The Role of Human Endogenous Retrovirus (HERV)-K119 env in THP-1 Monocytic Cell Differentiation
Abstract
1. Introduction
2. Results
2.1. Knockout of HERV-K119 env Gene in Human Monocytic Leukemia Cells
2.2. Effects of HERV-K119 env KO on Cytokine Secretion, Cell Proliferation, Migration, and Invasion in THP-1 Human Monocytic Leukemia Cells
2.3. Transcriptome Analysis of HERV-K119 env KO THP-1 Monocytic Leukemia Cells
2.4. Effects of SEMA7A on THP-1 Human Monocytic Leukemia Cell Lines
2.5. Expression Level of Macrophage Markers in HERV-K119 env KO Monocytic Leukemia Cells
3. Discussion
4. Materials and Methods
4.1. Cell Culture and Transfection
4.2. Generation of Knockout Cell Line with CRISPR-Cas9
4.3. Plasmid Construct for Over-Expression
4.4. RT-PCR, qRT-PCR and Genomic PCR (Polymerase Chain Reaction)
4.5. Western Blot Analysis
4.6. Cytokine Assay
4.7. Invasion and Migration Assays
4.8. Cell Viability Assay
4.9. RNA-Seq Data Analysis
4.10. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Belshaw, R.; Pereira, V.; Katzourakis, A.; Talbot, G.; Paces, J.; Burt, A.; Tristem, M. Long-term reinfection of the human genome by endogenous retroviruses. Proc. Natl. Acad. Sci. USA 2004, 101, 4894–4899. [Google Scholar] [CrossRef] [Scilit]
- Belshaw, R.; Dawson, A.L.; Woolven-Allen, J.; Redding, J.; Burt, A.; Tristem, M. Genomewide screening reveals high levels of insertional polymorphism in the human endogenous retrovirus family HERV-K(HML2): Implications for present-day activity. J. Virol. 2005, 79, 12507–12514. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang-Johanning, F.; Rycaj, K.; Plummer, J.B.; Li, M.; Yin, B.; Frerich, K.; Garza, J.G.; Shen, J.; Lin, K.; Yan, P.; et al. Immunotherapeutic potential of anti-human endogenous retrovirus-K envelope protein antibodies in targeting breast tumors. J. Natl. Cancer Inst. 2012, 104, 189–210. [Google Scholar] [CrossRef] [Scilit]
- Wang-Johanning, F.; Li, M.; Esteva, F.J.; Hess, K.R.; Yin, B.; Rycaj, K.; Plummer, J.B.; Garza, J.G.; Ambs, S.; Johanning, G.L. Human endogenous retrovirus type K antibodies and mRNA as serum biomarkers of early-stage breast cancer. Int. J. Cancer 2014, 134, 587–595. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, J.; Rycaj, K.; Geng, S.; Li, M.; Plummer, J.B.; Yin, B.; Liu, H.; Xu, X.; Zhang, Y.; Yan, Y.; et al. Expression of Human Endogenous Retrovirus Type K Envelope Protein is a Novel Candidate Prognostic Marker for Human Breast Cancer. Genes Cancer 2011, 2, 914–922. [Google Scholar] [CrossRef] [Scilit]
- Ishida, T.; Obata, Y.; Ohara, N.; Matsushita, H.; Sato, S.; Uenaka, A.; Saika, T.; Miyamura, T.; Chayama, K.; Nakamura, Y.; et al. Identification of the HERV-K gag antigen in prostate cancer by SEREX using autologous patient serum and its immunogenicity. Cancer Immun. 2008, 8, 15. [Google Scholar]
- Hahn, S.; Ugurel, S.; Hanschmann, K.M.; Strobel, H.; Tondera, C.; Schadendorf, D.; Lower, J.; Lower, R. Serological response to human endogenous retrovirus K in melanoma patients correlates with survival probability. AIDS Res. Hum. Retroviruses 2008, 24, 717–723. [Google Scholar] [CrossRef] [Scilit]
- Wang-Johanning, F.; Liu, J.; Rycaj, K.; Huang, M.; Tsai, K.; Rosen, D.G.; Chen, D.T.; Lu, D.W.; Barnhart, K.F.; Johanning, G.L. Expression of multiple human endogenous retrovirus surface envelope proteins in ovarian cancer. Int. J. Cancer 2007, 120, 81–90. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Curty, G.; Marston, J.L.; de Mulder Rougvie, M.; Leal, F.E.; Nixon, D.F.; Soares, M.A. Human Endogenous Retrovirus K in Cancer: A Potential Biomarker and Immunotherapeutic Target. Viruses 2020, 12, 726. [Google Scholar] [CrossRef] [Scilit]
- Tugnet, N.; Rylance, P.; Roden, D.; Trela, M.; Nelson, P. Human Endogenous Retroviruses (HERVs) and Autoimmune Rheumatic Disease: Is There a Link? Open Rheumatol. J. 2013, 7, 13–21. [Google Scholar] [CrossRef] [Scilit]
- Posso-Osorio, I.; Tobon, G.J.; Canas, C.A. Human endogenous retroviruses (HERV) and non-HERV viruses incorporated into the human genome and their role in the development of autoimmune diseases. J. Transl. Autoimmun. 2021, 4, 100137. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ko, E.J.; Cha, H.J. The Roles of Human Endogenous Retroviruses (HERVs) in Inflammation. Kosin Med. J. 2021, 36, 69–78. [Google Scholar] [CrossRef] [Scilit]
- Morozov, V.A.; Dao Thi, V.L.; Denner, J. The transmembrane protein of the human endogenous retrovirus-K (HERV-K) modulates cytokine release and gene expression. PLoS ONE 2013, 8, e70399. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rangel, S.C.; da Silva, M.D.; da Silva, A.L.; Dos Santos, J.M.B.; Neves, L.M.; Pedrosa, A.; Rodrigues, F.M.; Trettel, C.D.S.; Furtado, G.E.; de Barros, M.P.; et al. Human endogenous retroviruses and the inflammatory response: A vicious circle associated with health and illness. Front. Immunol. 2022, 13, 1057791. [Google Scholar] [CrossRef] [Scilit]
- Russ, E.; Iordanskiy, S. Endogenous Retroviruses as Modulators of Innate Immunity. Pathogens 2023, 12, 162. [Google Scholar] [CrossRef] [Scilit]
- Dembny, P.; Newman, A.G.; Singh, M.; Hinz, M.; Szczepek, M.; Kruger, C.; Adalbert, R.; Dzaye, O.; Trimbuch, T.; Wallach, T.; et al. Human endogenous retrovirus HERV-K(HML-2) RNA causes neurodegeneration through Toll-like receptors. JCI Insight 2020, 5, e131093. [Google Scholar] [CrossRef] [Scilit]
- Ko, E.J.; Song, K.S.; Ock, M.S.; Choi, Y.H.; Kim, S.; Kim, H.S.; Cha, H.J. Expression profiles of human endogenous retrovirus (HERV)-K and HERV-R Env proteins in various cancers. BMB Rep. 2021, 54, 368–373. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ko, E.J.; Ock, M.S.; Choi, Y.H.; Iovanna, J.L.; Mun, S.; Han, K.; Kim, H.S.; Cha, H.J. Human Endogenous Retrovirus (HERV)-K env Gene Knockout Affects Tumorigenic Characteristics of nupr1 Gene in DLD-1 Colorectal Cancer Cells. Int. J. Mol. Sci. 2021, 22, 3941. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ko, E.J.; Kim, E.T.; Kim, H.; Lee, C.M.; Koh, S.B.; Eo, W.K.; Kim, H.; Oh, Y.L.; Ock, M.S.; Kim, K.H.; et al. Effect of human endogenous retrovirus-K env gene knockout on proliferation of ovarian cancer cells. Genes Genom. 2022, 44, 1091–1097. [Google Scholar] [CrossRef] [Scilit]
- Li, M.; Radvanyi, L.; Yin, B.; Rycaj, K.; Li, J.; Chivukula, R.; Lin, K.; Lu, Y.; Shen, J.; Chang, D.Z.; et al. Downregulation of Human Endogenous Retrovirus Type K (HERV-K) Viral env RNA in Pancreatic Cancer Cells Decreases Cell Proliferation and Tumor Growth. Clin. Cancer Res. 2017, 23, 5892–5911. [Google Scholar] [CrossRef] [Scilit]
- Wildschutte, J.H.; Williams, Z.H.; Montesion, M.; Subramanian, R.P.; Kidd, J.M.; Coffin, J.M. Discovery of unfixed endogenous retrovirus insertions in diverse human populations. Proc. Natl. Acad. Sci. USA 2016, 113, E2326–E2334. [Google Scholar] [CrossRef] [Scilit]
- Morozov, V.A.; Morozov, A.V.; Semaan, M.; Denner, J. Single mutations in the transmembrane envelope protein abrogate the immunosuppressive property of HIV-1. Retrovirology 2012, 9, 67. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Young, G.R.; Terry, S.N.; Manganaro, L.; Cuesta-Dominguez, A.; Deikus, G.; Bernal-Rubio, D.; Campisi, L.; Fernandez-Sesma, A.; Sebra, R.; Simon, V.; et al. HIV-1 Infection of Primary CD4(+) T Cells Regulates the Expression of Specific Human Endogenous Retrovirus HERV-K (HML-2) Elements. J. Virol. 2018, 92. [Google Scholar] [CrossRef] [Scilit]
- Gonzalez-Hernandez, M.J.; Swanson, M.D.; Contreras-Galindo, R.; Cookinham, S.; King, S.R.; Noel, R.J., Jr.; Kaplan, M.H.; Markovitz, D.M. Expression of human endogenous retrovirus type K (HML-2) is activated by the Tat protein of HIV-1. J. Virol. 2012, 86, 7790–7805. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nagy, G.; Ward, J.; Mosser, D.D.; Koncz, A.; Gergely, P., Jr.; Stancato, C.; Qian, Y.; Fernandez, D.; Niland, B.; Grossman, C.E.; et al. Regulation of CD4 expression via recycling by HRES-1/RAB4 controls susceptibility to HIV infection. J. Biol. Chem. 2006, 281, 34574–34591. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chanput, W.; Mes, J.J.; Wichers, H.J. THP-1 cell line: An in vitro cell model for immune modulation approach. Int. Immunopharmacol. 2014, 23, 37–45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Genin, M.; Clement, F.; Fattaccioli, A.; Raes, M.; Michiels, C. M1 and M2 macrophages derived from THP-1 cells differentially modulate the response of cancer cells to etoposide. BMC Cancer 2015, 15, 577. [Google Scholar] [CrossRef] [Scilit]
- Song, Y.; Wang, L.; Zhang, L.; Huang, D. The involvement of semaphorin 7A in tumorigenic and immunoinflammatory regulation. J. Cell. Physiol. 2021, 236, 6235–6248. [Google Scholar] [CrossRef] [Scilit]
- Korner, A.; Bernard, A.; Fitzgerald, J.C.; Alarcon-Barrera, J.C.; Kostidis, S.; Kaussen, T.; Giera, M.; Mirakaj, V. Sema7A is crucial for resolution of severe inflammation. Proc. Natl. Acad. Sci. USA 2021, 118, e2017527118. [Google Scholar] [CrossRef] [Scilit]
- Kohler, D.; Granja, T.; Volz, J.; Koeppen, M.; Langer, H.F.; Hansmann, G.; Legchenko, E.; Geisler, T.; Bakchoul, T.; Eggstein, C.; et al. Red blood cell-derived semaphorin 7A promotes thrombo-inflammation in myocardial ischemia-reperfusion injury through platelet GPIb. Nat. Commun. 2020, 11, 1315. [Google Scholar] [CrossRef] [Scilit]
- Ghofrani, J.; Lucar, O.; Dugan, H.; Reeves, R.K.; Jost, S. Semaphorin 7A modulates cytokine-induced memory-like responses by human natural killer cells. Eur. J. Immunol. 2019, 49, 1153–1166. [Google Scholar] [CrossRef] [Scilit]
- Locati, M.; Mantovani, A.; Sica, A. Macrophage activation and polarization as an adaptive component of innate immunity. Adv. Immunol. 2013, 120, 163–184. [Google Scholar] [PubMed]
- Wang, T.; Medynets, M.; Johnson, K.R.; Doucet-O’Hare, T.T.; DiSanza, B.; Li, W.; Xu, Y.; Bagnell, A.; Tyagi, R.; Sampson, K.; et al. Regulation of stem cell function and neuronal differentiation by HERV-K via mTOR pathway. Proc. Natl. Acad. Sci. USA 2020, 117, 17842–17853. [Google Scholar] [CrossRef] [Scilit]
- Steiner, J.P.; Bachani, M.; Malik, N.; DeMarino, C.; Li, W.; Sampson, K.; Lee, M.H.; Kowalak, J.; Bhaskar, M.; Doucet-O’Hare, T.; et al. Human Endogenous Retrovirus K Envelope in Spinal Fluid of Amyotrophic Lateral Sclerosis Is Toxic. Ann. Neurol. 2022, 92, 545–561. [Google Scholar] [CrossRef] [Scilit]
- Tavakolian, S.; Goudarzi, H.; Faghihloo, E. Evaluating the expression level of HERV-K env, np9, rec and gag in breast tissue. Infect. Agent Cancer 2019, 14, 42. [Google Scholar] [CrossRef] [Scilit]
- Duan, X.; Liu, X.; Li, W.; Holmes, J.A.; Kruger, A.J.; Yang, C.; Li, Y.; Xu, M.; Ye, H.; Li, S.; et al. Microrna-130a Downregulates HCV Replication through an atg5-Dependent Autophagy Pathway. Cells 2019, 8, 338. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.; Ling, X.L.; Wu, Y.Y.; Lu, M.H.; Guo, H.; Zhang, P.B.; Zhao, X.Y.; Yang, S.M. CD64 expression is increased in patients with severe acute pancreatitis: Clinical significance. Gut Liver 2014, 8, 445–451. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ye, S.Y.; Apple, J.E.; Ren, X.; Tang, F.L.; Yao, L.L.; Wang, Y.G.; Mei, L.; Zhou, Y.G.; Xiong, W.C. Microglial VPS35 deficiency regulates microglial polarization and decreases ischemic stroke-induced damage in the cortex. J. Neuroinflamm. 2019, 16, 235. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Manuelpillai, U.; Lourensz, D.; Vaghjiani, V.; Tchongue, J.; Lacey, D.; Tee, J.Y.; Murthi, P.; Chan, J.; Hodge, A.; Sievert, W. Human amniotic epithelial cell transplantation induces markers of alternative macrophage activation and reduces established hepatic fibrosis. PLoS ONE 2012, 7, e38631. [Google Scholar] [CrossRef] [Scilit]
- Alshahrani, A.; Bin Khunayfir, A.; Al Rayih, M.; Al Sayed, H.; Alsadoon, A.; Al Dubayee, M.; Zahra, M.; Alrumayyan, Y.; Al Zayer, M.; Nasr, A.; et al. Phenotypic Characterization of Human Monocytes following Macronutrient Intake in Healthy Humans. Front. Immunol. 2017, 8, 1293. [Google Scholar] [CrossRef] [Scilit]
- Jo, J.O.; Kim, S.R.; Bae, M.K.; Kang, Y.J.; Ock, M.S.; Kleinman, H.K.; Cha, H.J. Thymosin beta4 induces the expression of vascular endothelial growth factor (VEGF) in a hypoxia-inducible factor (HIF)-1alpha-dependent manner. Biochim. Biophys. Acta 2010, 1803, 1244–1251. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cha, H.J.; Jeong, M.J.; Kleinman, H.K. Role of thymosin beta4 in tumor metastasis and angiogenesis. J. Natl. Cancer Inst. 2003, 95, 1674–1680. [Google Scholar] [CrossRef] [Scilit]
- Trapnell, C.; Pachter, L.; Salzberg, S.L. TopHat: Discovering splice junctions with RNA-Seq. Bioinformatics 2009, 25, 1105–1111. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roberts, A.; Trapnell, C.; Donaghey, J.; Rinn, J.L.; Pachter, L. Improving RNA-Seq expression estimates by correcting for fragment bias. Genome Biol. 2011, 12, R22. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Target Gene | HERV-K env KO | Fold Change (/MOCK, Treatment Groups) | Classification | Raw Data (FPKM) |
|---|---|---|---|---|
| SEMAA7A | K env KO Treated PMA Treated PMA + LPS | 1.15 19.296 20.369 | Up-regulation | 145 1185 1299 |
| Gene | Sense | Antisense | Ref. |
|---|---|---|---|
| Sema7a | ACAGGGGCACTATCCACAAG | CTCAGCATCCAGCGACAT | |
| CD80 | CACCTGGCTGAAGTGAC | GTCAGGCAGCATATCAC | Duan et al. [36] |
| CD86 | GGGCCGCACAAGTTTTGA | GCCCTTGTCCTTGATCTGAA | Duan et al. [36] |
| CD64 | ATGGCACCTACCATTGCTCAGG | CCA AGCACTTGAAGCTCCAACTC | Zhang et al. [37] |
| CD32 | AATCCTGCCGTTCCTACTGATC | GTGTCACCGTGTCTTCCTTGAG | Ye et al. [38] |
| CD206 | GTTCACCTGGATGATGGTTCTC | AGGACATGCCAGGGTCACCTTT | Manuelpillai et al. [39] |
| CD163 | CAGGAAACCAGTCCCAAACA | AGCGACCTCCTCCATTTACC | Alshahrani et al. [40] |
| CD68 | GCTACATGGCGGTGGAGTACAA | ATGATGAGAGGCAGCAAGATGG | Alshahrani et al. [40] |
| GAPDH | TGTTCCTACCCCCAATGTGT | TGTGAGGGAGATGCTCAGTG | Manuelpillai et al. [39] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ko, E.-J.; Kim, M.-H.; Kim, D.-Y.; An, H.; Leem, S.-H.; Choi, Y.H.; Kim, H.-S.; Cha, H.-J. The Role of Human Endogenous Retrovirus (HERV)-K119 env in THP-1 Monocytic Cell Differentiation. Int. J. Mol. Sci. 2023, 24, 15566. https://doi.org/10.3390/ijms242115566
Ko E-J, Kim M-H, Kim D-Y, An H, Leem S-H, Choi YH, Kim H-S, Cha H-J. The Role of Human Endogenous Retrovirus (HERV)-K119 env in THP-1 Monocytic Cell Differentiation. International Journal of Molecular Sciences. 2023; 24(21):15566. https://doi.org/10.3390/ijms242115566
Chicago/Turabian StyleKo, Eun-Ji, Min-Hye Kim, Do-Ye Kim, Hyojin An, Sun-Hee Leem, Yung Hyun Choi, Heui-Soo Kim, and Hee-Jae Cha. 2023. "The Role of Human Endogenous Retrovirus (HERV)-K119 env in THP-1 Monocytic Cell Differentiation" International Journal of Molecular Sciences 24, no. 21: 15566. https://doi.org/10.3390/ijms242115566
APA StyleKo, E.-J., Kim, M.-H., Kim, D.-Y., An, H., Leem, S.-H., Choi, Y. H., Kim, H.-S., & Cha, H.-J. (2023). The Role of Human Endogenous Retrovirus (HERV)-K119 env in THP-1 Monocytic Cell Differentiation. International Journal of Molecular Sciences, 24(21), 15566. https://doi.org/10.3390/ijms242115566

