The Effect of Prohibitins on Mitochondrial Function during Octopus tankahkeei Spermiogenesis
Abstract
:1. Introduction
2. Results
2.1. Biological Function Analysis of the Ot-phb1 Gene
2.2. Biological Function Analysis of the Ot-phb2 Gene
2.3. Tissue Expression Analysis of PHBs
2.4. Ot-PHB1 and Ot-PHB2 Function as a PHB Complex during O. tankahkeei Spermiogenesis
2.5. The Relationship between Ot-PHBs and Mitochondria in the Spermiogenesis of O. tankahkeei
2.6. The Relationship between Ot-PHBs and Polyubiquitin in the Spermiogenesis of O. tankahkeei
2.7. Detection of phb1 RNAi Efficiency
2.8. Effect of phb1 Knockdown on ROS Levels
2.9. Effect of phb1 Knockdown on mtDNA Content
2.10. Effect of phb1 Knockdown on Apoptosis-Related Genes
3. Materials and Methods
3.1. Animals and Tissues
3.2. RNA and Protein Extraction and Reverse Transcription
3.3. Full-Length Complementary Acquisition and Sequence Analyses of Ot-phbs
3.4. Quantitative Analysis of phb mRNA Expression in Different Tissues of O. tankahkeei
3.5. Antibodies
3.6. Western Blotting
3.7. Immunofluorescence
3.8. RNA Interference
3.9. Effects of phb1 Knockdown on mtDNA Content
3.10. Effect of phb1 Knockdown on mRNA Expression of Apoptosis-Related Genes
3.11. Effect of phb1 Knockdown on ROS Level
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Osman, C.; Haag, M.; Potting, C.; Rodenfels, J.; Dip, V.P.; Wieland, F.T.; Brügger, B.; Westermann, B.; Langer, T. The genetic interactome of prohibitins: Coordinated control of cardiolipin and phosphatidylethanolamine by conserved regulators in mitochondria. J. Cell Biol. 2009, 184, 583–596. [Google Scholar] [CrossRef] [Green Version]
- Tatsuta, T.; Model, K.; Langer, T. Formation of membrane-bound ring complexes by prohibitins in mitochondria. Mol. Biol. Cell 2005, 16, 248–259. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Osman, C.; Merkwirth, C.; Langer, T. Prohibitins and the functional compartmentalization of mitochondrial membranes. J. Cell Sci. 2009, 122, 3823–3830. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Back, J.W.; Sanz, M.A.; Jong, L.D.; de Koning, L.J.; Muijsers, A.O. A structure for the yeast prohibitin complex: Structure prediction and evidence from chemical crosslinking and mass spectrometry. Protein Sci. 2002, 11, 2471–2478. [Google Scholar] [CrossRef] [Green Version]
- Steglich, G.; Neupert, W.; Langer, T. Prohibitins regulate membrane protein degradation by the m-AAA protease in mitochondria. Mol. Cell. Biol. 1999, 19, 3435–3442. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kasashima, K.; Sumitani, M.; Satoh, M.; Endo, H. Human prohibitin 1 maintains the organization and stability of the mitochondrial nucleoids. Exp. Cell Res. 2008, 314, 988–996. [Google Scholar] [CrossRef]
- Ye, J.; Li, J.; Xia, R.; Zhou, M.; Yu, L. Prohibitin protects proximal tubule epithelial cells against oxidative injury through mitochondrial pathways. Free Radic. Res. 2015, 49, 1393–1403. [Google Scholar] [CrossRef]
- Merkwirth, C.; Dargazanli, S.; Tatsuta, T.; Dargazanli, S.; Tatsuta, T.; Geimer, S.; Löwer, B.; Wunderlich, F.T.; Kleist-Retzow, J.C.; Waisman, A.; et al. Prohibitins control cell proliferation and apoptosis by regulating OPA1-dependent cristae morphogenesis in mitochondria. Genes Dev. 2008, 22, 476–488. [Google Scholar] [CrossRef] [Green Version]
- Xu, Y.R.; Fan, Y.S.; Yang, W.X. Mitochondrial prohibitin and its ubiquitination during spermatogenesis of the swimming crab Charybdis japonica. Gene 2017, 627, 137–148. [Google Scholar] [CrossRef]
- Ma, D.D.; Pan, M.Y.; Hou, C.C.; Tan, F.Q.; Yang, W.X. KIFC1 and myosin Va: Two motors for acrosomal biogenesis and nuclear shaping during spermiogenesis of Portunus trituberculatus. Cell Tissue Res. 2017, 369, 625–640. [Google Scholar] [CrossRef]
- Amaral, A.; Lourenco, B.; Marques, M.; Ramalho-Santos, J. Mitochondria functionality and sperm quality. Reproduction 2013, 146, R163–R174. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Calvo, S.E.; Mootha, V.K. The mitochondrial proteome and human disease. Annu. Rev. Genom. Hum. Genet. 2010, 11, 25–44. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rajender, S.; Rahul, P.; Mahdi, A.A. Mitochondria, spermatogenesis and male infertility. Mitochondrion 2010, 10, 419–428. [Google Scholar] [CrossRef] [PubMed]
- Chai, R.R.; Chen, G.W.; Shi, H.J.; O, W.S.; Martin-DeLeon, P.A.; Chen, H. Prohibitin involvement in the generation of mitochondrial superoxide at complex I in human sperm. J. Cell. Mol. Med. 2017, 21, 121–129. [Google Scholar] [CrossRef] [PubMed]
- Pelliccione, F.; Micillo, A.; Cordeschi, G.; D’Angeli, A.; Necozione, S.; Gandini, L.; Lenzi, A.; Francavilla, F.; Francavilla, S. Altered ultrastructure of mitochondrial membranes is strongly associated with unexplained asthenozoospermia. Fertil. Steril. 2011, 95, 641–646. [Google Scholar] [CrossRef] [PubMed]
- Mao, H.T.; Wang, D.H.; Zhou, H.; Yang, W.X. Characterization and expression analysis of prohibitin in the testis of Chinese mitten crab Eriocheir sinensis. Mol. Biol. Rep. 2012, 39, 7031–7039. [Google Scholar] [CrossRef]
- Wang, D.; Zhao, Y.Q.; Han, Y.L.; Hou, C.C.; Zhu, J.Q. Characterization of mitochondrial prohibitin from Boleophthalmus pectinirostris and evaluation of its possible role in spermatogenesis. Fish Physiol. Biochem. 2017, 43, 1299–1313. [Google Scholar] [CrossRef]
- Hu, J.R.; Liu, M.; Wang, D.H.; Hu, Y.J.; Tan, F.Q.; Yang, W.X. Molecular characterization and expression analysis of a KIFC1-like kinesin gene in the testis of Eumeces chinensis. Mol. Biol. Rep. 2013, 40, 6645–6655. [Google Scholar] [CrossRef]
- Sanz, M.A.; Tsang, W.Y.; Willems, E.M.; Grivell, L.A.; Lemire, B.D.; van der Spek, H.; Nijtmans, L.G. The mitochondrial prohibitin complex is essential for embryonic viability and germline function in Caenorhabditis elegans. J. Biol. Chem. 2003, 278, 32091–32099. [Google Scholar] [CrossRef] [Green Version]
- Zhu, J.Q.; Wang, W.; Xu, S.J. Ultrastructure of spermatogenesis of Octopus tankahkeei. J. Fish China 2007, 4, 733–741. [Google Scholar]
- Wang, J.; Liu, Z.; Gao, X.; Du, C.; Hou, C.; Tang, D.; Lou, B.; Shen, W.; Zhu, J. The potential function of KIF17 in large yellow croaker (Larimichthys crocea) spermatid remodeling: Molecular characterization and expression pattern during spermiogenesis. Fish Physiol. Biochem. 2022, 48, 603–616. [Google Scholar] [CrossRef] [PubMed]
- Hou, C.C.; Gao, X.M.; Ni, J.; Mu, D.L.; Yang, H.Y.; Liu, C.; Zhu, J.Q. The expression pattern and potential functions of PHB in the spermiogenesis of Phascolosoma esculenta. Gene 2018, 652, 25–38. [Google Scholar] [CrossRef] [PubMed]
- Long, L.L.; Han, Y.L.; Sheng, Z.; Du, C.; Wang, Y.F.; Zhu, J.Q. Expression analysis of HSP70 in the testis of Octopus tankahkeei under thermal stress. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2015, 187, 150–159. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Zhu, J.Q.; Yang, W.X. Molecular cloning and characterization of KIFC1-like kinesin gene (ot-kifc1) from Octopus tankahkeei. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2010, 156, 174–182. [Google Scholar] [CrossRef] [PubMed]
- Winter, A.; Kämäräinen, O.; Hofmann, A. Molecular modeling of prohibitin domains. Proteins Struct. Funct. Bioinform. 2007, 68, 353–362. [Google Scholar] [CrossRef]
- Sutovsky, P. Ubiquitin-dependent proteolysis in mammalian spermatogenesis, fertilization, and sperm quality control: Killing three birds with one stone. Microsc. Res. Tech. 2003, 6, 88–102. [Google Scholar] [CrossRef]
- Fang, D.A.; Wang, Y.; Wang, J.; Liu, L.H.; Wang, Q. Characterization of Cherax quadricarinatus prohibitin and its potential role in spermatogenesis. Gene 2013, 519, 318–325. [Google Scholar] [CrossRef]
- Jin, J.M.; Hou, C.C.; Tan, F.Q.; Yang, W.X. The potential function of prohibitin during spermatogenesis in Chinese fire-bellied newt Cynops orientalis. Cell Tissue Res. 2016, 363, 805–822. [Google Scholar] [CrossRef]
- Dong, W.L.; Hou, C.C.; Yang, W.X. Mitochondrial prohibitin and its ubiquitination during crayfish Procambarus clarkii spermiogenesis. Cell Tissue Res. 2015, 359, 679–692. [Google Scholar] [CrossRef]
- Thuaud, F.; Ribeiro, N.; Nebigil, C.G.; Désaubry, L. Prohibitin ligands in cell death and survival: Mode of action and therapeutic potential. Chem. Biol. 2013, 20, 316–331. [Google Scholar] [CrossRef] [Green Version]
- Mishra, S.; Murphy, L.C.; Murphy, L.J. The Prohibitins: Emerging roles in diverse functions. J. Cell. Mol. Med. 2006, 2010, 353–363. [Google Scholar] [CrossRef] [Green Version]
- Bavelloni, A.; Piazzi, M.; Raffini, M.; Faenza, I.; Blalock, W.L. Prohibitin 2: At a communications crossroads. IUBMB Life 2015, 67, 239–254. [Google Scholar] [CrossRef]
- Bogenhagen, D.F.; Rousseau, D.; Burke, S. The layered structure of human mitochondrial DNA nucleoids. J. Biol. Chem. 2008, 283, 3665–3675. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Bogenhagen, D.F. Human Mitochondrial DNA Nucleoids Are Linked to Protein Folding Machinery and Metabolic Enzymes at the Mitochondrial Inner Membrane. J. Biol. Chem. 2006, 281, 25791–25802. [Google Scholar] [CrossRef] [Green Version]
- Zhang, L.F.; Tan-Tai, W.J.; Li, X.H.; Liu, M.F.; Shi, H.J.; Martin-DeLeon, P.A.; O, W.S.; Chen, H. PHB regulates meiotic recombination via JAK2-mediated histone modifications in spermatogenesis. Nucleic Acids Res. 2020, 48, 4780–4796. [Google Scholar] [CrossRef]
- May-Panloup, P. Increased sperm mitochondrial DNA content in male infertility. Hum. Reprod. 2003, 18, 550–556. [Google Scholar] [CrossRef] [Green Version]
- Amaral, A.; Ramalho-Santos, J.; St, J.C. The expression of polymerase gamma and mitochondrial transcription factor A and the regulation of mitochondrial DNA content in mature human sperm. Hum. Reprod. 2007, 22, 1585–1596. [Google Scholar] [CrossRef]
- Nijtmans, L.; Artal, S.M.; Grivell, L.A.; Coates, P.J. The mitochondrial PHB complex: Roles in mitochondrial respiratory complex assembly, ageing and degenerative disease. Cell. Mol. Life Sci. Cmls 2002, 59, 143–155. [Google Scholar] [CrossRef]
- Kang, T.; Lu, W.; Xu, W.; Anderson, L.; Bacanamwo, M.; Thompson, W.; Chen, Y.E.; Liu, D. MicroRNA-27 (miR-27) targets prohibitin and impairs adipocyte differentiation and mitochondrial function in human adipose-derived stem cells. J. Biol. Chem. 2013, 288, 34394–34402. [Google Scholar] [CrossRef] [Green Version]
- Koppers, A.J.; De Iuliis, G.N.; Finnie, J.M.; McLaughlin, E.A.; Aitken, R.J. Significance of mitochondrial reactive oxygen species in the generation of oxidative stress in spermatozoa. J. Clin. Endocrinol. Metab. 2008, 93, 3199–3207. [Google Scholar] [CrossRef] [Green Version]
- Chowdhury, I.; Xu, W.; Stiles, J.K.; Zeleznik, A.; Yao, X.; Matthews, R.; Thomas, K.; Thompson, W.E. Apoptosis of rat granulosa cells after staurosporine and serum withdrawal is suppressed by adenovirus-directed overexpression of prohibitin. Endocrinology 2007, 148, 206–217. [Google Scholar] [CrossRef] [Green Version]
- Chowdhury, I.; Branch, A.; Olatinwo, M.; Thomas, K.; Matthews, R.; Thompson, W.E. Prohibitin (PHB) acts as a potent survival factor against ceramide induced apoptosis in rat granulosa cells. Life Sci. 2011, 89, 295–303. [Google Scholar] [CrossRef] [Green Version]
- Hou, C.C.; Wei, C.G.; Lu, C.P.; Gao, X.M.; Yang, W.X.; Zhu, J.Q. Prohibitin-mediated mitochondrial ubiquitination during spermiogenesis in Chinese mitten crab Eriocheir sinensis. Oncotarget 2017, 8, 98782. [Google Scholar] [CrossRef] [Green Version]
- Sutovsky, P.; Moreno, R.D.; Ramalho-Santos, J.; Dominko, T.; Simerly, C.; Schatten, G. Ubiquitinated sperm mitochondria, selective proteolysis, and the regulation of mitochondrial inheritance in mammalian embryos. Biol. Reprod. 2000, 63, 582–590. [Google Scholar] [CrossRef]
- Escobar-Henriques, M.; Langer, T. Dynamic survey of mitochondria by ubiquitin. EMBO Rep. 2014, 15, 231–243. [Google Scholar] [CrossRef] [Green Version]
Primer | Sequence (5′–3′) | PCR Product Sizes | Purpose |
---|---|---|---|
phb1-F | AAGAAGATGTGATTGGCG | 660 | PCR |
phb1-R | TATTTTGTCCTTGGGGCA | PCR | |
phb2-F1 | GCTTACGCCATTTCCCAGTC | 562 | PCR |
phb2-R1 | GTTCTTGCTTGGCTCTTTCTACA | PCR | |
phb2-F2 | TCAGTGTGCTTATCCGACGAG | 263 | PCR |
phb2-R2 | TCCAGGGTTTTGTGAGATAGCA | PCR | |
phb1,5′RACE-R | CAACAAGACCAAGTCCTATTTTCCCG | >233 | 5′ RACE |
phb1,3′RACE-F1 | TGAACTTCGCAAACTGGA | >115 | 3′ RACE |
phb2,5′RACE-R1 | CACCCGCTCTTCATAATCTAATCCCA | >396 | 5′ RACE |
phb2,5′RACE R2 | CAATCGTCGGTACATGAGAGGCAG | >372 | 5′ RACE |
phb2,3′RACE F1 | CGACGATTGGGATTAGATTATGAAGAGC | >528 | 3′ RACE |
phb2,3′RACE F2 | CGGGTGCTACCATCAATTTGTAACG | >501 | 3′ RACE |
phb1-qPCR-F | GCTTTTGGCTTACTCCTTGA | 151 | qPCR |
phb1-qPCR-R | CAGCCTGTCGGATTTGTTC | qPCR | |
phb2-qPCR-F | AGAAGGGCTACATTTCAGGA | 185 | qPCR |
phb2-qPCR-R | CTAATCCCAATCGTCGGTA | qPCR | |
β-actin-F | CCCATCTATGAAGGTTACGC | 161 | qPCR |
β-actin-R | GAGATTCTGGGCACCTAAAC | qPCR | |
cytb-F | ATTTTGAGGGGCTACGG | 156 | semi-quantitative PCR |
cytb-R | CCCACAATGATAAACGGAA | semi-quantitative PCR | |
tubulin-F | TTTCTCCCCGAGCCAATG | 181 | semi-quantitative PCR |
tubulin-R | GGATACCGCCACAAACCTGAC | semi-quantitative PCR | |
siRNA-phb1-F | GAGGCCAUCAAGCUGUAAUTT | - | RNA interference |
siRNA-phb1-R | AUUACAGCUUGAUGGCCUCTT | RNA interference | |
siRNA-NC-F | UUCUCCGAACGUGUCAGGUTT | - | Negative siRNA |
siRNA-NC-R | ACGUGACACGUUCGGAGAATT | Negative siRNA |
Forecasting Tool | Function | Website |
---|---|---|
The Sequence Manipulation Suite | Analysis and formatting of DNA and protein sequences | http://www.bio-soft.net/sms/; accessed on 1 June 2023 |
COILS | Prediction of coiled-coil regions in proteins | http://www.ch.embnet.org/software/COILS_form.html; accessed on 1 June 2023 |
ExPASy ProtParam | Prediction of molecular weight and isoelectric point in proteins | https://www.expasy.org/; accessed on 1 June 2023 |
TMHMM Server v.2.0 | Prediction the structure of transmembrane domains in proteins | http://www.cbs.dtu.dk/services/TMHMM/; accessed on 1 June 2023 |
The NCBI CD-search tool | Prediction of protein domains | https://blast.ncbi.nlm.nih.gov/Blast.cgi; accessed on 1 June 2023 |
TASSER | Prediction of the tertiary structure in proteins | https://zhanglab.ccmb.med.umich.edu/I-TASSER/; accessed on 1 June 2023 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, J.; Gao, X.; Du, C.; Tang, D.; Hou, C.; Zhu, J. The Effect of Prohibitins on Mitochondrial Function during Octopus tankahkeei Spermiogenesis. Int. J. Mol. Sci. 2023, 24, 10030. https://doi.org/10.3390/ijms241210030
Wang J, Gao X, Du C, Tang D, Hou C, Zhu J. The Effect of Prohibitins on Mitochondrial Function during Octopus tankahkeei Spermiogenesis. International Journal of Molecular Sciences. 2023; 24(12):10030. https://doi.org/10.3390/ijms241210030
Chicago/Turabian StyleWang, Jingqian, Xinming Gao, Chen Du, Daojun Tang, Congcong Hou, and Junquan Zhu. 2023. "The Effect of Prohibitins on Mitochondrial Function during Octopus tankahkeei Spermiogenesis" International Journal of Molecular Sciences 24, no. 12: 10030. https://doi.org/10.3390/ijms241210030