Nuclear S6K1 Enhances Oncogenic Wnt Signaling by Inducing Wnt/β-Catenin Transcriptional Complex Formation
Abstract
:1. Introduction
2. Results
2.1. S6K1 Is Activated by Wnt Signaling Activation and Translocated into the Nucleus
2.2. S6K1 Interacts with β-Catenin
2.3. S6K1 Regulates Wnt/β-Catenin-Mediated Transcription
2.4. S6K1 Does Not Affect β-Catenin
2.5. S6K1 Affects the Formation of the Wnt/β-Catenin Transcriptional Complex
2.6. S6K1 Regulates Cell Proliferation and Invasiveness of Colon Cancer Cell Lines
3. Discussion
4. Materials and Methods
4.1. Antibodies
4.2. Plasmids and Reagents
4.3. Cell Culture and Drug Treatment
4.4. Protein Extraction and Immunoblotting
4.5. Immunofluorescence
4.6. Immunoprecipitation
4.7. RNA Extraction and Quantitative Real-Time PCR (qRT-PCR)
4.8. TOPFlash Luciferase Assay
4.9. Cell Proliferation and Migration Assay
4.10. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hwang, I.; Seo, E.Y.; Ha, H. Wnt/beta-catenin signaling: A novel target for therapeutic intervention of fibrotic kidney disease. Arch. Pharm. Res. 2009, 32, 1653–1662. [Google Scholar] [CrossRef] [PubMed]
- MacDonald, B.T.; Tamai, K.; He, X. Wnt/beta-catenin signaling: Components, mechanisms, and diseases. Dev. Cell. 2009, 17, 9–26. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xiang, M.; Huang, Y.; Dai, C.; Zou, G. MiR-340 regulates the growth and metabolism of renal cell carcinoma cells by targeting frizzled class receptor 3. Arch. Pharm. Res. 2021, 44, 219–229. [Google Scholar] [CrossRef] [PubMed]
- Li, V.S.; Ng, S.S.; Boersema, P.J.; Low, T.Y.; Karthaus, W.R.; Gerlach, J.P.; Mohammed, S.; Heck, A.J.; Maurice, M.M.; Mahmoudi, T.; et al. Wnt signaling through inhibition of β-catenin degradation in an intact Axin1 complex. Cell 2012, 149, 1245–1256. [Google Scholar] [CrossRef] [Green Version]
- MacDonald, B.T.; He, X. Frizzled and LRP5/6 receptors for Wnt/beta-catenin signaling. Cold Spring Harb. Perspect. Biol. 2012, 4, a007880. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hayward, P.; Kalmar, T.; Arias, A.M. Wnt/Notch signalling and information processing during development. Development 2008, 135, 411–424. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jung, H.Y.; Jun, S.; Lee, M.; Kim, H.C.; Wang, X.; Ji, H.; McCrea, P.D.; Park, J.I. PAF and EZH2 induce Wnt/beta-catenin signaling hyperactivation. Mol. Cell. 2013, 52, 193–205. [Google Scholar] [CrossRef] [Green Version]
- Francipane, M.G.; Lagasse, E. mTOR pathway in colorectal cancer: An update. Oncotarget 2014, 5, 49–66. [Google Scholar] [CrossRef] [Green Version]
- Gregorieff, A.; Clevers, H. Wnt signaling in the intestinal epithelium: From endoderm to cancer. Genes Dev. 2005, 19, 877–890. [Google Scholar] [CrossRef] [Green Version]
- Laplante, M.; Sabatini, D.M. mTOR signaling in growth control and disease. Cell 2012, 149, 274–293. [Google Scholar] [CrossRef]
- Um, S.H.; D’Alessio, D.; Thomas, G. Nutrient overload, insulin resistance, and ribosomal protein S6 kinase 1, S6K1. Cell. Metab. 2006, 3, 393–402. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hazra, A.; Bose, P.; Sunita, P.; Pattanayak, S.P. Molecular epigenetic dynamics in breast carcinogenesis. Arch. Pharm. Res. 2021, 44, 741–763. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.M.; Blenis, J. Molecular mechanisms of mTOR-mediated translational control. Nat. Rev. Mol. Cell Biol. 2009, 10, 307–318. [Google Scholar] [CrossRef] [PubMed]
- Ruvinsky, I.; Meyuhas, O. Ribosomal protein S6 phosphorylation: From protein synthesis to cell size. Trends Biochem. Sci. 2006, 31, 342–348. [Google Scholar] [CrossRef] [PubMed]
- Kwon, H.K.; Bae, G.U.; Yoon, J.W.; Kim, Y.K.; Lee, H.Y.; Lee, H.W.; Han, J.W. Constitutive activation of p70S6k in cancer cells. Arch. Pharm. Res. 2002, 25, 685–690. [Google Scholar] [CrossRef]
- Rosner, M.; Hengstschläger, M. Nucleocytoplasmic localization of p70 S6K1, but not of its isoforms p85 and p31, is regulated by TSC2/mTOR. Oncogene 2011, 30, 4509–4522. [Google Scholar] [CrossRef] [Green Version]
- Rosner, M.; Schipany, K.; Hengstschlager, M. Spatial consequences of blocking mTOR/S6K: Relevance for therapy. Cell. Cycle 2012, 11, 420–421. [Google Scholar] [CrossRef] [Green Version]
- Yi, S.A.; Um, S.H.; Lee, J.; Yoo, J.H.; Bang, S.Y.; Park, E.K.; Lee, M.G.; Nam, K.H.; Jeon, Y.J.; Park, J.W.; et al. S6K1 Phosphorylation of H2B Mediates EZH2 Trimethylation of H3: A Determinant of Early Adipogenesis. Mol. Cell 2016, 62, 443–452. [Google Scholar] [CrossRef] [Green Version]
- Yi, S.A.; Jeon, Y.J.; Lee, M.G.; Nam, K.H.; Ann, S.; Lee, J.; Han, J.W. S6K1 controls adiponectin expression by inducing a transcriptional switch: BMAL1-to-EZH2. Exp. Mol. Med. 2022, 54, 324–333. [Google Scholar] [CrossRef]
- Inoki, K.; Ouyang, H.; Zhu, T.; Lindvall, C.; Wang, Y.; Zhang, X.; Yang, Q.; Bennett, C.; Harada, Y.; Stankunas, K.; et al. TSC2 integrates Wnt and energy signals via a coordinated phosphorylation by AMPK and GSK3 to regulate cell growth. Cell 2006, 126, 955–968. [Google Scholar] [CrossRef]
- Vadlakonda, L.; Pasupuleti, M.; Pallu, R. Role of PI3K-AKT-mTOR and Wnt Signaling Pathways in Transition of G1-S Phase of Cell Cycle in Cancer Cells. Front. Oncol. 2013, 3, 85. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rodríguez-Paredes, M.; Esteller, M. Cancer epigenetics reaches mainstream oncology. Nat. Med. 2011, 17, 330–339. [Google Scholar] [CrossRef]
- Guertin, D.A.; Sabatini, D.M. Defining the role of mTOR in cancer. Cancer Cell 2007, 12, 9–22. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Q.; Li, Y.; Gu, B.; Fang, L.; Zhou, P.; Bao, S.; Huang, L.; Dai, X. Akt Phosphorylates Wnt Coactivator and Chromatin Effector Pygo2 at Serine 48 to Antagonize Its Ubiquitin/Proteasome-mediated Degradation. J. Biol. Chem. 2015, 290, 21553–21567. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, W.C.; Chen, C.C. Akt phosphorylation of p300 at Ser-1834 is essential for its histone acetyltransferase and transcriptional activity. Mol. Cell. Biol. 2005, 25, 6592–6602. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Wang, X. Targeting the Wnt/β-catenin signaling pathway in cancer. J. Hematol. Oncol. 2020, 13, 165. [Google Scholar] [CrossRef]
- Cho, C.; Wang, Y.; Smallwood, P.M.; Williams, J.; Nathans, J. Molecular determinants in Frizzled, Reck, and Wnt7a for ligand-specific signaling in neurovascular development. Elife 2019, 8, e47300. [Google Scholar] [CrossRef]
Gene | Forward (5′ to 3′) | Reverse (3′ to 5′) |
---|---|---|
GAPDH | ATCATCCCTGCCTCTACTGG | GTCAAGTCCACCACTGACAC |
Axin2 | TGGACGATGTGCTCTATGCC | GGATGGTGATGGTTTGGTAG |
Ccnd1 | ATGTTCGTGGCCTCTAAGATGAA | CGGTGTAGATGCACAGCTTCTC |
Dkk1 | AAACGCTGCATGCGTCACGCTAT | AAAGCTTTCAGTGATGGTTT |
Bmp4 | CACTGGTCCCTGGGATGTTC | GATCCACAGCACTGGTCTTGACTA |
Vegf-a | GAGTACATCTTCAAGCCATC | CATTTGTTGTGCTGTAGGAA |
β-Actin | AAAAGCCACCCCACTTCTCT | CTCAAGTTGGGGGACAAAAA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, M.G.; Oh, H.; Park, J.W.; You, J.S.; Han, J.-W. Nuclear S6K1 Enhances Oncogenic Wnt Signaling by Inducing Wnt/β-Catenin Transcriptional Complex Formation. Int. J. Mol. Sci. 2022, 23, 16143. https://doi.org/10.3390/ijms232416143
Lee MG, Oh H, Park JW, You JS, Han J-W. Nuclear S6K1 Enhances Oncogenic Wnt Signaling by Inducing Wnt/β-Catenin Transcriptional Complex Formation. International Journal of Molecular Sciences. 2022; 23(24):16143. https://doi.org/10.3390/ijms232416143
Chicago/Turabian StyleLee, Min Gyu, Hwamok Oh, Jong Woo Park, Jueng Soo You, and Jeung-Whan Han. 2022. "Nuclear S6K1 Enhances Oncogenic Wnt Signaling by Inducing Wnt/β-Catenin Transcriptional Complex Formation" International Journal of Molecular Sciences 23, no. 24: 16143. https://doi.org/10.3390/ijms232416143