The Potential Role of the Methionine Aminopeptidase Gene PxMetAP1 in a Cosmopolitan Pest for Bacillus thuringiensis Toxin Tolerance
Abstract
1. Introduction
2. Results
2.1. Differential Expression of PxMetAP1 Gene in the G88 and Cry1S1000 Strains
2.2. Identification and Sequence Characteristics of the PxMetAP1 Gene
2.3. Expression Pattern of PxMetAP1 Gene
2.4. Genetic Linkage of PxMetAP1 Gene with Cry1Ac Resistance
2.5. CRISPR/Cas9-Mediated Knockout of PxMetAP1
2.6. Effects of PxMetAP1 Knockout on the Activity of MetAPs
2.7. Effects of PxMetAP1 Knockout on the Sensitivity of Bt Toxin
3. Discussion
4. Materials and Methods
4.1. Insect Strains
4.2. RNA Extraction and cDNA Synthesis
4.3. Real-Time Quantitative PCR (qPCR) Analysis
4.4. Gene Cloning and Bioinformatic Analysis
4.5. Toxin Synthesis and Toxicity Bioassays
4.6. Genetic Linkage Analysis
4.7. Preparation of sgRNA and Embryo Microinjection
4.8. Screening and Construction of Homozygous Mutant Strains
4.9. Activity Assay with Methionine Aminopeptidase (MetAPs)
- A—Enzyme activity, with the unit IU/mL;
- C—The absorption value brought into the standard curve to obtain the concentration of PNA produced by the reaction, with the unit μmol/L;
- VT—The total volume of the reaction system in µL;
- D—Dilution of crude enzyme solution;
- T—Reaction time in min;
- VE—The volume of diluted crude enzyme solution added in µL.
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mendelsohn, M.; Kough, J.; Vaituzis, Z.; Matthews, K. Are Bt crops safe? Nat. Biotechnol. 2003, 21, 1003–1009. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ifoulis, A.A.; Savopoulou-Soultani, M. Biological control of Lobesia botrana (Lepidoptera: Tortricidae) larvae by using different formulations of Bacillus thuringiensis in 11 vine cultivars under field conditions. J. Econ. Entomol. 2004, 97, 340–343. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eski, A.; Demir, İ.; Güllü, M.; Demirbağ, Z. Biodiversity and pathogenicity of bacteria associated with the gut microbiota of beet armyworm, Spodoptera exigua Hübner (Lepidoptera: Noctuidae). Microb. Pathog. 2018, 121, 350–358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Edgerton, M.; Fridgen, J.; Anderson, J.; Ahlgrim, J.; Criswell, M.; Dhungana, P.; Gocken, T.; Li, Z.; Mariappan, S.; Pilcher, C.; et al. Transgenic insect resistance traits increase corn yield and yield stability. Nat. Biotechnol. 2012, 30, 493–496. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hutchison, W.; Burkness, E.; Mitchell, P.; Moon, R.; Leslie, T.; Fleischer, S.; Abrahamson, M.; Hamilton, K.; Steffey, K.; Gray, M.; et al. Areawide suppression of European corn borer with Bt maize reaps savings to non-Bt maize growers. Science 2010, 330, 222–225. [Google Scholar] [CrossRef] [Scilit]
- Klümper, W.; Qaim, M. A meta-analysis of the impacts of genetically modified crops. PLoS ONE 2014, 9, e111629. [Google Scholar] [CrossRef] [Scilit]
- Lu, Y.; Wu, K.; Jiang, Y.; Guo, Y.; Desneux, N. Widespread adoption of Bt cotton and insecticide decrease promotes biocontrol services. Nature 2012, 487, 362–365. [Google Scholar] [CrossRef] [Scilit]
- Wu, K.; Lu, Y.; Feng, H.; Jiang, Y.; Zhao, J. Suppression of cotton bollworm in multiple crops in China in areas with Bt toxin-containing cotton. Science 2008, 321, 1676–1678. [Google Scholar] [CrossRef] [Scilit]
- McGaughey, W. Insect Resistance to the Biological Insecticide Bacillus thuringiensis. Science 1985, 229, 193–195. [Google Scholar] [CrossRef] [Scilit]
- Tabashnik, B.E.; Cushing, N.L.; Naomi, F.; Johnson, M.W. Field Development of Resistance to Bacillus thuringiensis in Diamondback Moth (Lepidoptera: Plutellidae). J. Enonomic Entomol. 1990, 83, 1671–1676. [Google Scholar] [CrossRef] [Scilit]
- Tabashnik, B.E.; Carrière, Y. Surge in insect resistance to transgenic crops and prospects for sustainability. Nat. Biotechnol. 2017, 35, 926–935. [Google Scholar] [CrossRef] [Scilit]
- Adang, M.J.; Crickmore, N.; Fuentes, J. Diversity of Bacillus thuringiensis Crystal Toxins and Mechanism of Action. Adv. Insect Physiol. 2014, 47, 39–87. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Candas, M.; Griko, N.; Taussig, R.; Bulla, L. A mechanism of cell death involving an adenylyl cyclase/PKA signaling pathway is induced by the Cry1Ab toxin of Bacillus thuringiensis. Proc. Natl. Acad. Sci. USA 2006, 103, 9897–9902. [Google Scholar] [CrossRef] [Scilit]
- Vachon, V.; Laprade, R.; Schwartz, J. Current models of the mode of action of Bacillus thuringiensis insecticidal crystal proteins: A critical review. J. Invertebr. Pathol. 2012, 111, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Tabashnik, B.; Zhang, M.; Fabrick, J.; Wu, Y.; Gao, M.; Huang, F.; Wei, J.; Zhang, J.; Yelich, A.; Unnithan, G.; et al. Dual mode of action of Bt proteins: Protoxin efficacy against resistant insects. Sci. Rep. 2015, 5, 15107. [Google Scholar] [CrossRef] [Scilit]
- Bravo, A.; Gómez, I.; Conde, J.; Muñoz-Garay, C.; Sánchez, J.; Miranda, R.; Zhuang, M.; Gill, S.; Soberón, M. Oligomerization triggers binding of a Bacillus thuringiensis Cry1Ab pore-forming toxin to aminopeptidase N receptor leading to insertion into membrane microdomains. Biochim. Biophys. Acta 2004, 1667, 38–46. [Google Scholar] [CrossRef] [Scilit]
- Gahan, L.; Pauchet, Y.; Vogel, H.; Heckel, D. An ABC transporter mutation is correlated with insect resistance to Bacillus thuringiensis Cry1Ac toxin. PLoS Genet. 2010, 6, e1001248. [Google Scholar] [CrossRef] [Scilit]
- Gómez, I.; Arenas, I.; Benitez, I.; Miranda-Ríos, J.; Becerril, B.; Grande, R.; Almagro, J.; Bravo, A.; Soberón, M. Specific epitopes of domains II and III of Bacillus thuringiensis Cry1Ab toxin involved in the sequential interaction with cadherin and aminopeptidase-N receptors in Manduca sexta. J. Biol. Chem. 2006, 281, 34032–34039. [Google Scholar] [CrossRef] [Scilit]
- Gómez, I.; Sánchez, J.; Muñoz-Garay, C.; Matus, V.; Gill, S.; Soberón, M.; Bravo, A. Bacillus thuringiensis Cry1A toxins are versatile proteins with multiple modes of action: Two distinct pre-pores are involved in toxicity. Biochem. J. 2014, 459, 383–396. [Google Scholar] [CrossRef] [Scilit]
- Soberón, M.; Monnerat, R.; Bravo, A. Mode of Action of Cry Toxins from Bacillus thuringiensis and Resistance Mechanisms. In Microbial Toxins; Gopalakrishnakone, P., Stiles, B., Alape-Gir‘on, A., Dubreuil, J.D., Mandal, M., Eds.; Springer: Dordrecht, The Netherlands, 2016; pp. 1–13. [Google Scholar]
- Cao, G.; Zhang, L.; Liang, G.; Li, X.; Wu, K. Involvement of nonbinding site proteinases in the development of resistance of Helicoverpa armigera (Lepidoptera: Noctuidae) to Cry1Ac. J. Econ. Entomol. 2013, 106, 2514–2521. [Google Scholar] [CrossRef] [Scilit]
- Liu, C.; Xiao, Y.; Li, X.; Oppert, B.; Tabashnik, B.; Wu, K. Cis-mediated down-regulation of a trypsin gene associated with Bt resistance in cotton bollworm. Sci. Rep. 2014, 4, 7219. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rajagopal, R.; Arora, N.; Sivakumar, S.; Rao, N.; Nimbalkar, S.; Bhatnagar, R. Resistance of Helicoverpa armigera to Cry1Ac toxin from Bacillus thuringiensis is due to improper processing of the protoxin. Biochem. J. 2009, 419, 309–316. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wei, J.; Liang, G.; Wang, B.; Zhong, F.; Chen, L.; Khaing, M.; Zhang, J.; Guo, Y.; Wu, K.; Tabashnik, B. Activation of Bt Protoxin Cry1Ac in Resistant and Susceptible Cotton Bollworm. PLoS ONE 2016, 11, e0156560. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Atsumi, S.; Miyamoto, K.; Yamamoto, K.; Narukawa, J.; Kawai, S.; Sezutsu, H.; Kobayashi, I.; Uchino, K.; Tamura, T.; Mita, K.; et al. Single amino acid mutation in an ATP-binding cassette transporter gene causes resistance to Bt toxin Cry1Ab in the silkworm, Bombyx mori. Proc. Natl. Acad. Sci. USA 2012, 109, 9674–9675. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baxter, S.; Badenes-Pérez, F.; Morrison, A.; Vogel, H.; Crickmore, N.; Kain, W.; Wang, P.; Heckel, D.; Jiggins, C. Parallel evolution of Bacillus thuringiensis toxin resistance in lepidoptera. Genetics 2011, 189, 675–679. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, W.; Liu, C.; Xiao, Y.; Zhang, D.; Zhang, Y.; Li, X.; Tabashnik, B.; Wu, K. A toxin-binding alkaline phosphatase fragment synergizes Bt toxin Cry1Ac against susceptible and resistant Helicoverpa armigera. PLoS ONE 2015, 10, e0126288. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jurat-Fuentes, J.; Karumbaiah, L.; Jakka, S.; Ning, C.; Liu, C.; Wu, K.; Jackson, J.; Gould, F.; Blanco, C.; Portilla, M.; et al. Reduced levels of membrane-bound alkaline phosphatase are common to lepidopteran strains resistant to Cry toxins from Bacillus thuringiensis. PLoS ONE 2011, 6, e17606. [Google Scholar] [CrossRef] [Scilit]
- Xiao, Y.; Zhang, T.; Liu, C.; Heckel, D.; Li, X.; Tabashnik, B.; Wu, K. Mis-splicing of the ABCC2 gene linked with Bt toxin resistance in Helicoverpa armigera. Sci. Rep. 2014, 4, 6184. [Google Scholar] [CrossRef] [Scilit]
- Xu, X.; Yu, L.; Wu, Y. Disruption of a cadherin gene associated with resistance to Cry1Ac δ-endotoxin of Bacillus thuringiensis in Helicoverpa armigera. Appl. Environ. Microbiol. 2005, 71, 948–954. [Google Scholar] [CrossRef] [Scilit]
- Zhang, S.; Cheng, H.; Gao, Y.; Wang, G.; Liang, G.; Wu, K. Mutation of an aminopeptidase N gene is associated with Helicoverpa armigera resistance to Bacillus thuringiensis Cry1Ac toxin. Insect Biochem. Mol. Biol. 2009, 39, 421–429. [Google Scholar] [CrossRef] [Scilit]
- Ma, G.; Schmidt, O.; Keller, M. Pre-feeding of a glycolipid binding protein LEC-8 from Caenorhabditis elegans revealed enhanced tolerance to Cry1Ac toxin in Helicoverpa armigera. Results Immunol. 2012, 2, 97–103. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Y.; Blanco, C.; Portilla, M.; Adamczyk, J.; Luttrell, R.; Huang, F. Evidence of multiple/cross resistance to Bt and organophosphate insecticides in Puerto Rico population of the fall armyworm, Spodoptera frugiperda. Pestic. Biochem. Physiol. 2015, 122, 15–21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, J.; Yu, X.; Wang, Q.; Tao, X.; Li, J.; Zhang, S.; Xia, X.; You, M. Immune responses to Bacillus thuringiensis in the midgut of the diamondback moth, Plutella xylostella. Dev. Comp. Immunol. 2020, 107, 103661. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Giglione, C.; Serero, A.; Pierre, M.; Boisson, B.; Meinnel, T. Identification of eukaryotic peptide deformylases reveals universality of N-terminal protein processing mechanisms. EMBO J. 2000, 19, 5916–5929. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Giglione, C.; Boularot, A.; Meinnel, T. Protein N-terminal methionine excision. Cell. Mol. Life Sci. 2004, 61, 1455–1474. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Giglione, C.; Vallon, O.; Meinnel, T. Control of protein life-span by N-terminal methionine excision. EMBO J. 2003, 22, 13–23. [Google Scholar] [CrossRef] [Scilit]
- Gonzales, T.; Robert-Baudouy, J. Bacterial aminopeptidases: Properties and functions. FEMS Microbiol. Rev. 1996, 18, 319–344. [Google Scholar] [CrossRef]
- Ekpenyong, O.; Gao, X.; Ma, J.; Cooper, C.; Nguyen, L.; Olaleye, O.; Liang, D.; Xie, H. Pre-Clinical Pharmacokinetics, Tissue Distribution and Physicochemical Studies of CLBQ14, a Novel Methionine Aminopeptidase Inhibitor for the Treatment of Infectious Diseases. Drug Des. Dev. Ther. 2020, 14, 1263–1277. [Google Scholar] [CrossRef] [Scilit]
- Jonckheere, V.; Fijałkowska, D.; Van Damme, P. Omics Assisted N-terminal Proteoform and Protein Expression Profiling On Methionine Aminopeptidase 1 (MetAP1) Deletion. Mol. Cell. Proteom. MCP 2018, 17, 694–708. [Google Scholar] [CrossRef] [Scilit]
- Arfin, S.; Kendall, R.; Hall, L.; Weaver, L.; Stewart, A.; Matthews, B.; Bradshaw, R. Eukaryotic methionyl aminopeptidases: Two classes of cobalt-dependent enzymes. Proc. Natl. Acad. Sci. USA 1995, 92, 7714–7718. [Google Scholar] [CrossRef] [Scilit]
- Keeling, P.; Doolittle, W. Methionine aminopeptidase-1: The MAP of the mitochondrion? Trends Biochem. Sci. 1996, 21, 285–286. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Wang, B.; Zhang, Q. Anti-tumor targeted drug delivery systems mediated by aminopeptidase N/CD13. Acta Pharm. Sin. B 2011, 1, 80–83. [Google Scholar] [CrossRef] [Scilit]
- Chiu, J.; Wong, J.; Hogg, P. Redox regulation of methionine aminopeptidase 2 activity. J. Biol. Chem. 2014, 289, 15035–15043. [Google Scholar] [CrossRef] [Scilit]
- Hu, Q.; Lu, J.; Luo, R.; Sen, S.; Maity, S. Inhibition of CBF/NF-Y mediated transcription activation arrests cells at G2/M phase and suppresses expression of genes activated at G2/M phase of the cell cycle. Nucleic Acids Res. 2006, 34, 6272–6285. [Google Scholar] [CrossRef] [Scilit]
- Warder, S.; Tucker, L.; McLoughlin, S.; Strelitzer, T.; Meuth, J.; Zhang, Q.; Sheppard, G.; Richardson, P.; Lesniewski, R.; Davidsen, S.; et al. Discovery, identification, and characterization of candidate pharmacodynamic markers of methionine aminopeptidase-2 inhibition. J. Proteome Res. 2008, 7, 4807–4820. [Google Scholar] [CrossRef] [Scilit]
- Chai, S.; Wang, W.; Ding, D.; Ye, Q. Growth inhibition of Escherichia coli and methicillin-resistant Staphylococcus aureus by targeting cellular methionine aminopeptidase. Eur. J. Med. Chem. 2011, 46, 3537–3540. [Google Scholar] [CrossRef] [Scilit]
- John, S.; Aniemeke, E.; Ha, N.; Chong, C.; Gu, P.; Zhou, J.; Zhang, Y.; Graviss, E.; Liu, J.; Olaleye, O. Characterization of 2-hydroxy-1-naphthaldehyde isonicotinoyl hydrazone as a novel inhibitor of methionine aminopeptidases from Mycobacterium tuberculosis. Tuberculosis 2016, 101, 73–77. [Google Scholar] [CrossRef] [Scilit]
- Olaleye, O.; Raghunand, T.; Bhat, S.; Chong, C.; Gu, P.; Zhou, J.; Zhang, Y.; Bishai, W.; Liu, J. Characterization of clioquinol and analogues as novel inhibitors of methionine aminopeptidases from Mycobacterium tuberculosis. Tuberculosis 2011, 91, S61–S65. [Google Scholar] [CrossRef] [Scilit]
- Vaughan, M.; Sampson, P.; Honek, J. Methionine in and out of proteins: Targets for drug design. Curr. Med. Chem. 2002, 9, 385–409. [Google Scholar] [CrossRef] [Scilit]
- Huang, W.; Solter, L.; Yau, P.; Imai, B. Nosema ceranae escapes fumagillin control in honey bees. PLoS Pathog. 2013, 9, e1003185. [Google Scholar] [CrossRef] [Scilit]
- Bradley, D.; Harkey, M.; Kim, M.; Biever, K.; Bauer, L. The insecticidal CryIB crystal protein of Bacillus thuringiensis ssp. thuringiensis has dual specificity to coleopteran and lepidopteran larvae. J. Invertebr. Pathol. 1995, 65, 162–173. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Caccia, S.; Hernández-Rodríguez, C.; Mahon, R.; Downes, S.; James, W.; Bautsoens, N.; Van Rie, J.; Ferré, J. Binding site alteration is responsible for field-isolated resistance to Bacillus thuringiensis Cry2A insecticidal proteins in two Helicoverpa species. PLoS ONE 2010, 5, e9975. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, Z.; Meihls, L.; Hibbard, B.; Ji, T.; Elsik, C.; Shelby, K. Differential gene expression in response to eCry3.1Ab ingestion in an unselected and eCry3.1Ab-selected western corn rootworm (Diabrotica virgifera virgifera LeConte) population. Sci. Rep. 2019, 9, 4896. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gunning, R.; Dang, H.; Kemp, F.; Nicholson, I.; Moores, G. New resistance mechanism in Helicoverpa armigera threatens transgenic crops expressing Bacillus thuringiensis Cry1Ac toxin. Appl. Environ. Microbiol. 2005, 71, 2558–2563. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, G.; Roberts, H.; Sarjan, M.; Featherstone, N.; Lahnstein, J.; Akhurst, R.; Schmidt, O. Is the mature endotoxin Cry1Ac from Bacillus thuringiensis inactivated by a coagulation reaction in the gut lumen of resistant Helicoverpa armigera larvae? Insect Biochem. Mol. Biol. 2005, 35, 729–739. [Google Scholar] [CrossRef] [Scilit]
- Candas, M.; Loseva, O.; Oppert, B.; Kosaraju, P.; Bulla, L. Insect resistance to Bacillus thuringiensis: Alterations in the indianmeal moth larval gut proteome. Mol. Cell. Proteom. MCP 2003, 2, 19–28. [Google Scholar] [CrossRef] [Scilit]
- Zago, H.; Siqueira, H.; Pereira, E.; Picanço, M.; Barros, R. Resistance and behavioural response of Plutella xylostella (Lepidoptera: Plutellidae) populations to Bacillus thuringiensis formulations. Pest Manag. Sci. 2014, 70, 488–495. [Google Scholar] [CrossRef] [Scilit]
- Guo, Z.; Kang, S.; Sun, D.; Gong, L.; Zhou, J.; Qin, J.; Guo, L.; Zhu, L.; Bai, Y.; Ye, F.; et al. MAPK-dependent hormonal signaling plasticity contributes to overcoming Bacillus thuringiensis toxin action in an insect host. Nat. Commun. 2020, 11, 3003. [Google Scholar] [CrossRef] [Scilit]
- Guo, Z.; Kang, S.; Chen, D.; Wu, Q.; Wang, S.; Xie, W.; Zhu, X.; Baxter, S.; Zhou, X.; Jurat-Fuentes, J.; et al. MAPK signaling pathway alters expression of midgut ALP and ABCC genes and causes resistance to Bacillus thuringiensis Cry1Ac toxin in diamondback moth. PLoS Genet. 2015, 11, e1005124. [Google Scholar] [CrossRef] [Scilit]
- Guo, L.; Cheng, Z.; Qin, J.; Sun, D.; Wang, S.; Wu, Q.; Crickmore, N.; Zhou, X.; Bravo, A.; Soberón, M.; et al. MAPK-mediated transcription factor GATAd contributes to Cry1Ac resistance in diamondback moth by reducing PxmALP expression. PLoS Genet. 2022, 18, e1010037. [Google Scholar] [CrossRef] [Scilit]
- Guo, Z.; Kang, S.; Wu, Q.; Wang, S.; Crickmore, N.; Zhou, X.; Bravo, A.; Soberón, M.; Zhang, Y. The regulation landscape of MAPK signaling cascade for thwarting Bacillus thuringiensis infection in an insect host. PLoS Pathog. 2021, 17, e1009917. [Google Scholar] [CrossRef] [Scilit]
- Xu, L.; Qin, J.; Fu, W.; Wang, S.; Wu, Q.; Zhou, X.; Crickmore, N.; Guo, Z.; Zhang, Y. MAP4K4 controlled transcription factor POUM1 regulates PxABCG1 expression influencing Cry1Ac resistance in Plutella xylostella (L.). Pestic. Biochem. Physiol. 2022, 182, 105053. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiong, L.; Liu, Z.; Shen, L.; Xie, C.; Ye, M.; Li, Z.; Zhang, Z.; Li, J.; Dong, Y.; You, M.; et al. A Novel Reference for Bt-Resistance Mechanism in Plutella xylostella Based on Analysis of the Midgut Transcriptomes. Insects 2021, 12, 1091. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bradshaw, R.A.; Brickey, W.W.; Walker, K.W. N-Terminal processing: The methionine aminopeptidase and Nα-acetyl transferase families. Trends Biochem. Sci. 1998, 23, 263–267. [Google Scholar] [CrossRef] [Scilit]
- Boxem, M.; Tsai, C.; Zhang, Y.; Saito, R.; Liu, J. The C. elegans methionine aminopeptidase 2 analog map-2 is required for germ cell proliferation. FEBS Lett. 2004, 576, 245–250. [Google Scholar] [CrossRef] [Scilit]
- Hu, X.; Addlagatta, A.; Lu, J.; Matthews, B.; Liu, J. Elucidation of the function of type 1 human methionine aminopeptidase during cell cycle progression. Proc. Natl. Acad. Sci. USA 2006, 103, 18148–18153. [Google Scholar] [CrossRef] [Scilit]
- Arya, T.; Kishor, C.; Saddanapu, V.; Reddi, R.; Addlagatta, A. Discovery of a new genetic variant of methionine aminopeptidase from Streptococci with possible post-translational modifications: Biochemical and structural characterization. PLoS ONE 2013, 8, e75207. [Google Scholar] [CrossRef] [Scilit]
- Bala, S.; Haque, N.; Pillalamarri, V.; Reddi, R.; Kashyap, R.; Marapaka, A.; Addlagatta, A. Discovery of a new class of type 1 methionine aminopeptidases that have relaxed substrate specificity. Int. J. Biol. Macromol. 2019, 129, 523–529. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Lin, J.; Fernández-Grandon, G.; Zhang, J.; You, M.; Xia, X. Functional identification of C-type lectin in the diamondback moth, Plutella xylostella (L.) innate immunity. J. Integr. Agric. 2021, 20, 3240–3255. [Google Scholar] [CrossRef] [Scilit]
- Zhong, H.; Bowen, J. Antiangiogenesis drug design: Multiple pathways targeting tumor vasculature. Curr. Med. Chem. 2006, 13, 849–862. [Google Scholar] [CrossRef] [Scilit]
- Adams, K.; Sawadogo, S.; Nignan, C.; Niang, A.; Paton, D.; Robert Shaw, W.; South, A.; Wang, J.; Itoe, M.; Werling, K.; et al. Cuticular hydrocarbons are associated with mating success and insecticide resistance in malaria vectors. Commun. Biol. 2021, 4, 911. [Google Scholar] [CrossRef] [Scilit]
- Li, Q.; Sun, Z.; Shi, Q.; Wang, R.; Xu, C.; Wang, H.; Song, Y.; Zeng, R. RNA-Seq Analyses of Midgut and Fat Body Tissues Reveal the Molecular Mechanism Underlying Spodoptera litura Resistance to Tomatine. Front. Physiol. 2019, 10, 8. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Liu, Z.; Ma, H.; Yu, Y.; Zhang, C.; Zheng, W.; Man, Y.; Zhu, H.; Zhou, Y.; Chen, X.; et al. C/EBPα Regulates PxTreh1 and PxTreh2 Trehalase-Related Bt Resistance in Plutella xylostella (L.). Insects 2022, 13, 340. [Google Scholar] [CrossRef] [Scilit]
- Sun, Y.; Yang, P.; Jin, H.; Liu, H.; Zhou, H.; Qiu, L.; Lin, Y.; Ma, W. Knockdown of the aminopeptidase N genes decreases susceptibility of Chilo suppressalis larvae to Cry1Ab/Cry1Ac and Cry1Ca. Pestic. Biochem. Physiol. 2020, 162, 36–42. [Google Scholar] [CrossRef] [Scilit]
- Zhang, C.; Wei, J.; Naing, Z.; Soe, E.; Liang, G. Endogenous serpin reduces toxicity of Bacillus thuringiensis Cry1Ac against Helicoverpa armigera (Hübner). Pestic. Biochem. Physiol. 2021, 175, 104837. [Google Scholar] [CrossRef] [Scilit]
- Jurat-Fuentes, J.; Heckel, D.; Ferré, J. Mechanisms of Resistance to Insecticidal Proteins from Bacillus thuringiensis. Annu. Rev. Entomol. 2021, 66, 121–140. [Google Scholar] [CrossRef] [Scilit]
- Qin, J.; Guo, L.; Ye, F.; Kang, S.; Sun, D.; Zhu, L.; Bai, Y.; Cheng, Z.; Xu, L.; Ouyang, C.; et al. MAPK-Activated Transcription Factor PxJun Suppresses PxABCB1 Expression and Confers Resistance to Bacillus thuringiensis Cry1Ac Toxin in Plutella xylostella (L.). Appl. Environ. Microbiol. 2021, 87, e0046621. [Google Scholar] [CrossRef] [Scilit]
- Blomen, V.; Májek, P.; Jae, L.; Bigenzahn, J.; Nieuwenhuis, J.; Staring, J.; Sacco, R.; Van Diemen, F.; Olk, N.; Stukalov, A.; et al. Gene essentiality and synthetic lethality in haploid human cells. Science 2015, 350, 1092–1096. [Google Scholar] [CrossRef] [Scilit]
- Lai, T.; Jia, L.; Su, J. Monitoring of beet armyworm Spodoptera exigua (Lepidoptera: Noctuidae) resistance to chlorantraniliprole in China. Pestic. Biochem. Physiol. 2011, 101, 198–205. [Google Scholar] [CrossRef] [Scilit]
- Su, J.; Sun, X.X. High level of metaflumizone resistance and multiple insecticide resistance in field populations of Spodoptera exigua (Lepidoptera: Noctuidae) in Guangdong Province, China. Crop Prot. 2014, 61, 58–63. [Google Scholar] [CrossRef] [Scilit]
- Bel, Y.; Sheets, J.; Tan, S.; Narva, K.; Escriche, B. Toxicity and Binding Studies of Bacillus thuringiensis Cry1Ac, Cry1F, Cry1C, and Cry2A Proteins in the Soybean Pests Anticarsia gemmatalis and Chrysodeixis (Pseudoplusia) includens. Appl. Environ. Microbiol. 2017, 83, e00326-17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.; Miyamoto, K.; Takasu, Y.; Wada, S.; Iizuka, T.; Adegawa, S.; Sato, R.; Watanabe, K. ATP-Binding Cassette Subfamily a Member 2 Is a Functional Receptor for Bacillus thuringiensis Cry2A Toxins in Bombyx mori, But Not for Cry1A, Cry1C, Cry1D, Cry1F, or Cry9A Toxins. Toxins 2020, 12, 104. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luo, S.; Wu, K.; Tian, Y.; Liang, G.; Feng, X.; Zhang, J.; Guo, Y. Cross-resistance studies of Cry1Ac-resistant strains of Helicoverpa armigera (Lepidoptera: Noctuidae) to Cry2Ab. J. Econ. Entomol. 2007, 100, 909–915. [Google Scholar] [CrossRef] [Scilit]
- Soares Figueiredo, C.; Nunes Lemes, A.; Sebastião, I.; Desidério, J. Synergism of the Bacillus thuringiensis Cry1, Cry2, and Vip3 Proteins in Spodoptera frugiperda Control. Appl. Biochem. Biotechnol. 2019, 188, 798–809. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tay, W.; Mahon, R.; Heckel, D.; Walsh, T.; Downes, S.; James, W.; Lee, S.; Reineke, A.; Williams, A.; Gordon, K. Insect Resistance to Bacillus thuringiensis Toxin Cry2Ab Is Conferred by Mutations in an ABC Transporter Subfamily A Protein. PLoS Genet. 2015, 11, e1005534. [Google Scholar] [CrossRef] [Scilit]
- Yang, F.; Kerns, D.; Head, G.; Price, P.; Huang, F. Cross-resistance to purified Bt proteins, Bt corn and Bt cotton in a Cry2Ab2-corn resistant strain of Spodoptera frugiperda. Pest Manag. Sci. 2017, 73, 2495–2503. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Ma, Y.; Wei, W.; Wan, P.; Liu, K.; Xu, M.; Cong, S.; Wang, J.; Xu, D.; Xiao, Y.; et al. Cadherin repeat 5 mutation associated with Bt resistance in a field-derived strain of pink bollworm. Sci. Rep. 2020, 10, 16840. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Ma, Y.; Guo, X.; Wan, P.; Liu, K.; Cong, S.; Wang, J.; Xu, D.; Xiao, Y.; Li, X.; et al. Pink Bollworm Resistance to Bt Toxin Cry1Ac Associated with an Insertion in Cadherin Exon 20. Toxins 2019, 11, 186. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Ma, Y.; Wan, P.; Liu, K.; Xiao, Y.; Wang, J.; Cong, S.; Xu, D.; Wu, K.; Fabrick, J.; et al. Resistance to Bacillus thuringiensis linked with a cadherin transmembrane mutation affecting cellular trafficking in pink bollworm from China. Insect Biochem. Mol. Biol. 2018, 94, 28–35. [Google Scholar] [CrossRef] [Scilit]
- Wei, J.; Guo, Y.; Liang, G.; Wu, K.; Zhang, J.; Tabashnik, B.; Li, X. Cross-resistance and interactions between Bt toxins Cry1Ac and Cry2Ab against the cotton bollworm. Sci. Rep. 2015, 5, 7714. [Google Scholar] [CrossRef] [Scilit]
- Jurat-Fuentes, J.; Gould, F.; Adang, M. Dual resistance to Bacillus thuringiensis Cry1Ac and Cry2Aa toxins in Heliothis virescens suggests multiple mechanisms of resistance. Appl. Environ. Microbiol. 2003, 69, 5898–5906. [Google Scholar] [CrossRef] [Scilit]
- Tabashnik, B.; Unnithan, G.; Masson, L.; Crowder, D.; Li, X.; Carrière, Y. Asymmetrical cross-resistance between Bacillus thuringiensis toxins Cry1Ac and Cry2Ab in pink bollworm. Proc. Natl. Acad. Sci. USA 2009, 106, 11889–11894. [Google Scholar] [CrossRef] [Scilit]
- Jin, L.; Wei, Y.; Zhang, L.; Yang, Y.; Tabashnik, B.; Wu, Y. Dominant resistance to Bt cotton and minor cross-resistance to Bt toxin Cry2Ab in cotton bollworm from China. Evol. Appl. 2013, 6, 1222–1235. [Google Scholar] [CrossRef] [Scilit]
- Brévault, T.; Heuberger, S.; Zhang, M.; Ellers-Kirk, C.; Ni, X.; Masson, L.; Li, X.; Tabashnik, B.; Carrière, Y. Potential shortfall of pyramided transgenic cotton for insect resistance management. Proc. Natl. Acad. Sci. USA 2013, 110, 5806–5811. [Google Scholar] [CrossRef] [Scilit]
- Zhong, J.; Fang, S.; Gao, M.; Lu, L.; Zhang, X.; Zhu, Q.; Liu, Y.; Jurat-Fuentes, J.; Liu, X. Evidence of a shared binding site for Bacillus thuringiensis Cry1Ac and Cry2Aa toxins in Cnaphalocrocis medinalis cadherin. Insect Mol. Biol. 2022, 31, 101–114. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.; Hua, G.; Jurat-Fuentes, J.; Abdullah, M.; Adang, M. Synergism of Bacillus thuringiensis toxins by a fragment of a toxin-binding cadherin. Proc. Natl. Acad. Sci. USA 2007, 104, 13901–13906. [Google Scholar] [CrossRef] [Scilit]
- Hua, G.; Zhang, R.; Abdullah, M.; Adang, M. Anopheles gambiae cadherin AgCad1 binds the Cry4Ba toxin of Bacillus thuringiensis israelensis and a fragment of AgCad1 synergizes toxicity. Biochemistry 2008, 47, 5101–5110. [Google Scholar] [CrossRef] [Scilit]
- Park, Y.; Abdullah, M.; Taylor, M.; Rahman, K.; Adang, M. Enhancement of Bacillus thuringiensis Cry3Aa and Cry3Bb toxicities to coleopteran larvae by a toxin-binding fragment of an insect cadherin. Appl. Environ. Microbiol. 2009, 75, 3086–3092. [Google Scholar] [CrossRef] [Scilit]
- Peng, D.; Xu, X.; Ye, W.; Yu, Z.; Sun, M. Helicoverpa armigera cadherin fragment enhances Cry1Ac insecticidal activity by facilitating toxin-oligomer formation. Appl. Microbiol. Biotechnol. 2010, 85, 1033–1040. [Google Scholar] [CrossRef] [Scilit]
- Bernard, C.; Philogène, B. Insecticide synergists: Role, importance, and perspectives. J. Toxicol. Environ. Health 1993, 38, 199–223. [Google Scholar] [CrossRef] [Scilit]
- Dubois, N.R.; Dean, D.H. Synergism Between CryIA Insecticidal Crystal Proteins and Spores of Bacillus thuringiensis, Other Bacterial Spores, and Vegetative Cells Against Lymantria dispar (Lepidoptera: Lymantriidae) Larvae. Environ. Entomol. 1995, 24, 1741–1747. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Tabashnik, B.E. Synergism of Bacillus thuringiensis by Ethylenediamine Tetraacetate in Susceptible and Resistant Larvae of Diamondback Moth (Lepidoptera: Plutellidae). J. Econ. Entomol. 1997, 90, 287–292. [Google Scholar] [CrossRef] [Scilit]
- Brattsten, L.; Holyoke, C.; Leeper, J.; Raffa, K. Insecticide resistance: Challenge to pest management and basic research. Science 1986, 231, 1255–1260. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abdullah, M.; Moussa, S.; Taylor, M.; Adang, M. Manduca sexta (Lepidoptera: Sphingidae) cadherin fragments function as synergists for Cry1A and Cry1C Bacillus thuringiensis toxins against noctuid moths Helicoverpa zea, Agrotis ipsilon and Spodoptera exigua. Pest Manag. Sci. 2009, 65, 1097–1103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rahman, K.; Abdullah, M.; Ambati, S.; Taylor, M.; Adang, M. Differential protection of Cry1Fa toxin against Spodoptera frugiperda larval gut proteases by cadherin orthologs correlates with increased synergism. Appl. Environ. Microbiol. 2012, 78, 354–362. [Google Scholar] [CrossRef] [Scilit]
- Hao, J.; Gao, M.; Hu, X.; Lu, L.; Zhang, X.; Liu, Y.; Zhong, J.; Liu, X. Synergistic selection of a Helicoverpa armigera cadherin fragment with Cry1Ac in different cells and insects. Int. J. Biol. Macromol. 2020, 164, 3667–3675. [Google Scholar] [CrossRef] [Scilit]
- Peng, D.; Xu, X.; Ruan, L.; Yu, Z.; Sun, M. Enhancing Cry1Ac toxicity by expression of the Helicoverpa armigera cadherin fragment in Bacillus thuringiensis. Res. Microbiol. 2010, 161, 383–389. [Google Scholar] [CrossRef] [Scilit]
- Park, Y.; Hua, G.; Abdullah, M.; Rahman, K.; Adang, M. Cadherin fragments from Anopheles gambiae synergize Bacillus thuringiensis Cry4Ba’s toxicity against Aedes aegypti larvae. Appl. Environ. Microbiol. 2009, 75, 7280–7282. [Google Scholar] [CrossRef] [Scilit]
- Park, Y.; Hua, G.; Taylor, M.; Adang, M. A coleopteran cadherin fragment synergizes toxicity of Bacillus thuringiensis toxins Cry3Aa, Cry3Bb, and Cry8Ca against lesser mealworm, Alphitobius diaperinus (Coleoptera: Tenebrionidae). J. Invertebr. Pathol. 2014, 123, 1–5. [Google Scholar] [CrossRef] [Scilit]
- Shelton, A.; Cooley, R.; Kroening, M.; Wilsey, W.; Eigenbrode, S. Comparative analysis of two rearing procedures for diamondback moth (Lepidoptera: Plutellidae). J. Entomol. Sci. 1991, 26, 17–26. [Google Scholar] [CrossRef] [Scilit]
- Liu, Z.; Fu, S.; Ma, X.; Baxter, S.; Vasseur, L.; Xiong, L.; Huang, Y.; Yang, G.; You, S.; You, M. Resistance to Bacillus thuringiensis Cry1Ac toxin requires mutations in two Plutella xylostella ATP-binding cassette transporter paralogs. PLoS Pathog. 2020, 16, e1008697. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.; Schmittgen, T. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Bailey, T.; Boden, M.; Buske, F.; Frith, M.; Grant, C.; Clementi, L.; Ren, J.; Li, W.; Noble, W. MEME SUITE: Tools for motif discovery and searching. Nucleic Acids Res. 2009, 37, 202–208. [Google Scholar] [CrossRef] [Scilit]
- Kain, W.C.; Zhao, J.-Z.; Janmaat, A.F.; Myers, J.; Shelton, A.M.; Wang, P. Inheritance of resistance to Bacillus thuringiensis Cry1Ac toxin in a greenhouse-derived strain of cabbage looper (Lepidoptera: Noctuidae). J. Econ. Entomol. 2004, 97, 2073–2078. [Google Scholar] [CrossRef] [Scilit]
- Luo, K.; Banks, D.; Adang, M. Toxicity, binding, and permeability analyses of four Bacillus thuringiensis Cry1 δ-endotoxins using brush border membrane vesicles of Spodoptera exigua and Spodoptera frugiperda. Appl. Environ. Microbiol. 1999, 65, 457–464. [Google Scholar] [CrossRef] [Scilit]
- Culver, J.J. The Value of the Dry Substitutes for Liquid Lime Sulphur as a Control for San Jose Scale. J. Econ. Entomol. 1925, 18, 265. [Google Scholar] [CrossRef] [Scilit]
- Tabashnik, B.E.; Cushing, N.L.; Johnson, M.W. Diamondback Moth (Lepidoptera: Plutellidae) Resistance to Insecticides in Hawaii: Intra-Island Variation and Cross-Resistance. J. Econ. Entomol. 1987, 80, 1091–1099. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Jiang, W.; Liu, Q.; Sun, R. Establishment of a High Throughput Method for Detecting Methionine Aminopeptidase Activity. Food Ferment. Ind. 2012, 38, 138–142. (In Chinese) [Google Scholar] [CrossRef]







| Primer | Sequence (5′→3′) |
|---|---|
| MetAP1-CDS-F1 | ATGGCCGGAATTGGAATGTGCG |
| MetAP1-CDS-R1 | TCATCGAGCACCTCGCGTC |
| MetAP1-CDS-F2 | GCCTGGTCCGAAGCGTACG |
| MetAP1-CDS-R2 | CTTGCACCAGCCGCTGG |
| MetAP1-CDS-F3 | CACGGAATTCCTGATCTGAGGCC |
| MetAP1-CDS-R3 | CTAGGAGTTTAGCTTCTCCATTTGGTCC |
| Q-MetAP1-F | AGCTCGGCATACAAGGCTCG |
| Q-MetAP1-R | TGTGAACCCGTACGACGGCC |
| RPL32-F | CCAATTTACCGCCCTACC |
| RPL32-R | TACCCTGTTGTCAATACCTCT |
| MetAP1-GL-F | CACGGAATTCCTGATCTGAGGCC |
| MetAP1-GL-R | CTTGCACCAGCCGCTGG |
| MetAP1-sgRNA1-F | TAATACGACTCACTATAGGAGGGTGCTGATGGAGCGAGTTTTAGAGCTAGAAATAGCAAGTTAA |
| MetAP1-sgRNA2-F | TAATACGACTCACTATAGGCCGACGCCGGGAACCCGGTCGTTTTAGAGCTAGAAATAGCAAGTTAA |
| MetAP1-sgRNA-R | AGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ye, M.; Xiong, L.; Dong, Y.; Xie, C.; Zhang, Z.; Shen, L.; Li, Z.; Yue, Z.; Jiang, P.; Yuchi, Z.; et al. The Potential Role of the Methionine Aminopeptidase Gene PxMetAP1 in a Cosmopolitan Pest for Bacillus thuringiensis Toxin Tolerance. Int. J. Mol. Sci. 2022, 23, 13005. https://doi.org/10.3390/ijms232113005
Ye M, Xiong L, Dong Y, Xie C, Zhang Z, Shen L, Li Z, Yue Z, Jiang P, Yuchi Z, et al. The Potential Role of the Methionine Aminopeptidase Gene PxMetAP1 in a Cosmopolitan Pest for Bacillus thuringiensis Toxin Tolerance. International Journal of Molecular Sciences. 2022; 23(21):13005. https://doi.org/10.3390/ijms232113005
Chicago/Turabian StyleYe, Min, Lei Xiong, Yi Dong, Chao Xie, Zhen Zhang, Lingling Shen, Zeyun Li, Zhen Yue, Puzi Jiang, Zhiguang Yuchi, and et al. 2022. "The Potential Role of the Methionine Aminopeptidase Gene PxMetAP1 in a Cosmopolitan Pest for Bacillus thuringiensis Toxin Tolerance" International Journal of Molecular Sciences 23, no. 21: 13005. https://doi.org/10.3390/ijms232113005
APA StyleYe, M., Xiong, L., Dong, Y., Xie, C., Zhang, Z., Shen, L., Li, Z., Yue, Z., Jiang, P., Yuchi, Z., You, M., & You, S. (2022). The Potential Role of the Methionine Aminopeptidase Gene PxMetAP1 in a Cosmopolitan Pest for Bacillus thuringiensis Toxin Tolerance. International Journal of Molecular Sciences, 23(21), 13005. https://doi.org/10.3390/ijms232113005

