Production, Exacerbating Effect, and EV-Mediated Transcription of Hepatic CCN2 in NASH: Implications for Diagnosis and Therapy of NASH Fibrosis
Abstract
:1. Introduction
2. Results
2.1. CCN2 Is Induced in NAFLD Liver
2.2. CCN2 Localization in Normal or NASH Liver
2.3. CCN2 Transgene Exacerbates NASH Fibrosis
2.4. CCN2 Is Induced in HSC In Vitro by EVs from Palmitic Acid-Treated Hepatocytes
3. Discussion
4. Materials and Methods
4.1. Non-Alcoholic Steatohepatitis (NASH) Disease Model
4.2. Histology
4.3. Immunofluorescence
4.4. Liver Function and Glucose Tests
4.5. Patient Cohort Sequencing Data Analysis
4.6. Isolation and Characterization of Extracellular Vesicles (EVs) from Palmitic Acid-Treated Hepatocytes
4.7. RNA Extraction and Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)
4.8. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Diehl, A.M.; Day, C. Cause, Pathogenesis, and Treatment of Nonalcoholic Steatohepatitis. N. Engl. J. Med. 2017, 377, 2063–2072. [Google Scholar] [CrossRef]
- Sheka, A.C.; Adeyi, O.; Thompson, J.; Hameed, B.; Crawford, P.A.; Ikramuddin, S. Nonalcoholic Steatohepatitis: A Review. JAMA 2020, 323, 1175–1183. [Google Scholar] [CrossRef] [PubMed]
- Loomba, R.; Friedman, S.L.; Shulman, G.I. Mechanisms and disease consequences of nonalcoholic fatty liver disease. Cell 2021, 184, 2537–2564. [Google Scholar] [CrossRef] [PubMed]
- Younossi, Z.M.; Koenig, A.B.; Abdelatif, D.; Fazel, Y.; Henry, L.; Wymer, M. Global epidemiology of nonalcoholic fatty liver disease-Meta-analytic assessment of prevalence, incidence, and outcomes. Hepatology 2016, 64, 73–84. [Google Scholar] [CrossRef] [Green Version]
- Noureddin, M.; Vipani, A.; Bresee, C.; Todo, T.; Kim, I.K.; Alkhouri, N.; Setiawan, V.W.; Tran, T.; Ayoub, W.S.; Lu, S.C.; et al. NASH Leading Cause of Liver Transplant in Women: Updated Analysis of Indications For Liver Transplant and Ethnic and Gender Variances. Am. J. Gastroenterol. 2018, 113, 1649–1659. [Google Scholar] [CrossRef]
- Wong, R.J.; Aguilar, M.; Cheung, R.; Perumpail, R.B.; Harrison, S.A.; Younossi, Z.M.; Ahmed, A. Nonalcoholic steatohepatitis is the second leading etiology of liver disease among adults awaiting liver transplantation in the United States. Gastroenterology 2015, 148, 547–555. [Google Scholar] [CrossRef]
- Vilar-Gomez, E.; Martinez-Perez, Y.; Calzadilla-Bertot, L.; Torres-Gonzalez, A.; Gra-Oramas, B.; Gonzalez-Fabian, L.; Friedman, S.L.; Diago, M.; Romero-Gomez, M. Weight Loss Through Lifestyle Modification Significantly Reduces Features of Nonalcoholic Steatohepatitis. Gastroenterology 2015, 149, 367–378.e5. [Google Scholar] [CrossRef] [PubMed]
- van der Windt, D.J.; Sud, V.; Zhang, H.; Tsung, A.; Huang, H. The Effects of Physical Exercise on Fatty Liver Disease. Gene Expr. 2018, 18, 89–101. [Google Scholar] [CrossRef] [Green Version]
- Patel, N.S.; Doycheva, I.; Peterson, M.R.; Hooker, J.; Kisselva, T.; Schnabl, B.; Seki, E.; Sirlin, C.B.; Loomba, R. Effect of weight loss on magnetic resonance imaging estimation of liver fat and volume in patients with nonalcoholic steatohepatitis. Clin. Gastroenterol. Hepatol. 2015, 13, 561–568.e1. [Google Scholar] [CrossRef] [Green Version]
- Musso, G.; Cassader, M.; Rosina, F.; Gambino, R. Impact of current treatments on liver disease, glucose metabolism and cardiovascular risk in non-alcoholic fatty liver disease (NAFLD): A systematic review and meta-analysis of randomised trials. Diabetologia 2012, 55, 885–904. [Google Scholar] [CrossRef] [Green Version]
- Matteoni, C.A.; Younossi, Z.M.; Gramlich, T.; Boparai, N.; Liu, Y.C.; McCullough, A.J. Nonalcoholic fatty liver disease: A spectrum of clinical and pathological severity. Gastroenterology 1999, 116, 1413–1419. [Google Scholar] [CrossRef] [PubMed]
- Angulo, P.; Kleiner, D.E.; Dam-Larsen, S.; Adams, L.A.; Bjornsson, E.S.; Charatcharoenwitthaya, P.; Mills, P.R.; Keach, J.C.; Lafferty, H.D.; Stahler, A.; et al. Liver Fibrosis, but No Other Histologic Features, Is Associated With Long-term Outcomes of Patients With Nonalcoholic Fatty Liver Disease. Gastroenterology 2015, 149, 389–397.e10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ekstedt, M.; Hagstrom, H.; Nasr, P.; Fredrikson, M.; Stal, P.; Kechagias, S.; Hultcrantz, R. Fibrosis stage is the strongest predictor for disease-specific mortality in NAFLD after up to 33 years of follow-up. Hepatology 2015, 61, 1547–1554. [Google Scholar] [CrossRef] [PubMed]
- Vilar-Gomez, E.; Calzadilla-Bertot, L.; Wai-Sun Wong, V.; Castellanos, M.; Aller-de la Fuente, R.; Metwally, M.; Eslam, M.; Gonzalez-Fabian, L.; Alvarez-Quinones Sanz, M.; Conde-Martin, A.F.; et al. Fibrosis Severity as a Determinant of Cause-Specific Mortality in Patients With Advanced Nonalcoholic Fatty Liver Disease: A Multi-National Cohort Study. Gastroenterology 2018, 155, 443–457.e17. [Google Scholar] [CrossRef] [PubMed]
- Schwabe, R.F.; Tabas, I.; Pajvani, U.B. Mechanisms of Fibrosis Development in Nonalcoholic Steatohepatitis. Gastroenterology 2020, 158, 1913–1928. [Google Scholar] [CrossRef]
- Heyens, L.J.M.; Busschots, D.; Koek, G.H.; Robaeys, G.; Francque, S. Liver Fibrosis in Non-alcoholic Fatty Liver Disease: From Liver Biopsy to Non-invasive Biomarkers in Diagnosis and Treatment. Front. Med. 2021, 8, 615978. [Google Scholar] [CrossRef]
- Huisman, T.M.; Dieterich, D.T.; Friedman, S.L. Experimental and Investigational Targeted Therapies for the Management of Fibrosis in NASH: An Update. J. Exp. Pharmacol. 2021, 13, 329–338. [Google Scholar] [CrossRef]
- Tsuchida, T.; Friedman, S.L. Mechanisms of hepatic stellate cell activation. Nat. Rev. Gastroenterol. Hepatol. 2017, 14, 397–411. [Google Scholar] [CrossRef]
- Mendez-Sanchez, N.; Valencia-Rodriguez, A.; Coronel-Castillo, C.; Vera-Barajas, A.; Contreras-Carmona, J.; Ponciano-Rodriguez, G.; Zamora-Valdes, D. The cellular pathways of liver fibrosis in non-alcoholic steatohepatitis. Ann. Transl. Med. 2020, 8, 400. [Google Scholar] [CrossRef]
- Marcher, A.B.; Bendixen, S.M.; Terkelsen, M.K.; Hohmann, S.S.; Hansen, M.H.; Larsen, B.D.; Mandrup, S.; Dimke, H.; Detlefsen, S.; Ravnskjaer, K. Transcriptional regulation of Hepatic Stellate Cell activation in NASH. Sci. Rep. 2019, 9, 2324. [Google Scholar] [CrossRef] [Green Version]
- Gressner, O.A.; Gressner, A.M. Connective tissue growth factor: A fibrogenic master switch in fibrotic liver diseases. Liver Int. 2008, 28, 1065–1079. [Google Scholar] [CrossRef] [PubMed]
- Ramazani, Y.; Knops, N.; Elmonem, M.A.; Nguyen, T.Q.; Arcolino, F.O.; van den Heuvel, L.; Levtchenko, E.; Kuypers, D.; Goldschmeding, R. Connective tissue growth factor (CTGF) from basics to clinics. Matrix Biol. 2018, 68–69, 44–66. [Google Scholar] [CrossRef] [PubMed]
- Perbal, B.; Tweedie, S.; Bruford, E. The official unified nomenclature adopted by the HGNC calls for the use of the acronyms, CCN1-6, and discontinuation in the use of CYR61, CTGF, NOV and WISP 1-3 respectively. J. Cell Commun. Signal. 2018, 12, 625–629. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Williams, E.J.; Gaca, M.D.; Brigstock, D.R.; Arthur, M.J.; Benyon, R.C. Increased expression of connective tissue growth factor in fibrotic human liver and in activated hepatic stellate cells. J. Hepatol. 2000, 32, 754–761. [Google Scholar] [CrossRef] [PubMed]
- Huang, G.; Brigstock, D.R. Integrin expression and function in the response of primary culture hepatic stellate cells to connective tissue growth factor (CCN2). J. Cell. Mol. Med. 2011, 15, 1087–1095. [Google Scholar] [CrossRef] [PubMed]
- Sakai, K.; Jawaid, S.; Sasaki, T.; Bou-Gharios, G.; Sakai, T. Transforming growth factor-beta-independent role of connective tissue growth factor in the development of liver fibrosis. Am. J. Pathol. 2014, 184, 2611–2617. [Google Scholar] [CrossRef] [PubMed]
- Shi, C.; Li, G.; Tong, Y.; Deng, Y.; Fan, J. Role of CTGF gene promoter methylation in the development of hepatic fibrosis. Am. J. Transl. Res. 2016, 8, 125–132. [Google Scholar]
- Huang, G.; Brigstock, D.R. Regulation of hepatic stellate cells by connective tissue growth factor. Front. Biosci. 2012, 17, 2495–2507. [Google Scholar] [CrossRef] [Green Version]
- Leask, A.; Chen, S.; Pala, D.; Brigstock, D.R. Regulation of CCN2 mRNA expression and promoter activity in activated hepatic stellate cells. J. Cell Commun. Signal. 2008, 2, 49–56. [Google Scholar] [CrossRef] [Green Version]
- Gao, R.; Ball, D.K.; Perbal, B.; Brigstock, D.R. Connective tissue growth factor induces c-fos gene activation and cell proliferation through p44/42 MAP kinase in primary rat hepatic stellate cells. J. Hepatol. 2004, 40, 431–438. [Google Scholar] [CrossRef]
- Gao, R.; Brigstock, D.R. Connective tissue growth factor (CCN2) induces adhesion of rat activated hepatic stellate cells by binding of its C-terminal domain to integrin alpha(v)beta(3) and heparan sulfate proteoglycan. J. Biol. Chem. 2004, 279, 8848–8855. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rachfal, A.W.; Brigstock, D.R. Connective tissue growth factor (CTGF/CCN2) in hepatic fibrosis. Hepatol. Res. 2003, 26, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Abou-Shady, M.; Friess, H.; Zimmermann, A.; di Mola, F.F.; Guo, X.Z.; Baer, H.U.; Buchler, M.W. Connective tissue growth factor in human liver cirrhosis. Liver 2000, 20, 296–304. [Google Scholar] [CrossRef]
- Paradis, V.; Dargere, D.; Vidaud, M.; De Gouville, A.C.; Huet, S.; Martinez, V.; Gauthier, J.M.; Ba, N.; Sobesky, R.; Ratziu, V.; et al. Expression of connective tissue growth factor in experimental rat and human liver fibrosis. Hepatology 1999, 30, 968–976. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Charrier, A.L.; Leask, A.; French, S.W.; Brigstock, D.R. Ethanol-stimulated differentiated functions of human or mouse hepatic stellate cells are mediated by connective tissue growth factor. J. Hepatol. 2011, 55, 399–406. [Google Scholar] [CrossRef] [Green Version]
- Tong, Z.; Chen, R.; Alt, D.S.; Kemper, S.; Perbal, B.; Brigstock, D.R. Susceptibility to liver fibrosis in mice expressing a connective tissue growth factor transgene in hepatocytes. Hepatology 2009, 50, 939–947. [Google Scholar] [CrossRef] [Green Version]
- Brigstock, D.R. Strategies for blocking the fibrogenic actions of connective tissue growth factor (CCN2): From pharmacological inhibition in vitro to targeted siRNA therapy in vivo. J. Cell Commun. Signal. 2009, 3, 5–18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gao, R.P.; Brigstock, D.R. Connective tissue growth factor hammerhead ribozyme attenuates human hepatic stellate cell function. World J. Gastroenterol. 2009, 15, 3807–3813. [Google Scholar] [CrossRef]
- George, J.; Tsutsumi, M. siRNA-mediated knockdown of connective tissue growth factor prevents N-nitrosodimethylamine-induced hepatic fibrosis in rats. Gene Ther. 2007, 14, 790–803. [Google Scholar] [CrossRef] [PubMed]
- Li, G.; Li, D.; Xie, Q.; Shi, Y.; Jiang, S.; Jin, Y. RNA interfering connective tissue growth factor prevents rat hepatic stellate cell activation and extracellular matrix production. J. Gene Med. 2008, 10, 1039–1047. [Google Scholar] [CrossRef]
- Hao, C.; Xie, Y.; Peng, M.; Ma, L.; Zhou, Y.; Zhang, Y.; Kang, W.; Wang, J.; Bai, X.; Wang, P.; et al. Inhibition of connective tissue growth factor suppresses hepatic stellate cell activation in vitro and prevents liver fibrosis in vivo. Clin. Exp. Med. 2014, 14, 141–150. [Google Scholar] [CrossRef] [PubMed]
- Moylan, C.A.; Pang, H.; Dellinger, A.; Suzuki, A.; Garrett, M.E.; Guy, C.D.; Murphy, S.K.; Ashley-Koch, A.E.; Choi, S.S.; Michelotti, G.A.; et al. Hepatic gene expression profiles differentiate presymptomatic patients with mild versus severe nonalcoholic fatty liver disease. Hepatology 2014, 59, 471–482. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Murphy, S.K.; Yang, H.; Moylan, C.A.; Pang, H.; Dellinger, A.; Abdelmalek, M.F.; Garrett, M.E.; Ashley-Koch, A.; Suzuki, A.; Tillmann, H.L.; et al. Relationship between methylome and transcriptome in patients with nonalcoholic fatty liver disease. Gastroenterology 2013, 145, 1076–1087. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wei, G.; An, P.; Vaid, K.A.; Nasser, I.; Huang, P.; Tan, L.; Zhao, S.; Schuppan, D.; Popov, Y.V. Comparison of murine steatohepatitis models identifies a dietary intervention with robust fibrosis, ductular reaction, and rapid progression to cirrhosis and cancer. Am. J. Physiol. Gastrointest. Liver Physiol. 2020, 318, G174–G188. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Trampuz, S.R.; van Riet, S.; Nordling, A.; Ingelman-Sundberg, M. The Role of CTGF in Liver Fibrosis Induced in 3D Human Liver Spheroids. Cells 2023, 12, 302. [Google Scholar] [CrossRef]
- Koenen, M.T.; Brandt, E.F.; Kaczor, D.M.; Caspers, T.; Heinzmann, A.C.A.; Fischer, P.; Heinrichs, D.; Wirtz, T.H.; Trautwein, C.; Koenen, R.R.; et al. Extracellular Vesicles from Steatotic Hepatocytes Provoke Pro-Fibrotic Responses in Cultured Stellate Cells. Biomolecules 2022, 12, 698. [Google Scholar] [CrossRef]
- Lee, Y.S.; Kim, S.Y.; Ko, E.; Lee, J.H.; Yi, H.S.; Yoo, Y.J.; Je, J.; Suh, S.J.; Jung, Y.K.; Kim, J.H.; et al. Exosomes derived from palmitic acid-treated hepatocytes induce fibrotic activation of hepatic stellate cells. Sci. Rep. 2017, 7, 3710. [Google Scholar] [CrossRef] [Green Version]
- Povero, D.; Panera, N.; Eguchi, A.; Johnson, C.D.; Papouchado, B.G.; de Araujo Horcel, L.; Pinatel, E.M.; Alisi, A.; Nobili, V.; Feldstein, A.E. Lipid-induced hepatocyte-derived extracellular vesicles regulate hepatic stellate cell via microRNAs targeting PPAR-gamma. Cell. Mol. Gastroenterol. Hepatol. 2015, 1, 646–663.e4. [Google Scholar] [CrossRef] [Green Version]
- Garcia-Martinez, I.; Alen, R.; Pereira, L.; Povo-Retana, A.; Astudillo, A.M.; Hitos, A.B.; Gomez-Hurtado, I.; Lopez-Collazo, E.; Bosca, L.; Frances, R.; et al. Saturated fatty acid-enriched small extracellular vesicles mediate a crosstalk inducing liver inflammation and hepatocyte insulin resistance. JHEP Rep. 2023, 5, 100756. [Google Scholar] [CrossRef]
- Gao, R.; Brigstock, D.R. Low density lipoprotein receptor-related protein (LRP) is a heparin-dependent adhesion receptor for connective tissue growth factor (CTGF) in rat activated hepatic stellate cells. Hepatol. Res. 2003, 27, 214–220. [Google Scholar] [CrossRef]
- Paradis, V.; Perlemuter, G.; Bonvoust, F.; Dargere, D.; Parfait, B.; Vidaud, M.; Conti, M.; Huet, S.; Ba, N.; Buffet, C.; et al. High glucose and hyperinsulinemia stimulate connective tissue growth factor expression: A potential mechanism involved in progression to fibrosis in nonalcoholic steatohepatitis. Hepatology 2001, 34, 738–744. [Google Scholar] [CrossRef] [PubMed]
- Nan, Y.M.; Fu, N.; Wu, W.J.; Liang, B.L.; Wang, R.Q.; Zhao, S.X.; Zhao, J.M.; Yu, J. Rosiglitazone prevents nutritional fibrosis and steatohepatitis in mice. Scand. J. Gastroenterol. 2009, 44, 358–365. [Google Scholar] [CrossRef]
- Walter, R.; Wanninger, J.; Bauer, S.; Eisinger, K.; Neumeier, M.; Weiss, T.S.; Amann, T.; Hellerbrand, C.; Schaffler, A.; Scholmerich, J.; et al. Adiponectin reduces connective tissue growth factor in human hepatocytes which is already induced in non-fibrotic non-alcoholic steatohepatitis. Exp. Mol. Pathol. 2011, 91, 740–744. [Google Scholar] [CrossRef] [PubMed]
- Wanninger, J.; Neumeier, M.; Bauer, S.; Weiss, T.S.; Eisinger, K.; Walter, R.; Dorn, C.; Hellerbrand, C.; Schaffler, A.; Buechler, C. Adiponectin induces the transforming growth factor decoy receptor BAMBI in human hepatocytes. FEBS Lett. 2011, 585, 1338–1344. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bugianesi, E.; Pagotto, U.; Manini, R.; Vanni, E.; Gastaldelli, A.; de Iasio, R.; Gentilcore, E.; Natale, S.; Cassader, M.; Rizzetto, M.; et al. Plasma adiponectin in nonalcoholic fatty liver is related to hepatic insulin resistance and hepatic fat content, not to liver disease severity. J. Clin. Endocrinol. Metab. 2005, 90, 3498–3504. [Google Scholar] [CrossRef] [PubMed]
- Pagano, C.; Soardo, G.; Esposito, W.; Fallo, F.; Basan, L.; Donnini, D.; Federspil, G.; Sechi, L.A.; Vettor, R. Plasma adiponectin is decreased in nonalcoholic fatty liver disease. Eur. J. Endocrinol. 2005, 152, 113–118. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vuppalanchi, R.; Marri, S.; Kolwankar, D.; Considine, R.V.; Chalasani, N. Is adiponectin involved in the pathogenesis of nonalcoholic steatohepatitis? A preliminary human study. J. Clin. Gastroenterol. 2005, 39, 237–242. [Google Scholar] [CrossRef]
- Schaffler, A.; Scholmerich, J.; Buchler, C. Mechanisms of disease: Adipocytokines and visceral adipose tissue--emerging role in nonalcoholic fatty liver disease. Nat. Clin. Pract. Gastroenterol. Hepatol. 2005, 2, 273–280. [Google Scholar] [CrossRef]
- Uribe, M.; Zamora-Valdes, D.; Moreno-Portillo, M.; Bermejo-Martinez, L.; Pichardo-Bahena, R.; Baptista-Gonzalez, H.A.; Ponciano-Rodriguez, G.; Uribe, M.H.; Medina-Santillan, R.; Mendez-Sanchez, N. Hepatic expression of ghrelin and adiponectin and their receptors in patients with nonalcoholic fatty liver disease. Ann. Hepatol. 2008, 7, 67–71. [Google Scholar] [CrossRef]
- Nannipieri, M.; Cecchetti, F.; Anselmino, M.; Mancini, E.; Marchetti, G.; Bonotti, A.; Baldi, S.; Solito, B.; Giannetti, M.; Pinchera, A.; et al. Pattern of expression of adiponectin receptors in human liver and its relation to nonalcoholic steatohepatitis. Obes. Surg. 2009, 19, 467–474. [Google Scholar] [CrossRef]
- Kaser, S.; Ebenbichler, C.F.; Tilg, H. Pharmacological and non-pharmacological treatment of non-alcoholic fatty liver disease. Int. J. Clin. Pract. 2010, 64, 968–983. [Google Scholar] [CrossRef] [PubMed]
- Brigstock, D.R. Connective tissue growth factor (CCN2, CTGF) and organ fibrosis: Lessons from transgenic animals. J. Cell Commun. Signal. 2010, 4, 1–4. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, P.; Luo, Q.; Huang, C.; Gao, Q.; Li, L.; Chen, J.; Chen, B.; Liu, W.; Zeng, W.; Chen, Z. Pathogenesis of non-alcoholic fatty liver disease mediated by YAP. Hepatol. Int. 2018, 12, 26–36. [Google Scholar] [CrossRef]
- Sato, W.; Horie, Y.; Kataoka, E.; Ohshima, S.; Dohmen, T.; Iizuka, M.; Sasaki, J.; Sasaki, T.; Hamada, K.; Kishimoto, H.; et al. Hepatic gene expression in hepatocyte-specific Pten deficient mice showing steatohepatitis without ethanol challenge. Hepatol. Res. 2006, 34, 256–265. [Google Scholar] [CrossRef] [PubMed]
- Lo, L.; McLennan, S.V.; Williams, P.F.; Bonner, J.; Chowdhury, S.; McCaughan, G.W.; Gorrell, M.D.; Yue, D.K.; Twigg, S.M. Diabetes is a progression factor for hepatic fibrosis in a high fat fed mouse obesity model of non-alcoholic steatohepatitis. J. Hepatol. 2011, 55, 435–444. [Google Scholar] [CrossRef] [PubMed]
- Farrell, G.C.; Mridha, A.R.; Yeh, M.M.; Arsov, T.; Van Rooyen, D.M.; Brooling, J.; Nguyen, T.; Heydet, D.; Delghingaro-Augusto, V.; Nolan, C.J.; et al. Strain dependence of diet-induced NASH and liver fibrosis in obese mice is linked to diabetes and inflammatory phenotype. Liver Int. 2014, 34, 1084–1093. [Google Scholar] [CrossRef] [PubMed]
- Tahan, V.; Eren, F.; Avsar, E.; Yavuz, D.; Yuksel, M.; Emekli, E.; Imeryuz, N.; Celikel, C.; Uzun, H.; Haklar, G.; et al. Rosiglitazone attenuates liver inflammation in a rat model of nonalcoholic steatohepatitis. Dig. Dis. Sci. 2007, 52, 3465–3472. [Google Scholar] [CrossRef]
- Ratziu, V.; Giral, P.; Jacqueminet, S.; Charlotte, F.; Hartemann-Heurtier, A.; Serfaty, L.; Podevin, P.; Lacorte, J.M.; Bernhardt, C.; Bruckert, E.; et al. Rosiglitazone for nonalcoholic steatohepatitis: One-year results of the randomized placebo-controlled Fatty Liver Improvement with Rosiglitazone Therapy (FLIRT) Trial. Gastroenterology 2008, 135, 100–110. [Google Scholar] [CrossRef]
- Marcolin, E.; San-Miguel, B.; Vallejo, D.; Tieppo, J.; Marroni, N.; Gonzalez-Gallego, J.; Tunon, M.J. Quercetin treatment ameliorates inflammation and fibrosis in mice with nonalcoholic steatohepatitis. J. Nutr. 2012, 142, 1821–1828. [Google Scholar] [CrossRef] [Green Version]
- Vargas-Pozada, E.E.; Ramos-Tovar, E.; Acero-Hernandez, C.; Cardoso-Lezama, I.; Galindo-Gomez, S.; Tsutsumi, V.; Muriel, P. Caffeine mitigates experimental nonalcoholic steatohepatitis and the progression of thioacetamide-induced liver fibrosis by blocking the MAPK and TGF-beta/Smad3 signaling pathways. Ann. Hepatol. 2022, 27, 100671. [Google Scholar] [CrossRef]
- Colak, Y.; Senates, E.; Coskunpinar, E.; Oltulu, Y.M.; Zemheri, E.; Ozturk, O.; Doganay, L.; Mesci, B.; Yilmaz, Y.; Enc, F.Y.; et al. Concentrations of connective tissue growth factor in patients with nonalcoholic fatty liver disease: Association with liver fibrosis. Dis. Markers 2012, 33, 77–83. [Google Scholar] [CrossRef]
- Yang, D.J.; Shi, J.H.; Xia, Z.P.; Guo, W.Z.; Ahmed, M.S.; Zhang, S.J. Hepatic connective tissue growth factor expression and regulation differ between non-steatotic and non-alcoholic steatotic livers from brain-dead donor. Sci. Rep. 2021, 11, 3857. [Google Scholar] [CrossRef]
- Ren, J.; Wang, X.; Parry, S.N.; Yee, C.; Gorrell, M.D.; McLennan, S.V.; Twigg, S.M. Targeting CCN2 protects against progressive non-alcoholic steatohepatitis in a preclinical model induced by high-fat feeding and type 2 diabetes. J. Cell Commun. Signal. 2022, 16, 447–460. [Google Scholar] [CrossRef]
- Riser, B.L.; Najmabadi, F.; Perbal, B.; Peterson, D.R.; Rambow, J.A.; Riser, M.L.; Sukowski, E.; Yeger, H.; Riser, S.C. CCN3 (NOV) is a negative regulator of CCN2 (CTGF) and a novel endogenous inhibitor of the fibrotic pathway in an in vitro model of renal disease. Am. J. Pathol. 2009, 174, 1725–1734. [Google Scholar] [CrossRef] [Green Version]
- Kubota, S.; Kawata, K.; Hattori, T.; Nishida, T. Molecular and Genetic Interactions between CCN2 and CCN3 behind Their Yin-Yang Collaboration. Int. J. Mol. Sci. 2022, 23, 5887. [Google Scholar] [CrossRef]
- Charrier, A.; Chen, R.; Kemper, S.; Brigstock, D.R. Regulation of pancreatic inflammation by connective tissue growth factor (CTGF/CCN2). Immunology 2014, 141, 564–576. [Google Scholar] [CrossRef] [Green Version]
- Romer, A.; Rawat, D.; Linn, T.; Petry, S.F. Preparation of fatty acid solutions exerts significant impact on experimental outcomes in cell culture models of lipotoxicity. Biol. Methods Protoc. 2022, 7, bpab023. [Google Scholar] [CrossRef]
- Li, X.; Chen, R.; Kemper, S.; Brigstock, D.R. Structural and Functional Characterization of Fibronectin in Extracellular Vesicles From Hepatocytes. Front. Cell. Dev. Biol. 2021, 9, 640667. [Google Scholar] [CrossRef]
- Li, X.; Chen, R.; Kemper, S.; Brigstock, D.R. Dynamic Changes in Function and Proteomic Composition of Extracellular Vesicles from Hepatic Stellate Cells during Cellular Activation. Cells 2020, 9, 290. [Google Scholar] [CrossRef] [Green Version]
Gene ID | Accession No. | Primer | Length (bp) | |
---|---|---|---|---|
Fwd Seq (5′-3′) | Rev Seq (5′-3′) | |||
CCN2 (mouse) | NM_010217 | CACTCTGCCAGTGGAGTTCA | AAGATGTCATTGTCCCCAGG | 111 |
Col1A1 (mouse) | NM_007742 | GCCCGAACCCCAAGGAAAAGAAGC | CTGGGAGGCCTCGGTGGACATTAG | 148 |
GAPDH (human and mouse) | TGCACCACCAACTGCTTAGC | GGCATGGACTGTGGTCATGAG | 87 | |
Col3A1 (mouse) | NM_009930 | GCCCACAGCCTTCTACACCT | GCCAGGGTCACCATTTCTC | 110 |
αSMA (mouse) | NM_007392 | GGCTCTGGGCTCTGTAAGG | CTCTTGCTCTGGGCTTCATC | 148 |
CCN2 (human) | NM_001901 | AAAAGTGCATCCGTACTCCCA | CCGTCGGTACATACTCCACAG | 109 |
Col1A1 (human) | NM_000088 | GAACGCGTGTCATCCCTTGT | GAACGAGGTAGTCTTTCAGCAACA | 91 |
αSMA (human) | NM_001613 | GTGTTGCCCCTGAAGAGCAT | GCTGGGACATTGAAAGTCTCA | 109 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, X.; Chen, R.; Kemper, S.; Brigstock, D.R. Production, Exacerbating Effect, and EV-Mediated Transcription of Hepatic CCN2 in NASH: Implications for Diagnosis and Therapy of NASH Fibrosis. Int. J. Mol. Sci. 2023, 24, 12823. https://doi.org/10.3390/ijms241612823
Li X, Chen R, Kemper S, Brigstock DR. Production, Exacerbating Effect, and EV-Mediated Transcription of Hepatic CCN2 in NASH: Implications for Diagnosis and Therapy of NASH Fibrosis. International Journal of Molecular Sciences. 2023; 24(16):12823. https://doi.org/10.3390/ijms241612823
Chicago/Turabian StyleLi, Xinlei, Ruju Chen, Sherri Kemper, and David R. Brigstock. 2023. "Production, Exacerbating Effect, and EV-Mediated Transcription of Hepatic CCN2 in NASH: Implications for Diagnosis and Therapy of NASH Fibrosis" International Journal of Molecular Sciences 24, no. 16: 12823. https://doi.org/10.3390/ijms241612823