Species Are Hypotheses: Avoid Connectivity Assessments Based on Pillars of Sand. Mol. Ecol. 2015, 24, 525–544. [Google Scholar] [CrossRef] [PubMed]
  48. McNeill, J.; Barrie, F.R.; Buck, W.R.; Demoulin, V.; Greuter, W.; Hawksworth, D.L.; Herendeen, P.S.; Knapp, S.; Marhold, K.; Prado, J.; et al. (Eds.) International Code of Nomenclature for Algae, Fungi, and Plants; Regnum Vegetabile; Koeltz Botanical Books: Glashütten, Germany, 2018; Volume 159, ISBN 978-3-946583-16-5. [Google Scholar]
  49. Taylor, W.R. Marine Algae of the Eastern Tropical and Subtropical Coasts of the Americas; The University of Michigan Press: Ann Arbor, MI, USA, 1960. [Google Scholar]
  50. Uwai, S.; Kogame, K.; Yoshida, G.; Kawai, H.; Ajisaka, T. Geographical Genetic Structure and Phylogeography of the Sargassum horneri/filicinum Complex in Japan, Based on the Mitochondrial Cox3 Haplotype. Mar. Biol. 2009, 156, 901–911. [Google Scholar] [CrossRef]
  51. Mattio, L.; Payri, C.E. 190 Years of Sargassum Taxonomy, Facing the Advent of DNA Phylogenies. Bot. Rev. 2011, 77, 31–70. [Google Scholar] [CrossRef]
  52. Draisma, S.G.A.; Ballesteros, E.; Rousseau, F.; Thibaut, T. Dna Sequence Data Demonstrate The Polyphyly of The Genus Cystoseira and Other Sargassaceae Genera (Phaeophyceae) 1. J. Phycol. 2010, 46, 1329–1345. [Google Scholar] [CrossRef]
  53. Phillips, N.; Fredericq, S. Biogeographic and Phylogenetic Investigations of the Pantropical Genus Sargassum (Fucales, Phaetophyceae) with Respect to Gulf of Mexico Species. Gulf Mex. Sci. 2000, 18, 1. [Google Scholar] [CrossRef]
  54. Camacho, O.; Mattio, L.; Draisma, S.; Fredericq, S.; Diaz-Pulido, G. Morphological and Molecular Assessment of Sargassum (Fucales, Phaeophyceae) from Caribbean Colombia, Including the Proposal of Sargassum Giganteum Sp. Nov., Sargassum Schnetteri Comb. Nov. and Sargassum Section Cladophyllum Sect. Nov. Syst. Biodivers. 2015, 13, 105–130. [Google Scholar] [CrossRef]
  55. Sissini, M.N.; De Barros Barreto, M.B.B.; Széchy, M.T.M.; De Lucena, M.B.; Oliveira, M.C.; Gower, J.; Liu, G.; De Oliveira Bastos, E.; Milstein, D.; Gusmão, F.; et al. The Floating Sargassum (Phaeophyceae) of the South Atlantic Ocean—Likely Scenarios. Phycologia 2017, 56, 321–328. [Google Scholar] [CrossRef]
  56. González-Nieto, D.; Oliveira, M.C.; Núñez Resendiz, M.L.; Dreckmann, K.M.; Mateo-Cid, L.E.; Sentíes, A. Molecular Assessment of the Genus Sargassum (Fucales, Phaeophyceae) from the Mexican Coasts of the Gulf of Mexico and Caribbean, with the Description of S. xochitlae Sp. Nov. Phytotaxa 2020, 461, 254–274. [Google Scholar] [CrossRef]
  57. Amaral-Zettler, L.A.; Dragone, N.B.; Schell, J.; Slikas, B.; Murphy, L.G.; Morrall, C.E.; Zettler, E.R. Comparative Mitochondrial and Chloroplast Genomics of a Genetically Distinct Form of Sargassum Contributing to Recent “Golden Tides” in the Western Atlantic. Ecol. Evol. 2017, 7, 516–525. [Google Scholar] [CrossRef] [PubMed]
  58. Dibner, S.; Martin, L.; Thibaut, T.; Aurelle, D.; Blanfuné, A.; Whittaker, K.; Cooney, L.; Schell, J.M.; Goodwin, D.S.; Siuda, A.N.S. Consistent Genetic Divergence Observed among Pelagic Sargassum Morphotypes in the Western North Atlantic. Mar. Ecol. 2022, 43, e12691. [Google Scholar] [CrossRef]
  59. Thiers, B. Index Herbariorum: A Global Directory of Public Herbaria and Associated Staff. New York Botanical Garden’s Virtual Herbarium. Available online: https://sweetgum.nybg.org/science/ih/ (accessed on 24 April 2024).
  60. Taylor, W.R. The Marine Algae of Florida with Special Reference to the Dry Tortugas Carnegie; Institution of Washington: Washington, DC, USA, 1928; Volume 379. [Google Scholar]
  61. Taylor, W.R. Caribbean Marine Algae of the Allan Hancock Expedition, 1939; The University of Southern California Press: Los Angeles, CA, USA, 1942. [Google Scholar]
  62. Dawes, C.J. Marine Algae of the West Coast of Florida.; University of Miami Press: Oxford, OH, USA, 1974. [Google Scholar]
  63. Littler, D.S.; Littler, M.M. Caribbean Reefs Plants.; OffShore Graphics, Inc.: Deerfield Beach, FL, USA, 2000. [Google Scholar]
  64. John, D.M.; Lawson, G.W.; Ameka, G. The Marine Macroalgae of the Tropical Africa Sub-Region. Nova Hedwig. 2003, iv, 1–217. [Google Scholar]
  65. Dawes, C.J.; Mathieson, A.C. The Seaweeds of Florida.; University Press of Florida: Gainesville, FL, USA, 2008. [Google Scholar]
  66. Clarke, K.R.; Warwick, R.M. Changes in Marine Communities: An Approach to Statistical Analysis and Interpretation.; Plymouth Marine Laboratory: Plymouth, UK, 1994. [Google Scholar]
  67. Anderson, M.J. Permutation Tests for Univariate or Multivariate Analysis of Variance and Regression. Can. J. Fish. Aquat. Sci. 2001, 58, 626–639. [Google Scholar] [CrossRef]
  68. Clarke, K.R.; Gorley, R.N. Primer v6: User Manual/Tutorial.; Primer-E Ltd.: Plymouth, UK, 2006. [Google Scholar]
  69. Yoon, H.S.; Hackett, J.D.; Bhattacharya, D. A Single Origin of the Peridinin- and Fucoxanthin-Containing Plastids in Dinoflagellates through Tertiary Endosymbiosis. Proc. Natl. Acad. Sci. USA 2002, 99, 11724–11729. [Google Scholar] [CrossRef] [PubMed]
  70. Hu, Z.; Uwai, S.; Yu, S.; Komatsu, T.; Ajisaka, T.; Duan, D. Phylogeographic Heterogeneity of the Brown Macroalga Sargassum horneri (Fucaceae) in the Northwestern Pacific in Relation to Late Pleistocene Glaciation and Tectonic Configurations. Mol. Ecol. 2011, 20, 3894–3909. [Google Scholar] [CrossRef] [PubMed]
  71. Okonechnikov, K.; Golosova, O.; Fursov, M.; the UGENE team. Unipro UGENE: A Unified Bioinformatics Toolkit. Bioinformatics 2012, 28, 1166–1167. [Google Scholar] [CrossRef] [PubMed]
  72. Edgar, R.C. MUSCLE: Multiple Sequence Alignment with High Accuracy and High Throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef] [PubMed]
  73. Nguyen, L.-T.; Schmidt, H.A.; Von Haeseler, A.; Minh, B.Q. IQ-TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum-Likelihood Phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef] [PubMed]
  74. Huelsenbeck, J.P.; Ronquist, F. MRBAYES: Bayesian Inference of Phylogenetic Trees. Bioinformatics 2001, 17, 754–755. [Google Scholar] [CrossRef] [PubMed]
  75. Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian Phylogenetic Inference under Mixed Models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef] [PubMed]
  76. Hoang, D.T.; Chernomor, O.; Von Haeseler, A.; Minh, B.Q.; Vinh, L.S. UFBoot2: Improving the Ultrafast Bootstrap Approximation. Mol. Biol. Evol. 2018, 35, 518–522. [Google Scholar] [CrossRef] [PubMed]
  77. Lanfear, R.; Calcott, B.; Ho, S.Y.W.; Guindon, S. PartitionFinder: Combined Selection of Partitioning Schemes and Substitution Models for Phylogenetic Analyses. Mol. Biol. Evol. 2012, 29, 1695–1701. [Google Scholar] [CrossRef]
  78. Rambaut, A. FigTree v1. 4. 2012.
  79. Silberfeld, T.; Leigh, J.W.; Verbruggen, H.; Cruaud, C.; De Reviers, B.; Rousseau, F. A Multi-Locus Time-Calibrated Phylogeny of the Brown Algae (Heterokonta, Ochrophyta, Phaeophyceae): Investigating the Evolutionary Nature of the “Brown Algal Crown Radiation”. Mol. Phylogenetics Evol. 2010, 56, 659–674. [Google Scholar] [CrossRef] [PubMed]
  80. Clement, M.; Posada, D.C.K.A.; Crandall, K.A. TCS: A Computer Program to Estimate Gene Genealogies. Mol. Ecol. 2000, 9, 1657–1659. [Google Scholar] [CrossRef] [PubMed]
  81. De Queiroz, K. Species Concepts and Species Delimitation. Syst. Biol. 2007, 56, 879–886. [Google Scholar] [CrossRef] [PubMed]
  82. Watanabe, K.; Homma, Y.; Karakisawa, H.; Ishikawa, R.; Uwai, S. Haplotypic Differentiation between Seasonal Populations of Sargassum horneri (Fucales, Phaeophyceae) in Japan. Phycol. Res. 2019, 67, 59–64. [Google Scholar] [CrossRef]
  83. Sonsthagen, S.A.; Wilson, R.E.; Chesser, R.T.; Pons, J.-M.; Crochet, P.-A.; Driskell, A.; Dove, C. Recurrent Hybridization and Recent Origin Obscure Phylogenetic Relationships within the ‘White-Headed’ Gull (Larus Sp.) Complex. Mol. Phylogenetics Evol. 2016, 103, 41–54. [Google Scholar] [CrossRef] [PubMed]
  84. Tuffisantos, L.; Meira, R.; Ferreira, F.; Santannasantos, B.; Ferreira, L. Morphological Responses of Different Eucalypt Clones Submitted to Glyphosate Drift. Environ. Exp. Bot. 2007, 59, 11–20. [Google Scholar] [CrossRef]
  85. Stiger, V.; Horiguchi, T.; Yoshida, T.; Coleman, A.W.; Masuda, M. Phylogenetic Relationships of Sargassum (Sargassaceae, Phaeophyceae) with Reference to a Taxonomic Revision of the Section Phyllocystae Based on ITS-2 nrDNA Sequences. Phycol. Res. 2000, 48, 251–260. [Google Scholar] [CrossRef]
  86. Yoshida, T.; Stiger, V.; Horiguchi, T. Sargassum boreale sp. Nov. (Fucales, Phaeophyceae) from Hokkaido, Japan. Phycol. Res. 2000, 48, 125–131. [Google Scholar] [CrossRef]
  87. Mattio, L.; Payri, C.E.; Stiger-Pouvreau, V. Taxonomic Revision of Sargassum (Fucales, Phaeophyceae) from French Polynesia Based on Morphological And Molecular Analyses 1. J. Phycol. 2008, 44, 1541–1555. [Google Scholar] [CrossRef] [PubMed]
  88. Rohfritsch, A.; Payri, C.; Stiger, V.; Bonhomme, F. Molecular and Morphological Relationships between Two Closely Related Species, Turbinaria ornata and T. conoides (Sargassaceae, Phaeophyceae). Biochem. Syst. Ecol. 2007, 35, 91–98. [Google Scholar] [CrossRef]
  89. Deacon, G.E.R. The Sargasso Sea. Geogr. J. 1942, 99, 16–28. [Google Scholar] [CrossRef]
  90. Ryther, J.H. The Sargasso Sea. Sci. Am. 1956, 194, 98–108. [Google Scholar] [CrossRef]
  91. Woelkerling, W.J. On the Epibiotic and Pelagic Chlorophyceae, Phaeophyceae and Rhodophyceae of the Western Sargasso Sea. Rhodora 1975, 77, 1–40. [Google Scholar]
  92. Butler, J.N.; Stoner, A.W. Pelagic Sargassum: Has its Biomass Changed in the Last 50 Years? Deep. Sea Res. 1984, 31, 1259–1264. [Google Scholar] [CrossRef]
  93. Niermann, U.; Anders, H.-G.; John, H.-C. Distribution and Abundance of Pelagic Sargassum in Spring 1979. Senckenberg. Marit 1986, 17, 293–302. [Google Scholar]
  94. Conover, J.T.; Sieburth, M.J. Effect of Sargassum Distribution on its Epibiota and Antibacterial Activity. Bot. Mar. 1964, 6, 147–156. [Google Scholar] [CrossRef]
  95. Ryland, J.S. Observations on Some Epibionts of Gulf-Weed, Sargassum natans (l.) Meyen. J. Exp. Mar. Biol. Ecol. 1974, 14, 17–25. [Google Scholar] [CrossRef]
  96. Niermann, U. Distribution of Sargassum natans and Some of its Epibionts in the Sargasso Sea. Helgol. Meeresunters. 1986, 40, 343–353. [Google Scholar] [CrossRef]
  97. Calder, D.R. Hydroid Assemblages on Holopelagic Sargassum From the Sargasso Sea at Bermuda. Bull. Mar. Sci. 1995, 56, 537–546. [Google Scholar]
  98. Weis, J.S. Fauna Associated with Pelagic Sargassum in the Gulf Stream. Am. Midl. Nat. 1968, 80, 554–558. [Google Scholar] [CrossRef]
  99. Fine, M.L. Faunal Variation on Pelagic Sargassum. Mar. Biol. 1970, 7, 112–122. [Google Scholar] [CrossRef]
  100. Stoner, A.W.; Greening, H.S. Geographic Variation in the Macrofauna Associates of Pelagic Sargassum and Some Biogeographic Implications. Mar. Ecol. Prog. Ser. 1984, 20, 185–192. [Google Scholar] [CrossRef]
  101. Howard, K.L.; Menzies, R.J. Distribution and Production of Sargassum in the Waters off the Carolina Coast. Bot. Mar. 1967, 12, 244–254. [Google Scholar] [CrossRef]
  102. Lapointe, B.E. Phosphorous-Limited Photosynthesis and Growth of Sargassum natans and Sargassum fluitans (Phaeophyceae) in the Western North Atlantic. Deep. Sea Res. 1986, 33, 391–399. [Google Scholar] [CrossRef]
  103. Wynne, M.J. A Checklist of Benthic Marine Algae of the Tropical and Subtropical Western Atlantic. Can. J. Bot. 1986, 64, 2239–2281. [Google Scholar] [CrossRef]
  104. Schneider, C.W.; Searles, R.B. Seaweeds of the Southeastern United States: Cape Hatteras to Cape Canaveral. Duke University Press: Durham, NC, USA, 1991; 584p.
  105. de Szechy, M.T.M.; Guedes, P.M.; Baeta-Neves, M.H.; Oliveira, E.N. Verification of Sargassum natans (Linnaeus) Gaillon (Heterokontophyta: Phaeophyceae) from the Sargasso Sea Off the Coast of Brazil, Western Atlantic Ocean. Checklist 2012, 8, 638–641. [Google Scholar] [CrossRef]
  106. Lapointe, B.E.; West, L.E.; Sutton, T.T.; Hu, C. Ryther Revisited: Nutrient Excretions by Fishes Enhance Productivity of Pelagic Sargassum in the Western North Atlantic Ocean. J. Exp. Mar. Biol. Ecol. 2014, 458, 46–56. [Google Scholar] [CrossRef]
  107. Doyle, E.; Franks, J. Sargassum Factsheet. Gulf and Caribbean Fisheries Institute: Guadeloupe, French, 2015; p. 4. Available online: https://www.gcfi.org/sargassum-influx/ (accessed on 27 February 2024).
  108. Wynne, M.J. A Checklist of Benthic Marine Algae of the Tropical and Subtropical Western Atlantic: Fifth Revision Nova Hedwigia Beiheft, 153, Bomtraeger Science Publishers, Stuttgart, Germany; 2022. 180 pp.
  109. Govindarajan, A.F.; Cooney, L.; Whittaker, K.; Bloch, D.; Burdorf, R.M.; Canning, S.; Carter, C.; Cellan, S.M.; Eriksson, F.A.A.; Freyer, H.; et al. The Distribution and Mitochondrial Genotype of the Hydroid Aglaophenia Latecarinata Is Correlated with Its Pelagic Sargassum Substrate Type in the Tropical and Subtropical Wester Atlantic Ocean. PeerJ 2019, 7, e7814. [Google Scholar] [CrossRef] [PubMed]
  110. Martin, L.M.; Taylor, M.; Huston, G.; Goodwin, D.S.; Schell, J.M.; Siuda, A.N.S. Pelagic Sargassum Morphotypes Support Different Rafting Motile Epifauna Communities. Mar. Biol. 2021, 168, 115. [Google Scholar] [CrossRef]
  111. McGillicuddy, D.J.; Morton, P.L.; Brewton, R.A.; Hu, C.; Kelly, T.B.; Solow, A.R.; Lapointe, B.E. Nutrient and Arsenic Biogeochemistry of Sargassum in the Western Atlantic. Nat. Commun. 2023, 14, 6205. [Google Scholar] [CrossRef] [PubMed]
  112. Samadi, S.; Barberousse, A. Species. In Handbook of Evolution Thinking in the Sciences; Heams, T., Huneman, P., Lecointre, G., Silberstein, M., Eds.; Springer: Berlin/Heidelberg, Germany, 2015. [Google Scholar]
  113. Rousseau, F.; De Reviers, B. Phylogenetic Relationships within the Fucales (Phaeophyceae) Based on Combined Partial SSU+ LSU rDNA Sequence Data. Eur. J. Phycol. 1999, 34, 53–64. [Google Scholar]
  114. Motomura, T.; Nagasato, C.; Kimura, K. Cytoplasmic Inheritance of Organelles in Brown Algae. J. Plant Res. 2010, 123, 185–192. [Google Scholar] [CrossRef] [PubMed]
Phycology 04 00014 g001
Figure 1. Sampling locations of holopelagic Sargassum during the two 2017 expeditions. S: Caribbean expedition; Y: Transatlantic expedition.
Figure 1. Sampling locations of holopelagic Sargassum during the two 2017 expeditions. S: Caribbean expedition; Y: Transatlantic expedition.
Phycology 04 00014 g001
Phycology 04 00014 g002
Figure 2. Two-dimensional nMDS ordination plot using S17 Bray–Curtis similarity based on 54 discriminant morphological characters of 264 holopelagic specimens of Sargassum collected during the two 2017 campaigns.
Figure 2. Two-dimensional nMDS ordination plot using S17 Bray–Curtis similarity based on 54 discriminant morphological characters of 264 holopelagic specimens of Sargassum collected during the two 2017 campaigns.
Phycology 04 00014 g002
Phycology 04 00014 g003
Figure 3. Dried specimens and detail of holopelagic Sargassum morphotypes collected at station S10. (A) Sargassum fluitans III (S. fluitans var. fluitans, ref. HCOM S10-S3-1). (B) Sargassum natans I (S. natans ref. HCOM S10-S2-2). (C) Sargassum natans VIII (S. natans var. wingei nov. var., holotype, ref. HCOM S10-S1-3).
Figure 3. Dried specimens and detail of holopelagic Sargassum morphotypes collected at station S10. (A) Sargassum fluitans III (S. fluitans var. fluitans, ref. HCOM S10-S3-1). (B) Sargassum natans I (S. natans ref. HCOM S10-S2-2). (C) Sargassum natans VIII (S. natans var. wingei nov. var., holotype, ref. HCOM S10-S1-3).
Phycology 04 00014 g003
Phycology 04 00014 g004
Figure 4. Morphological comparison between S. fluitans III, S. natans I, and S. natans VIII morphotypes of holopelagic Sargassum collected during the two expeditions of 2017. (A) Habitus, axis, and vesicles of S. fluitans III morphotype (S. fluitans var. fluitans). Scale bars = 1 cm. (B) Habitus, axis, and vesicles of S. natans I morphotype (S. natans var. natans). (C) Habitus, axis, and vesicles of S. natans VIII morphotype (S. natans var. wingei nov. var.). Each vesicle is attached to the axis by a pedicel. Vesicles have an apical spine-like appendage only for Sargassum natans var. natans.
Figure 4. Morphological comparison between S. fluitans III, S. natans I, and S. natans VIII morphotypes of holopelagic Sargassum collected during the two expeditions of 2017. (A) Habitus, axis, and vesicles of S. fluitans III morphotype (S. fluitans var. fluitans). Scale bars = 1 cm. (B) Habitus, axis, and vesicles of S. natans I morphotype (S. natans var. natans). (C) Habitus, axis, and vesicles of S. natans VIII morphotype (S. natans var. wingei nov. var.). Each vesicle is attached to the axis by a pedicel. Vesicles have an apical spine-like appendage only for Sargassum natans var. natans.
Phycology 04 00014 g004
Phycology 04 00014 g005
Figure 5. Phylogenetic tree based on the concatenation of rbcL and cox3 sequences. The topology shown here corresponds to the output of the Maximum Likelihood analysis. Bootstrap values higher than 80%, and posterior probabilities higher than 0.9 are indicated at the left of the corresponding group. Newly generated sequences are in red. For the sequences retrieved from GenBank, the accession number is indicated together with the species name (corrected with current taxonomic status).
Figure 5. Phylogenetic tree based on the concatenation of rbcL and cox3 sequences. The topology shown here corresponds to the output of the Maximum Likelihood analysis. Bootstrap values higher than 80%, and posterior probabilities higher than 0.9 are indicated at the left of the corresponding group. Newly generated sequences are in red. For the sequences retrieved from GenBank, the accession number is indicated together with the species name (corrected with current taxonomic status).
Phycology 04 00014 g005
Phycology 04 00014 g006
Figure 6. Sequence networks for mt spacer IGS, rbcL, 16S rRNA gene, concatenation of cox2 and cox3, and nad6. Sequences of S. polyceratium, S. vachellianum, S. spinuligerum, and Sargassum sp., as well as dot-filled wedges correspond to sequences retrieved from GenBank. Number of sequences per haplotype is noted.
Figure 6. Sequence networks for mt spacer IGS, rbcL, 16S rRNA gene, concatenation of cox2 and cox3, and nad6. Sequences of S. polyceratium, S. vachellianum, S. spinuligerum, and Sargassum sp., as well as dot-filled wedges correspond to sequences retrieved from GenBank. Number of sequences per haplotype is noted.
Phycology 04 00014 g006
Table 1. Primer names and sequences, annealing temperature and time, elongation time, expected size of the PCR product, and references for all loci studied in the present study.
Table 1. Primer names and sequences, annealing temperature and time, elongation time, expected size of the PCR product, and references for all loci studied in the present study.
LocusPrimerSequenceAnnealingElongationSize (bp)Reference
mt spacer IGStRNALys-FCGTTTGGTGAGAACCTTACC48 °C, 1 min1 min250[52]
tRNALys-RTACCACTGAGTTATTGCTCCC
cox2cox2-370FCAAAGATGGATTCGACGGTTGG57 °C, 1 min1 min406[57]
cox2-776RCCGGTATCAAACTCGCCCTT
cox3cox3-467FGGTTCAACGACACCCATTT50 °C, 1 min1 min434[57]
cox3-901RTAGCGTGATGAGCCCATG
16S rRNASarg-mt16S-FGTAGTCGGTTGGGTTAGGCC60 °C, 1 min1 min616[58]
Sarg-mt16S-RGTTTGAACCCCCGCCAATTC
nad6Sarg-nad6-F (External)TATGATTCTTGGGGCTGGT56 °C, 1 min1 min431[58]
Sarg-nad6-R (External)GGGATCATTCAAAGCAGAAGA
psbApsbA-FATGACTGCTACTTTAGAAAGACG49 °C, 1 min1 min 30 s970[69]
psbA-R1GCTAAATCTARWGGGAAGTTGTG
rbcLrbcL-FTATGATTGATTT AGTGGTTGG51 °C, 1 min 30 s2 min820[70]
rbcL-RGTTCGTCAC TTAAATCTGGTA
Table 2. Permutation multivariate analysis of variance (PERMANOVA) and pair-wise test, based on the morphological characters of holopelagic specimens of Sargassum collected during the two 2017 campaigns (after a square root transformation of the data, and using S17 Bray–Curtis similarity).
Table 2. Permutation multivariate analysis of variance (PERMANOVA) and pair-wise test, based on the morphological characters of holopelagic specimens of Sargassum collected during the two 2017 campaigns (after a square root transformation of the data, and using S17 Bray–Curtis similarity).
SourcedfSSMSPseudo-FP(perm)Unique perms
Morphotype277,75638,878175.730.001998
Residual25255,752221.24
Total2541.3351 × 105
GroupstP(perm)Unique permsP(MC)
S. natans VIII, S. natans I14.310.0019990.001
S. natans VIII, S. fluitans III10.590.0019990.001
S. natans I, S. fluitans III14.930.0019990.001
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Siuda, A.N.S.; Blanfuné, A.; Dibner, S.; Verlaque, M.; Boudouresque, C.-F.; Connan, S.; Goodwin, D.S.; Stiger-Pouvreau, V.; Viard, F.; Rousseau, F.; et al. Morphological and Molecular Characters Differentiate Common Morphotypes of Atlantic Holopelagic Sargassum. Phycology 2024, 4, 256-275. https://doi.org/10.3390/phycology4020014

AMA Style

Siuda ANS, Blanfuné A, Dibner S, Verlaque M, Boudouresque C-F, Connan S, Goodwin DS, Stiger-Pouvreau V, Viard F, Rousseau F, et al. Morphological and Molecular Characters Differentiate Common Morphotypes of Atlantic Holopelagic Sargassum. Phycology. 2024; 4(2):256-275. https://doi.org/10.3390/phycology4020014

Chicago/Turabian Style

Siuda, Amy N. S., Aurélie Blanfuné, Skye Dibner, Marc Verlaque, Charles-François Boudouresque, Solène Connan, Deborah S. Goodwin, Valérie Stiger-Pouvreau, Frédérique Viard, Florence Rousseau, and et al. 2024. "Morphological and Molecular Characters Differentiate Common Morphotypes of Atlantic Holopelagic Sargassum" Phycology 4, no. 2: 256-275. https://doi.org/10.3390/phycology4020014

Article Metrics

Back to TopTop