Next Article in Journal
Osr1 Is Required for Mesenchymal Derivatives That Produce Collagen in the Bladder
Next Article in Special Issue
Gut-Microbial Metabolites, Probiotics and Their Roles in Type 2 Diabetes
Previous Article in Journal
The Genetic, Environmental, and Immunopathological Complexity of Autoantibody-Negative Rheumatoid Arthritis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 22
Issue 22
10.3390/ijms222212388
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Protective Effects of Lactobacillus plantarum Lac16 on Clostridium perfringens Infection-Associated Injury in IPEC-J2 Cells

by
Yuanhao Zhou
1,
Baikui Wang
1,
Qi Wang
1,
Li Tang
1,
Peng Zou
1,
Zihan Zeng
1,
Huihua Zhang
2,
Li Gong
1,2,* and
Weifen Li
1,*
1
Key Laboratory of Molecular Animal Nutrition of the Ministry of Education, Key Laboratory of Animal Nutrition and Feed Science (Eastern of China) of the Ministry of Agriculture, Key Laboratory of Animal Feed and Nutrition of Zhejiang Province, Institute of Animal Nutrition and Feed Sciences, College of Animal Sciences, Zhejiang University, Hangzhou 310058, China
2
Department of Animal Sciences, School of Life Science and Engineering, Foshan University, Foshan 528225, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2021, 22(22), 12388; https://doi.org/10.3390/ijms222212388
Submission received: 26 September 2021 / Revised: 10 November 2021 / Accepted: 12 November 2021 / Published: 17 November 2021
(This article belongs to the Special Issue The Effect of Probiotics on Gut Homeostasis Regulation 2.0)
Browse Figures
Review Reports Versions Notes

Abstract

:
Clostridium perfringens (C. perfringens) causes intestinal injury through overgrowth and the secretion of multiple toxins, leading to diarrhea and necrotic enteritis in animals, including pigs, chickens, and sheep. This study aimed to investigate the protective effects of Lactobacillus plantarum (L. plantarum) Lac16 on C. perfringens infection-associated injury in intestinal porcine epithelial cell line (IPEC-J2). The results showed that L. plantarum Lac16 significantly inhibited the growth of C. perfringens, which was accompanied by a decrease in pH levels. In addition, L. plantarum Lac16 significantly elevated the mRNA expression levels of host defense peptides (HDPs) in IPEC-J2 cells, decreased the adhesion of C. perfringens to IPEC-J2 cells, and attenuated C. perfringens-induced cellular cytotoxicity and intestinal barrier damage. Furthermore, L. plantarum Lac16 significantly suppressed C. perfringens-induced gene expressions of proinflammatory cytokines and pattern recognition receptors (PRRs) in IPEC-J2 cells. Moreover, L. plantarum Lac16 preincubation effectively inhibited the phosphorylation of p65 caused by C. perfringens infection. Collectively, probiotic L. plantarum Lac16 exerts protective effects against C. perfringens infection-associated injury in IPEC-J2 cells.

1. Introduction

Clostridium perfringens (C. perfringens) is a Gram-positive, spore-forming, anaerobic, rod-shaped bacterium [1,2], which can be isolated from the natural environment (e.g., soil) and intestines of human and animals as a component of the normal microbial community [3,4]. However, C. perfringens is an opportunistic pathogen that can cause various intestinal diseases under certain conditions, such as its overgrowth or disruption of the intestinal microbiota [5,6,7]. C. perfringens strains could secrete more than twenty toxins or enzymes, which are principal virulence factors [8]. Based on the secretion of four major toxins (α, β, ε, and ι), C. perfringens can be grouped into five different toxin types (types A to E) [9]. Among them, C. perfringens type A is very common in the intestines of warm-blooded animals; however, it also could cause intestinal diseases in domestic animals, such as pigs, chickens, and sheep [3,10]. Its symptoms in piglets include severe diarrhea, accompanied by necrotic mucosa and intestinal villi atrophy [11,12]. It is worth mentioning that antibiotics play a critical role in the prevention and clinical treatment of diseases caused by C. perfringens [13,14]. However, under the situation of feed antibiotics prohibition, C. perfringens infection has become an important problem, hindering the development of the pig industry [13,15,16]. Nowadays, many feed additives are used in animal husbandry to prevent C. perfringens infection, such as probiotics, prebiotics, symbiotics, essential oils, and herbs [17,18,19,20].
Probiotics are defined as “live microorganisms that, when administered in adequate amounts, confer a health benefit on the host” [21]. In animal husbandry, beneficial effects of probiotics are mainly reflected in nutrition and immunity [22]. They promote animal health by regulating immune functions and maintaining the dynamic balance of intestinal microbiota [23,24]. Some studies reported that probiotics, especially Lactobacillus spp., exerted protective effects against C. perfringens infection in vivo and in vitro. For example, Lactobacillus acidophilus (L. acidophilus) and L. fermentum inhibited the growth and α-toxin production capacity of C. perfringens in vitro [25]. Furthermore, L. fermentum, L. salivarius, L. plantarum, and L. acidophilus inhibited C. perfringens infection-associated necrotic enteritis of broilers by improving intestinal barrier integrity, reducing lesions, ameliorating inflammation, as well as modulating intestinal microbiota [26,27,28,29].
Our previous study also found that L. plantarum Lac16 effectively protected broilers against C. perfringens infection [30]. However, it has not been proved whether L. plantarum Lac16 can protect pig intestines in cases of C. perfringens infection. The intestinal porcine epithelial cell line (IPEC-J2) has exhibited a high specificity in pig studies and is a suitable model for investigating the interactions between bacteria and intestinal epithelia in vitro [31,32]. Thus, this study aimed to investigate the protective effects of L. plantarum Lac16 on C. perfringens infection-associated injury in IPEC-J2 cells.

2. Results

2.1. L. plantarum Lac16 Inhibited the Growth and Biofilm Formation of C. perfringens

Probiotics could produce antimicrobial substances and lower the environmental pH to resist pathogen infections [25]. As shown in Figure 1A, the positive group (100 µg/mL of ampicillin) exhibited the best bacteriostatic effect on C. perfringens, while L. plantarum Lac16 fermentation supernatant (LFS) also exhibited good bacteriostatic effects, forming a clear boundary of bacteriostatic zone. At the same time, as shown in Figure 1B, after 12 h of culture, the optical density (OD600) of the CP group increased sharply. However, in the group of C. perfringens co-incubated with the LFS, the OD600 was significantly lower than that of the CP group (p < 0.001), indicating that LFS could inhibit the proliferation of C. perfringens. In addition, LFS significantly inhibited the biofilm formation of C. perfringens (p < 0.001; Figure 1C). At the same time, we found that the inhibitory effects of L. plantarum Lac16 are different from those of some other probiotics (e.g., Bacillus licheniformis (B. licheniformis), B. coagulans, C. butyricum) that could not inhibit the growth (p > 0.05; Figures S1 and S2A) and biofilm formation of C. perfringens (p > 0.05; Figure S2B). Moreover, the colony forming units (CFUs) of C. perfringens in the co-culture group were significantly decreased when compared to the CP group (p < 0.05; Figure 1D), and the pH value in the co-culture group was lower than that of the CP group (p < 0.01; Figure 1E).

2.2. L. plantarum Lac16 Enhanced mRNA Expression of Host Defense Peptides (HDPs) in IPEC-J2 Cells

It is well known that intestinal epithelial cells and phagocytes could secrete HDPs to maintain the homeostasis in the intestine [33,34,35]. Co-incubation with L. plantarum Lac16 could increase the expression levels of HDP genes in IPEC-J2 cells, including porcine β-defensin (pBD1, pBD2, pBD3) and porcine epididymis protein 2 splicing variant C (pEP2C) (Figure 2). Specifically, the highest expression level of pBD1 was observed in the group co-incubated with L. plantarum Lac16 at the concentration of 107 CFU/mL (p < 0.001; Figure 2A). At the same time, the trend in pBD2 gene expression level was similar (p < 0.05, Figure 2B). Gene expression levels of pBD3 and pEP2C were significantly elevated in a concentration-dependent manner of L. plantarum Lac16 (p < 0.05; Figure 2C,D). Therefore, the concentration (107 CFU/mL) of L. plantarum Lac16 was selected for the follow-up experiments.

2.3. L. plantarum Lac16 Alleviated C. perfringens Infection-Associated Lactate Dehydrogenase (LDH) Leakage

LDH leakage is an important indicator of cell membrane damage [36]. When the intestinal epithelial cells are infected with C. perfringens, LDH, which is a stable cytoplasmic enzyme, will rapidly release into the extracellular environment [25,37]. The results of LDH leakage showed that pretreatment with L. plantarum Lac16 did not increase LDH release (p > 0.05; Figure 3A), whereas LDH release in the CP group was significantly elevated (p < 0.01), which was alleviated by preincubation with L. plantarum Lac16 (p < 0.01). At the same time, it is worth mentioning that C. butyricum, a probiotic which had no inhibitory effect on C. perfringens in our previous study, also did not possess this alleviated effect on the increased LDH release (p > 0.05; Figure S2C). In addition, the increased LDH release induced by C. perfringens infection for 3 h was not alleviated to normal levels by L. plantarum Lac16 preincubation (p < 0.001). Therefore, for subsequent experiments, IPEC-J2 cells infected with C. perfringens for 1 h were selected as the time point for sampling.

2.4. L. plantarum Lac16 Suppressed the Adhesion of C. perfringens to IPEC-J2 Cells

In the occurrence of infection, pathogens need to adhere to the host epithelial cells [38]. For the bacterial adhesion assay, the adhesion rate in the CP group (IPEC-J2 cells were only co-incubated with C. perfringens) was defined as 100% (Figure 3B). However, preincubation with L. plantarum Lac16 could significantly decrease the adhesion rate of C. perfringens to IPEC-J2 (p < 0.05). Similar results were obtained in the images of the fluorescence labeling method (Figure 3C). The quantity of fluorescent labeled pathogens that adhered to IPEC-J2 cells in the CP group was significantly larger than that of the group pretreated with L. plantarum Lac16 (p < 0.01; Figure 3D).

2.5. L. plantarum Lac16 Attenuated C. perfringens-Induced Damage to Intestinal Epithelial Barrier Function

To evaluate C. perfringens-induced damage to intestinal epithelial barrier function and the corresponding protective effects of L. plantarum Lac16, we determined the flux of fluorescein sodium, mucin production, and the expression levels of tight junction proteins in IPEC-J2 cells. When cells developed tight junctions and completely differentiated into tight monolayers, they were infected with C. perfringens. The significant increased flux of fluorescein sodium was observed in the CP group (p < 0.001; Figure 4A). It is worth mentioning that fluorescein sodium is not transported through the tight monolayers by membrane transporters or channels expressed in the mammalian epitheliums, but leaks through the intercellular cracks formed after tight junction injury [39,40]. However, L. plantarum Lac16 pretreatment significantly alleviated the increase in apparent permeability coefficient (Papp) of the IPEC-J2 monolayers induced by C. perfringens infection (p < 0.001). In addition, the results of periodic acid–Schiff (PAS) staining showed that C. perfringens infection significantly inhibited mucin production, which was effectively reversed by L. plantarum Lac16 pretreatment (Figure 4B). At the same time, C. perfringens infection sharply decreased the mRNA expression level of Mucin 2 in IPEC-J2 cells (p < 0.05), while it was effectively alleviated by preincubation with L. plantarum Lac16 (p < 0.05; Figure 4C).
The results of the expression levels of tight junction proteins in IPEC-J2 cells showed that, compared with the control group, the expression of claudin-1 was significantly elevated by L. plantarum Lac16 treatment (p < 0.05), whereas it was significantly suppressed by C. perfringens infection (p < 0.01; Figure 4D and Figure S3). At the same time, L. plantarum Lac16 preincubation significantly alleviated the decrease in protein expressions caused by C. perfringens infection (p < 0.01). However, there was no significant difference in occludin expression among all groups (p > 0.05). Regarding immunofluorescence images of ZO-1 (Figure 4E), it was found that ZO-1 expression level was not affected by L. plantarum Lac16, whereas it was significantly suppressed by C. perfringens infection (p < 0.01; Figure 4F). However, this phenomenon was attenuated by pretreatment with L. plantarum Lac16 (p < 0.01).

2.6. L. plantarum Lac16 Alleviated C. perfringens-Induced Inflammatory Response

One of the salient features of pathogen infections in the host immune system is the intense inflammatory response [41,42]. The results of mRNA expression levels of inflammatory cytokines in IPEC-J2 cells showed that L. plantarum Lac16 could significantly elevate mRNA expression levels of interleukin (IL)-6 and IL-8 (p < 0.05; Figure 5B,C), while C. perfringens infection sharply elevated gene expression levels of IL-1β, IL-6, IL-8, and tumor necrosis factor (TNF)-α much more (p < 0.01; Figure 5A–D), which was significantly alleviated by preincubation with L. plantarum Lac16 (p < 0.05), especially for IL-8 and TNF-α (p < 0.001).

2.7. L. plantarum Lac16 Alleviated the Increase in mRNA Expression Levels of Pattern Recognition Receptors (PRRs) Induced by C. perfringens Infection

Intestinal epithelial cells could express PRRs, which enable them to act as dynamic sensors of the microbial environment and foreign antigens [43]. PRRs, including Toll-like receptors (TLRs) and NOD-like receptors (NLRs), could initiate the activation of intracellular signaling pathways, thereby increasing the expression and release of chemokines, cytokines, and antibacterial peptides [44]. The results of mRNA expression levels of PRRs in IPEC-J2 cells showed that both L. plantarum Lac16 and C. perfringens could significantly up-regulate mRNA expression levels of TLRs (p < 0.05; Figure 6A–C). The most significant increase in mRNA expression levels of TLRs was in the group infected with C. perfringens only. However, the increased mRNA expression (TLR1 and TLR2) caused by C. perfringens infection was effectively inhibited (p < 0.01) by co-incubation with L. plantarum Lac16. The trend in mRNA expression levels of nucleotide-binding oligomerization domains (NODs) was similar to that of TLRs (Figure 6D,E). Although both bacteria increased NOD1 gene expression (p < 0.001), preincubation with L. plantarum Lac16 significantly reduced the increased gene expression associated with C. perfringens infection (p < 0.01; Figure 6D). However, this effect was not significant in NOD2 gene expression (p > 0.05; Figure 6E).

2.8. L. plantarum Lac16 Alleviated Inflammatory Response Induced by C. perfringens Infection by Nuclear Factor Kappa B (NF-κB) Signaling Pathways

To investigate the potential signaling pathway that led to the release of inflammatory cytokines, phosphorylation levels of certain proteins of the mitogen-activated protein kinase (MAPK) and NF-κB were determined (Figure 7 and Figure S3). It was found that C. perfringens infection enhanced the phosphorylation of p38, c-Jun NH 2-terminal kinase (JNK), as well as p65 when compared to the control group (p < 0.05). Moreover, preincubation with L. plantarum Lac16 significantly inhibited C. perfringens infection-associated p65 phosphorylation (p < 0.001). In addition, the phosphorylation of extracellular signal-regulated kinase (ERK) in each group did not change significantly (p > 0.05).

3. Discussion

Probiotics provide benefits to the host through various mechanisms, including producing anti-bacterial substances, competing with pathogenic microorganisms for enterocyte binding, regulating the secretion of pro- and anti-inflammatory cytokines, and maintaining intestinal barrier integrity [45]. Several studies indicated that Lactobacillus spp. could prevent the infection of pathogenic bacteria, including Escherichia coli, C. perfringens, and Salmonella Enteritidis [25,45,46,47]. Previously, we found that L. plantarum Lac16 exhibited protective effects against C. perfringens infection in broilers [30]. In this study, we have shown that L. plantarum Lac16 inhibits the growth of C. perfringens and attenuates C. perfringens infection-associated intestinal injury in IPEC-J2 cells.
Probiotics exert antimicrobial activities by secreting antimicrobial substances, such as bacteriocins, organic acids, and hydrogen peroxide [48]. Cell-free supernatants contain antimicrobial substances secreted by probiotics, which can effectively inhibit the growth of various pathogens [49]. In addition, C. perfringens strains form biofilms to enhance their persistence and increase resistance to various stressors, such as oxidative and antibiotic stress [50], and this phenomenon has been proved to be involved in a large proportion of bacterial infections [51]. In the current study, it was found that the fermentation supernatant of L. plantarum Lac16 could inhibit the growth of C. perfringens, and significantly suppress C. perfringens biofilm formation. Moreover, the antimicrobial activity of L. plantarum is associated with the production of organic acids, which decreases environmental pH [52]. C. perfringens is a pH sensitive bacterium [53]. Acidic environments down-regulate the expression of virulence factors of C. perfringens while inhibiting its growth [53,54]. These findings indicate that L. plantarum Lac16 and its metabolites decreased environmental pH and inhibited biofilm formation as well as the growth of C. perfringens.
HDPs, as important components of the innate immune system, play critical roles in infection resistance [33]. They are mainly secreted by intestinal epithelial cells and phagocytes in the gastrointestinal tract [34]. HDPs are involved in the maintenance of intestinal homeostasis and innate immune defenses during infection through multiple mechanisms. Specifically, HDPs secreted by intestinal epithelial cells exert direct antimicrobial effects on invading bacterial pathogens and intestinal microbiota [35]. Several studies indicated that Lactobacillus spp. enhance the expression of HDPs [55,56,57]. Increased secretion of endogenous HDPs improves early immune system responses to pathogenic infections and inflammation [58]. In this study, L. plantarum Lac16 promoted the expression of endogenous HDPs in IPEC-J2 cells, which is consistent with results observed by Wang et al. that L. plantarum ZLP001 enhanced intestinal defense responses by promoting the secretion of HDPs [34].
LDH is a stable cytoplasmic enzyme that possesses oxidation–reduction activities. When cells are subjected to cell membrane damage that is caused by intracellular or extracellular stress, LDH will rapidly release into the extracellular environment [37]. Alpha toxin, which is produced by C. perfringens type A, can result in extensive degradation of the plasma membrane, leading to LDH release [59]. Elevated LDH release is a key feature of apoptosis, necrosis, and other forms of cellular damage [60,61]. In this study, it was found that C. perfringens infection elevated LDH release from IPEC-J2 cells, implying that C. perfringens damaged the intestinal epithelial cells, resulting in intracellular enzyme leakage. At the same time, when cells were infected with C. perfringens for 1 h, the increased LDH release was effectively alleviated to the normal level by L. plantarum Lac16 preincubation. This phenomenon may be related to L. plantarum Lac16 directly inhibiting the growth of C. perfringens and suppressing C. perfringens adhesion to IPEC-J2 cells, and indirectly inducing IPEC-J2 cells to produce antimicrobial substances to resist C. perfringens infection, such as HDPs. Similar protective results have been reported by some studies [62,63,64,65]. However, when the cells were infected with C. perfringens for 3 h, L. plantarum Lac16 preincubation did not reduce the LDH release to the normal level, implying that the damage of C. perfringens to intestinal epithelial cells was beyond the protective effects of L. plantarum Lac16 preincubation.
Pathogenic adherence to host epithelial cells is an indispensable step in the occurrence of infection [38]. In the meantime, Lactobacillus could effectively prevent pathogenic adhesion to intestinal epithelial cells and play an important role in maintaining intestinal homeostasis [66]. Thus, one way for Lactobacillus to exert its antibacterial activity is by occupying the adhesion site of pathogens to intestinal epithelial cells [67]. Probiotic adhesion to intestinal epithelial cells can optimize the balance and activities of intestinal microbiota [68]. It is worth mentioning that the adherence of C. perfringens strains increases toxin production [69]. In this study, L. plantarum Lac16 significantly suppressed C. perfringens adhesion to IPEC-J2 cells, thereby resisting C. perfringens infection and protecting intestinal epithelial cells. This finding is similar to that of another study, which showed that L. rhamnosus effectively inhibited the adhesion of C. perfringens to pig intestinal mucosa [70].
Epithelial cells form a layer that acts as a physical barrier connected by tight junctions between each cell [71]. In addition, the mucus layer covering the surface of the intestinal epithelium also plays a crucial role in protecting intestinal epithelial barrier integrity [72]. The main components of tight junction proteins are claudins, zona occludens, and occludin [73]. Tight junctions regulate the paracellular transport of various substances, such as ions, solutes, molecules, and water, across the intestinal epithelium [74], thereby maintaining physiological functions of epithelial cells [75]. Probiotics and pathogens can alter the expression of tight junctions [75,76]. Moreover, the dysregulation of tight junction protein integrity enhances intestinal barrier permeability [77]. It is worth noting that virulence factors, which are produced by C. perfringens, could effectively impair tight junctions [15,78]. In this study, L. plantarum Lac16 preincubation attenuated C. perfringens-induced disruption of mucus production. In addition, C. perfringens infection suppressed the expression levels of claudin-1 and ZO-1, which were effectively alleviated by L. plantarum Lac16 preincubation. Our results are consistent with those of studies reporting on the effects of probiotics in the alleviation of intestinal barrier dysfunction caused by pathogens [45,72,79]. It is worth mentioning that C. perfringens enterotoxin (CPE), a pore-forming toxin that could disrupt the selective permeability of the plasma membrane of target cells and result in cell death, interacts with claudins to impair tight junction barrier function [80]. At the same time, scaffolding proteins such as ZO-1 and signaling proteins are associated with tight junctions by binding their PDZ-domains to respective binding motifs at the C-terminus of claudins [81,82]. In our opinion, the structure between ZO-1 and claudins causes them to have the same trend of change. However, we cannot give a reasonable explanation at present for the result that the protein expressions of occludin did not change. Moreover, it had been reported that it is not possible to investigate porcine intestinal barrier function well using the existing IPEC-J2 model because of its atypically high transepithelial resistances and low active transport rates [83]. These existing defects require us to find more suitable in vitro models or carry out animal experiments in future studies.
Infections with pathogenic microbes, such as C. perfringens, often lead to significant inflammatory responses [41,42]. Pro-inflammatory cytokines mediate inflammatory responses to invading pathogens through multiple modulatory mechanisms, such as lymphocyte activation, neutrophil migration, and cell proliferation [84]. However, excess secretion of pro-inflammatory cytokines has deleterious effects on the host [85]. In this study, although L. plantarum Lac16 elevated the expression levels of pro-inflammatory cytokines, such as IL-6 and IL-8, preincubation with L. plantarum Lac16 significantly inhibited C. perfringens-associated inflammatory responses, which was consistent with our previous results that L. plantarum Lac16 alleviated C. perfringens infection-associated inflammatory responses in the ileum mucosa of broilers [30]. In general, we postulate that one of the mechanisms through which L. plantarum Lac16 protects intestinal epithelial cells from C. perfringens injury is by relieving inflammation.
PRRs, including TLRs and NLRs, are important receptor molecules in the host immune system [86]. PRRs play a crucial protective role in the immune system via identifying pathogen-associated molecular patterns (PAMPs), such as bacterial nucleic acids and flagellin, to resist pathogenic infections [87]. Furthermore, PRRs initiate the activation of intracellular signaling pathways, thereby increasing the expression and release of chemokines, cytokines, and antibacterial peptides [44]. It is worth mentioning that TLRs play a crucial role in the regulation of mucosal immune responses and the maintenance of intestinal homeostasis [88]. At the same time, when pathogens gain entry into the cytoplasm, NLRs have been shown to initiate innate immune responses [89]. In the current study, we found that L. plantarum Lac16 elevated the expression levels of TLRs. Changes in expression levels of TLRs in intestinal epithelial cells regulate β-defensin expression [90], corresponding to our above findings that L. plantarum Lac16 enhances the expression of endogenous HDPs. The C. perfringens challenge sharply elevated the mRNA expression levels of TLR1, TLR2, and TLR4, whereas preincubation with L. plantarum Lac16 attenuated this dramatic increase. Furthermore, L. plantarum Lac16 alleviated C. perfringens-induced elevations in NOD1 expression, in tandem with other studies showing that probiotics attenuate pathogen-associated elevations in PRR expression [45,91]. In our opinion, L. plantarum Lac16 activates PRR-dependent signaling pathways and strengthens the immune system to resist C. perfringens infection.
High expression levels of PRRs and cytokines are accompanied by the activation of MAPK and NF-κB signaling pathways [92,93]. MAPK signaling pathways are signal transduction modules that transform extracellular signals into intracellular responses that regulate the processes of cell growth, differentiation, and migration [94,95]. In addition, MAPK plays a crucial role in modulating the synthesis and release of inflammatory mediators during inflammatory responses [96,97]. Elevated expressions of PRRs enhance the phosphorylation of MAPK [98,99]. In addition, NF-κB, an important transcription factor, is a key factor for modulating the expression of genes and proteins involved in inflammatory responses [100]. For example, the production of proinflammatory cytokines, such as TNF-α, is closely associated with the activation of NF-κB [101]. Probiotics have also been shown to exert their protective mechanisms against pathogenic infections by modulating the NF-κB signaling pathways [45,102,103]. In the current study, C. perfringens infection significantly elevated p38, JNK, and p65 phosphorylation in IPEC-J2 cells. However, preincubation with L. plantarum Lac16 did not significantly attenuate C. perfringens-induced p38 and JNK phosphorylation, but significantly attenuated the increase in p65 phosphorylation. The above results indicated that C. perfringens-induced inflammatory responses are mediated by MAPK and NF-κB signaling pathways, and L. plantarum Lac16 prevents C. perfringens infection-associated excess immune responses by attenuating p65 NF-κB phosphorylation.
In summary, L. plantarum Lac16 attenuated C. perfringens-induced injury in IPEC-J2 cells via several mechanisms, including inhibiting the growth and biofilm formation of C. perfringens, preventing its adhesion to epithelial cells, promoting the expressions of endogenous host defense peptides, protecting intestinal epithelial barrier integrity, and alleviating inflammatory responses by attenuating p65 NF-κB phosphorylation. These findings highlight the significance of L. plantarum Lac16 as a potential therapeutic strategy against C. perfringens infection and provide a theoretical basis for the application of L. plantarum Lac16 in animal husbandry to resist pathogen infections.

4. Materials and Methods

4.1. Bacterial Strains and Culture Conditions

L. plantarum Lac16 was isolated by our laboratory and preserved at the China Center for Type Culture Collection (CCTCC, No. M2016259). L. plantarum Lac16 was cultured in MRS medium and incubated at 37 °C for 18 h. C. perfringens type A (ATCC 13124) was cultured in Reinforced clostridium medium (RCM; Hopebio, Qingdao, China) and incubated at 37 °C under anaerobic conditions for 18 h. The overnight-incubated bacterial cultures were centrifuged at 5000 rpm for 5 min. After being washed three times using sterile phosphate-buffered saline (PBS, pH = 7.2), bacteria were resuspended in PBS and their concentrations were determined using a standard curve. Then, they were diluted to a certain concentration and stored at 4 °C for further use.

4.2. Bacteriostasis Detection of LFS to C. perfringens

Agar diffusion was performed as previously described by Wang et al. [34] with some modifications to perform the bacteriostasis detection. Briefly, L. plantarum culture was centrifuged at 5000 rpm for 10 min to obtain the supernatant, which was then filtered through a 0.22 μm membrane to remove suspended bacteria and stored at 4 °C. About 0.2% (v/v) of the overnight culture of C. perfringens was added to TSC agar (Hopebio, Qingdao, China), which cooled down to about 50 °C. Then, the medium was well mixed and poured into plastic plates, which placed oxford cups in advance. The oxford cups were removed after the medium had solidified. Then, 100 µL of LFS was injected into each well, and plates were placed in anaerobic gas generating packs (Hopebio, Qingdao, China) for 12 h. This bacteriostatic experiment was performed in triplicate.

4.3. Determination of Biofilm Formation of C. perfringens

Biofilm formation of C. perfringens was determined as previously described by Jiang et al. [104] with some modifications. L. plantarum and C. perfringens were cultured in modified RCM medium (glucose content was increased to 20 g/L on the original basis) and incubated at 37 °C for 18 h, respectively. Then, the concentration of the C. perfringens culture was adjusted to 107 CFU/mL using the medium, and the supernatant of L. plantarum was collected as described above. Experimental groups were treated as: Control: Sterile modified RCM medium (200 μL) was inoculated into 96-well culture plates; LFS: LFS (100 μL) and 100 μL of medium were inoculated; Cp: Resuspended C. perfringens (100 μL) and 100 μL of medium were inoculated; LFS + Cp: LFS (100 μL) and 100 μL of resuspended C. perfringens were inoculated, respectively. The 96-well culture plate was incubated in an anaerobic environment at 37 °C for 12 h, and the bacterial proliferation index was measured at OD600 using SpectraMax M5 (Molecular Devices, Sunnyvale, CA, USA). Then, bacterial cultures were removed with caution, and the bacteria in wells were gently washed thrice using PBS and incubated with 100 μL of 1% crystal violet for 30 min. After that, crystal violet was removed and wells were gently washed thrice. Then, 100 μL of 95% alcohol was added into the wells to dissolve excess crystal violet. At last, OD590 values in each well were measured. The higher the optical density, the more biofilm formation. Experiments were performed in triplicate.

4.4. Co-Culture Experiment and pH Determination of Bacterial Cultures

Bacterial co-culture experiments were performed as previously described by Guo et al. [25] with some modifications. L. plantarum or C. perfringens suspensions (100 μL, 107 CFU/mL) or both 100 μL of them were inoculated in modified RCM medium (the final volume is 10 mL), respectively. The above cultures were incubated at 37 °C for 12 h, and their pH values were determined. At the same time, the cultures were serially diluted, cultured on TSC agar, and incubated at 37 °C for 12 h to enumerate CFU. These experiments were performed in triplicate.

4.5. IPEC-J2 Cells Culture

IPEC-J2 cells were cultured in Dulbecco’s modified Eagle’s F12 ham medium (DMEM/F12; Gibco, Waltham, MA, USA) supplemented with 10% (v/v) fetal bovine serum (FBS; Gibco, MA, USA), 100 μg/mL streptomycin, and 100 U/mL penicillin (Sigma-Aldrich, St Louis, MO, USA). Incubation was performed at 37 °C in an atmosphere of 90% humidity and 5% CO2. When cell confluence reached 80%, cells were digested using 0.25% trypsin–EDTA solution (Gibco, MA, USA) and seeded in cell culture plates.

4.6. Determination of Expression Levels of HDPs by Real-Time PCR

IPEC-J2 cells were seeded in 12-well cell culture plates (Corning Life Science, Acton, MA, USA) at a density of 5 × 105 cells/well. L. plantarum cultures were centrifuged and resuspended in DMEM/F12 supplemented with 10% FBS and stored at 4 °C. When IPEC-J2 cells reached 80% confluence, they were co-incubated in cell culture media containing different concentrations of L. plantarum Lac16 (106, 107, and 108 CFU/mL) for 6 h. After being washed three times using PBS, IPEC-J2 cells were lysed by RNAiso Plus (Takara, Dalian, China) to extract RNA. Expression levels of pBD1, pBD2, pBD3, and pEP2C were then determined by real-time PCR. At the same time, untreated IPEC-J2 cells were used as the control group. β-actin was selected as an endogenous control and relative gene expressions were analyzed using the 2−ΔΔCt method [105]. All experiments were performed in triplicate.

4.7. Cytotoxicity Assay

IPEC-J2 cells were seeded in 12-well culture plates at a density of 5 × 105 cells/well. When cells reached 80% confluence, they were incubated with or without L. plantarum (107 CFU/mL) for 6 h, respectively. After being washed three times using PBS, cells were infected with C. perfringens (106 CFU/well) under anaerobic conditions for 1 h or 3 h, respectively. Then, cell suspensions were collected and centrifuged at 10,000 rpm/min for 5 min to remove cell debris and bacteria. The release of LDH from damaged cells was measured using the LDH kit (Nanjing Jiancheng Biological Product, Nanjing, China), according to the manufacturer’s instructions. Experiments were performed in triplicate.

4.8. Determination of C. perfringens Adhesion to IPEC-J2 Cells

Bacterial adhesion assay was performed as previously described by Jiang et al. [104] with some modifications. Briefly, IPEC-J2 cells were seeded in 12-well cell culture plates at a density of 5 × 105 cells/well. At 80% confluence, cells were preincubated with L. plantarum (107 CFU/mL) for 6 h, after which C. perfringens were added into the wells (106 CFU/mL) and incubated for 1 h under anaerobic conditions. Cells treated with C. perfringens only were used as the controls. Then, cells were washed three times using sterile PBS to remove non-adherent C. perfringens. Two hundred microliters of 0.25% trypsin-EDTA solution was added to the wells and digested for 15 min; then, 800 μL sterile PBS was added to each well and completely mixed. The mixed liquids were diluted for C. perfringens count. Each assay was performed in triplicate.
At the same time, the FITC (Solarbio, Beijing, China) labeling method was used to assay the adhesion of C. perfringens to IPEC-J2 cells. Briefly, C. perfringens culture, after centrifugation, was adjusted to 107 CFU/mL with diluted FITC solution (200 μg/mL), and incubated for 2 h at 37 °C without light. Then, the bacteria were washed with sterile PBS for three times and stored at 4 °C for further use. After incubation with L. plantarum Lac16 for 6 h, the IPEC-J2 cells were further co-incubated with C. perfringens (106 CFU/mL), which was labeled with FITC, for 1 h under anaerobic conditions and away from light. Then, the cells were washed three times with sterile PBS and examined under a fluorescence microscope (Nikon, Tokyo, Japan). Mean relative fluorescence intensity of FITC was determined using the ImageJ software (version 1.51, National Institute of Health, Bethesda, MD, USA). All experiments were performed in triplicate.

4.9. Cell Permeability to Fluorescein Sodium

Cell permeability to fluorescein sodium was assayed as previously described by Nie et al. [106] with some modifications. Briefly, IPEC-J2 cells were seeded in 12-well transwell inserts (Corning Life Science, MA, USA), with pore sizes of 0.4 mm and membrane areas of 1.12 cm2, at a concentration of 1 × 105 cells/mL. Since IPEC-J2 cells can develop tight junctions and differentiate into tight monolayers after 9 days of culture on transwell filters [31], the culture medium in both apical and basolateral sides of the filters was renewed every 24 h for 9 days. On the 10th day, the culture medium on the apical side of the filters was removed and IPEC-J2 cells were treated as described in adhesion assay section. Then, 100 μg/mL fluorescein sodium (Sigma-Aldrich, MO, USA), dissolved in PBS, was added to the apical inserts for 1 h, after which 200 μL of medium from each basolateral side was collected. Fluorescence intensity was determined using a SpectraMax M5 (Molecular Devices, CA, USA) at an excitation wavelength of 495 nm and an emission wavelength of 525 nm. Then, we calculated apical to basolateral flux of fluorescein sodium using the standard curve. The Papp was calculated using the formula: Papp = ΔQ/Δt × (1/AC0) [106], where ΔQ/Δt is the permeability rate (μg/s), A is the diffusion area of the monolayer (cm2), while C0 is the initial concentration (μg/mL) of fluorescein sodium in the transwell apical inserts. All experiments were performed in triplicate.

4.10. Immunofluorescence Analysis

IPEC-J2 cells (5 × 105 cell/mL) were seeded on glass coverslips in a 12-well flat-bottom culture plate for at least 9 days to form tight junctions. On the 10th day, the monolayer reaching polarization was treated with bacteria as described in the adhesion assay section. Cells were fixed in 4% paraformaldehyde for 20 min at room temperature and blocked with 2.5% bovine serum albumin (BSA; Solarbio, Beijing, China) for 1 h at room temperature. Cells were incubated with rabbit polyclonal anti-ZO-1 primary antibody (Invitrogen, Waltham, MA, USA) for 12 h at 4 °C, after which they were incubated with secondary antibody Alexa fluor 488 goat anti-rabbit (Abcam, Cambridge, UK) for 1 h at room temperature and away from light. Nuclei were stained with DAPI (Beyotime, Shanghai, China). Fluorescence images were obtained through laser scanning confocal microscopy (LSM 880 with AiryScan) (Zeiss, Oberkochen, Germany). Mean relative fluorescence intensity of ZO-1 was determined using the ImageJ software (version 1.51, National Institute of Health, MD, USA). All experiments were performed in triplicate.

4.11. PAS Staining

The IPEC-J2 cells (5 × 105 cell/mL) were grown in 24-well plates (Corning Life Science, MA, USA) for 9 days and pretreated with bacteria as described in the adhesion assay section. Then, cells were washed using PBS and fixed in 70% ethanol for 10 min at room temperature. PAS staining was performed according to the manufacturer’s instructions (Beyotime, Shanghai, China). Images were obtained using a light microscope (Leica, Wetzlar, Germany). Experiments were performed in triplicate.

4.12. Quantitative Real-Time PCR

IPEC-J2 cells were pretreated with bacteria as described in the adhesion assay section. Then, cells were lysed using RNAiso Plus (Takara, Dalian, China) to extract RNA. Total RNA was reverse transcribed to cDNA using the HiScript II Q Select RT SuperMix (Vazyme, Nanjing, China). The qRT-PCR analysis was performed using StepOne Plus Real-Time PCR system (Applied Biosystems, USA) and the ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China). Primer sequences used in this study are shown in Table 1. All samples were run in triplicate. β-actin was selected as an endogenous control and relative gene expressions were analyzed using the 2−ΔΔCt method [105]. Each assay was performed in triplicate.

4.13. Western Blot Analysis

After pretreatment with bacteria as described in the adhesion assay section, IPEC-J2 cells were lysed using the RIPA Lysis Buffer (Beyotime, Shanghai, China) involving protease inhibitors. Protein concentrations were measured using the BCA Protein Assay Kit (Beyotime, Shanghai, China). Briefly, protein samples were separated by SDS-PAGE and transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, Billerica, MA, USA). Membranes with migrated proteins were blocked with 5% dried skimmed milk for 2 h at room temperature and incubated overnight at 4 °C with the following primary antibodies: claudin-1 (Abcam, Cambridge, UK), occludin (Abcam, Cambridge, UK), ERK1/2 (Cell Signaling Technology, Beverly, MA, USA), phospho-ERK1/2 (Cell Signaling Technology, MA, USA), p38 (Cell Signaling Technology, MA, USA), phospho-p38 (Cell Signaling Technology, MA, USA), JNK (Cell Signaling Technology, MA, USA), phospho-JNK (Cell Signaling Technology, MA, USA), p65 (Cell Signaling Technology, MA, USA), phospho-p65 (Cell Signaling Technology, MA, USA), and β-actin (Abcam, Cambridge, UK). After being washed three times for five minutes using Tris-Buffered-Saline with Tween (TBST), membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 h at room temperature. Then, protein bands were detected on an image system (Tanon, Shanghai, China) using the chemiluminescent HRP substrate kit (Millipore, MA, USA). Intensities of protein bands were determined using the ImageJ software (version 1.51, National Institute of Health, MD, USA). All experiments were performed in triplicate.

4.14. Statistical Analysis

Experimental data were analyzed by IBM SPSS Statistics 20 and presented as mean ± SD. Statistical significance between two groups was determined by two-tailed Student’s t test, while multiple comparisons were performed by one-way ANOVA. p ≤ 0.05 was considered significant. Graphs were drawn using the OriginPro 2018 software.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/ijms222212388/s1.

Author Contributions

W.L., Y.Z. and L.G. conceptualized the experiments; Y.Z. performed the experiments, analyzed the data, and wrote the original draft; B.W., Q.W., L.T., P.Z., Z.Z. and H.Z. revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This study is supported by the Natural Science Foundation of Zhejiang province, China (No. LZ20C170002), the National Natural Science Foundation of China (No. 32072766, 31672460, and 31472128), the National High-Tech R&D Program (863) of China (No. 2013AA102803D), and the Major Science and Technology Project of Zhejiang Province (No. 2006C12086), PRC.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data generated or analyzed during this study are available from the corresponding author by request.

Acknowledgments

The authors would like to thank members of their laboratory for helpful and constructive advice.

Conflicts of Interest

The authors declare no conflict of interest.

Abbreviations

B. licheniformis: Bacillus licheniformis; BSA: Bovine serum albumin; CFU: Colony forming units; CPE: C. perfringens enterotoxin; C. perfringens: Clostridium perfringens; DAPI: 4′,6-Diamidino-2-phenylindole dihydrochloride; DMEM/F12: Dulbecco’s modified Eagle’s F12 ham medium; ERK: extracellular signal-regulated kinase; FBS: Fetal bovine serum; FITC: Fluorescein isothiocyanate; HDPs: Host defense peptides; HRP: Horseradish peroxidase; IL: Interleukin; IPEC-J2: Intestinal porcine epithelial cell line; JNK: c-Jun NH 2-terminal kinase; L. acidophilus: Lactobacillus acidophilus; LDH: Lactate dehydrogenase; LFS: L. plantarum Lac16 fermentation supernatant; L. plantarum: Lactobacillus plantarum; MAPK: Mitogen-activated protein kinase; MRS: de Man–Rogosa–Sharpe; NF-κB: Nuclear factor-κB; NLRs: NOD-like receptors; NOD: Nucleotide-binding oligomerization domain; OD: Optical density; PAMPs: Pathogen-associated molecular patterns; Papp: Apparent permeability coefficient; PAS: Periodic acid–Schiff; pBD: Porcine β-defensin; PBS: Phosphate-buffered saline; PCR: Polymerase chain reaction; pEP2C: Porcine epididymis protein 2 splicing variant C; PRRs: Pattern recognition receptors; PVDF: Polyvinylidene difluoride; RCM: Reinforced clostridium medium; TBST: Tris-Buffered-Saline with Tween; TLR: Toll-like receptor; TNF-α: Tumor necrosis factor-α; TSC: Tryptose sulfite cycloserine; ZO-1: Zona occludens 1.

References

  1. O’Brien, D.K.; Melville, S.B. Effects of Clostridium perfringens Alpha-Toxin (PLC) and Perfringolysin O (PFO) on Cytotoxicity to Macrophages, on Escape from the Phagosomes of Macrophages, and on Persistence of C. perfringens in Host Tissues. Infect. Immun. 2004, 72, 5204–5215. [Google Scholar] [CrossRef] [Green Version]
  2. Hassan, K.; Elbourne, L.; Tetu, S.; Melville, S.B.; Rood, J.I.; Paulsen, I.T. Genomic analyses of Clostridium perfringens isolates from five toxinotypes. Res. Microbiol. 2015, 166, 255–263. [Google Scholar] [CrossRef]
  3. Songer, J.G. Clostridial enteric diseases of domestic animals. Clin. Microbiol. Rev. 1996, 9, 216–234. [Google Scholar] [CrossRef]
  4. Lindström, M.; Heikinheimo, A.; Lahti, P.; Korkeala, H. Novel insights into the epidemiology of Clostridium perfringens type A food poisoning. Food Microbiol. 2011, 28, 192–198. [Google Scholar] [CrossRef]
  5. Charlebois, A.; Jacques, M.; Boulianne, M.; Archambault, M. Tolerance of Clostridium perfringens biofilms to disinfectants commonly used in the food industry. Food Microbiol. 2017, 62, 32–38. [Google Scholar] [CrossRef]
  6. Kondo, F. In vitro lecithinase activity and sensitivity to 22 antimicrobial agents of Clostridium perfringens isolated from necrotic enteritis of broiler chickens. Res. Veter-Sci. 1988, 45, 337–340. [Google Scholar] [CrossRef]
  7. Weese, J.S.; Staempfli, H.R.; Prescott, J.F.; Kruth, S.A.; Greenwood, S.J.; Weese, H.E. The Roles of Clostridium difficile and Enterotoxigenic Clostridium perfringens in Diarrhea in Dogs. J. Veter-Intern. Med. 2001, 15, 374–378. [Google Scholar] [CrossRef]
  8. Revitt-Mills, S.A.; Rood, J.I.; Adams, V. Clostridium perfringens extracellular toxins and enzymes: 20 and counting. Microbiol. Aust. 2015, 36, 114. [Google Scholar] [CrossRef]
  9. Petit, L.; Gibert, M.; Popoff, M.R. Clostridium perfringens: Toxinotype and genotype. Trends Microbiol. 1999, 7, 104–110. [Google Scholar] [CrossRef]
  10. Mengel, H.; Kruger, M.; Kruger, M.U.; Westphal, B.; Swidsinski, A.; Schwarz, S.; Mundt, H.-C.; Dittmar, K.; Daugschies, A. Necrotic enteritis due to simultaneous infection with Isospora suis and clostridia in newborn piglets and its prevention by early treatment with toltrazuril. Parasitol. Res. 2011, 110, 1347–1355. [Google Scholar] [CrossRef]
  11. Kiu, R.; Hall, L.J. An update on the human and animal enteric pathogen Clostridium perfringens. Emerg. Microbes Infect. 2018, 7, 1–15. [Google Scholar] [CrossRef] [Green Version]
  12. Nedbalcová, K.; Zouharová, M. Resistance of isolates of Clostridium perfringens type a from pig management in the Czech Republic to the selected antimicrobials. Veterinářství 2018, 68, 640–644. [Google Scholar]
  13. Zheng, X.; Wang, X.; Teng, D.; Mao, R.; Hao, Y.; Yang, N.; Zong, L.; Wang, J. Mode of action of plectasin-derived peptides against gas gangrene-associated Clostridium perfringens type A. PLoS ONE 2017, 12, e0185215. [Google Scholar] [CrossRef] [Green Version]
  14. Fasina, Y.O.; Newman, M.M.; Stough, J.M.; Liles, M.R. Effect of Clostridium perfringens infection and antibiotic administration on microbiota in the small intestine of broiler chickens. Poult. Sci. 2016, 95, 247–260. [Google Scholar] [CrossRef]
  15. Luo, R.; Yang, Q.; Huang, X.; Yan, Z.; Gao, X.; Wang, W.; Xie, K.; Wang, P.; Gun, S. Clostridium perfringens beta2 toxin induced in vitro oxidative damage and its toxic assessment in porcine small intestinal epithelial cell lines. Gene 2020, 759, 144999. [Google Scholar] [CrossRef]
  16. Posthaus, H.; Kittl, S.; Tarek, B.; Bruggisser, J. Clostridium perfringens type C necrotic enteritis in pigs: Diagnosis, pathogenesis, and prevention. J. Veter-Diagn. Investig. 2020, 32, 203–212. [Google Scholar] [CrossRef] [Green Version]
  17. Gharaibeh, M.; Khalifeh, M.; Nawasreh, A.; Hananeh, W.; Awawdeh, M. Assessment of Immune Response and Efficacy of Essential Oils Application on Controlling Necrotic Enteritis Induced by Clostridium perfringens in Broiler Chickens. Molecules 2021, 26, 4527. [Google Scholar] [CrossRef]
  18. Rajput, D.S.; Zeng, D.; Khalique, A.; Rajput, S.S.; Wang, H.; Zhao, Y.; Sun, N.; Ni, X. Pretreatment with probiotics ameliorate gut health and necrotic enteritis in broiler chickens, a substitute to antibiotics. AMB Express 2020, 10, 220. [Google Scholar] [CrossRef]
  19. Al-Sagan, A.A.; Abudabos, A.M. Effect of a prebiotic, probiotic and symbiotic on performance of broilers under Clostridium Perfringens challenge. Thai J. Vet. Med. 2017, 47, 257–264. [Google Scholar]
  20. Friedlein, U.; Dorn-In, S.; Schwaiger, K. Antimicrobial effects of plant extracts against Clostridium perfringens with respect to food-relevant influencing factors. J. Food Prot. 2021, 84, 1809–1818. [Google Scholar] [CrossRef]
  21. Reid, G.; Jass, J.; Sebulsky, M.T.; McCormick, J.K. Potential Uses of Probiotics in Clinical Practice. Clin. Microbiol. Rev. 2003, 16, 658–672. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Zhou, Y.; Zeng, Z.; Xu, Y.; Ying, J.; Wang, B.; Majeed, M.; Majeed, S.; Pande, A.; Li, W. Application of Bacillus coagulans in Animal Husbandry and Its Underlying Mechanisms. Animals 2020, 10, 454. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Wang, J.; Yin, F.; Zhu, C.; Yu, H.; Niven, S.; De Lange, C.; Gong, J. Evaluation of probiotic bacteria for their effects on the growth performance and intestinal microbiota of newly-weaned pigs fed fermented high-moisture maize. Livest. Sci. 2012, 145, 79–86. [Google Scholar] [CrossRef]
  24. Hao, Q.; Dong, B.R.; Wu, T. Probiotics for preventing acute upper respiratory tract infections. Cochrane Database Syst. Rev. 2015, CD006895. [Google Scholar] [CrossRef]
  25. Guo, S.; Liu, D.; Zhang, B.; Li, Z.; Li, Y.; Ding, B.; Guo, Y. Two Lactobacillus Species Inhibit the Growth and α-Toxin Production of Clostridium perfringens and Induced Proinflammatory Factors in Chicken Intestinal Epithelial Cells in Vitro. Front. Microbiol. 2017, 8, 2081. [Google Scholar] [CrossRef]
  26. Li, Z.; Wang, W.; Liu, D.; Guo, Y. Effects of Lactobacillus acidophilus on the growth performance and intestinal health of broilers challenged with Clostridium perfringens. J. Anim. Sci. Biotechnol. 2018, 9, 25. [Google Scholar] [CrossRef] [Green Version]
  27. Xu, T.; Chen, Y.; Yu, L.; Wang, J.; Huang, M.; Zhu, N. Effects of Lactobacillus plantarum on intestinal integrity and immune responses of egg-laying chickens infected with Clostridium perfringens under the free-range or the specific pathogen free environment. BMC Veter-Res. 2020, 16, 47. [Google Scholar] [CrossRef] [Green Version]
  28. Kizerwetter-Swida, M.; Binek, M. Protective effect of potentially probiotic Lactobacillus strain on infection with pathogenic bacteria in chickens. Pol. J. Veter-Sci. 2009, 12, 15–20. [Google Scholar]
  29. Cao, L.; Yang, X.; Li, Z.; Sun, F.; Wu, X.; Yao, J. Reduced lesions in chickens with Clostridium perfringens-induced necrotic enteritis by Lactobacillus fermentum 1.20291. Poult. Sci. 2012, 91, 3065–3071. [Google Scholar] [CrossRef]
  30. Gong, L.; Wang, B.; Zhou, Y.; Tang, L.; Zeng, Z.; Zhang, H.; Li, W. Protective Effects of Lactobacillus plantarum 16 and Paenibacillus polymyxa 10 Against Clostridium perfringens Infection in Broilers. Front. Immunol. 2021, 11, 11. [Google Scholar] [CrossRef]
  31. Liu, H.-Y.; Roos, S.; Jonsson, H.; Ahl, D.; Dicksved, J.; Lindberg, J.E.; Lundh, T. Effects of Lactobacillus johnsonii and Lactobacillus reuteri on gut barrier function and heat shock proteins in intestinal porcine epithelial cells. Physiol. Rep. 2015, 3, e12355. [Google Scholar] [CrossRef]
  32. Brosnahan, A.J.; Brown, D.R. Porcine IPEC-J2 intestinal epithelial cells in microbiological investigations. Veter-Microbiol. 2012, 156, 229–237. [Google Scholar] [CrossRef] [Green Version]
  33. Hancock, R.E.W.; Sahl, H.-G. Antimicrobial and host-defense peptides as new anti-infective therapeutic strategies. Nat. Biotechnol. 2006, 24, 1551–1557. [Google Scholar] [CrossRef]
  34. Wang, J.; Zeng, Y.; Wang, S.; Liu, H.; Zhang, D.; Zhang, W.; Wang, Y.; Ji, H. Swine-Derived Probiotic Lactobacillus plantarum Inhibits Growth and Adhesion of Enterotoxigenic Escherichia coli and Mediates Host Defense. Front. Microbiol. 2018, 9, 1364. [Google Scholar] [CrossRef] [PubMed]
  35. Blyth, G.; Connors, L.; Fodor, C.; Cobo, E.R. The Network of Colonic Host Defense Peptides as an Innate Immune Defense against Enteropathogenic Bacteria. Front. Immunol. 2020, 11, 965. [Google Scholar] [CrossRef] [PubMed]
  36. Xiao, K.; Liu, C.; Tu, Z.; Xu, Q.; Chen, S.; Zhang, Y.; Wang, X.; Zhang, J.; Hu, C.-A.A.; Liu, Y. Activation of the NF-κB and MAPK signaling pathways contributes to the inflammatory responses, but not cell injury, in IPEC-1 cells challenged with hydrogen peroxide. Oxidative Med. Cell. Longev. 2020, 2020, 5803639. [Google Scholar] [CrossRef] [Green Version]
  37. Kumar, P.; Nagarajan, A.; Uchil, P. Analysis of Cell Viability by the Lactate Dehydrogenase Assay. Cold Spring Harb. Protoc. 2018, 2018, pdb.prot095497. [Google Scholar] [CrossRef] [PubMed]
  38. Collado, M.C.; Gueimonde, M.; Salminen, S. Probiotics in adhesion of pathogens: Mechanisms of action. In Bioactive Foods in Promoting Health; Elsevier: Amsterdam, The Netherlands, 2010; pp. 353–370. [Google Scholar]
  39. Bröer, S.; Fairweather, S.J. Amino Acid Transport across the Mammalian Intestine. Compr. Physiol. 2018, 9, 343–373. [Google Scholar] [CrossRef]
  40. Fairweather, S.J.; Shah, N.; Bröer, S. Heteromeric Solute Carriers: Function, Structure, Pathology and Pharmacology. Adv. Exp. Med. Biol. 2020, 21, 13–127. [Google Scholar] [CrossRef]
  41. Zhang, B.; Gan, L.; Shahid, M.S.; Lv, Z.; Fan, H.; Liu, D.; Guo, Y. In vivo and in vitro protective effect of arginine against intestinal inflammatory response induced by Clostridium perfringens in broiler chickens. J. Anim. Sci. Biotechnol. 2019, 10, 73. [Google Scholar] [CrossRef]
  42. Bortoluzzi, C.; Lumpkins, B.; Mathis, G.; França, M.; King, W.; Graugnard, D.; Dawson, K.; Applegate, T. Zinc source modulates intestinal inflammation and intestinal integrity of broiler chickens challenged with coccidia and Clostridium perfringens. Poult. Sci. 2019, 98, 2211–2219. [Google Scholar] [CrossRef] [PubMed]
  43. Berri, M.; Olivier, M.; Holbert, S.; Dupont, J.; Demais, H.; Le Goff, M.; Collen, P.N. Ulvan from Ulva armoricana (Chlorophyta) activates the PI3K/Akt signalling pathway via TLR4 to induce intestinal cytokine production. Algal Res. 2017, 28, 39–47. [Google Scholar] [CrossRef]
  44. Wellnitz, O.; Bruckmaier, R.M. The innate immune response of the bovine mammary gland to bacterial infection. Vet. J. 2012, 192, 148–152. [Google Scholar] [CrossRef] [PubMed]
  45. Qiao, J.; Sun, Z.; Liang, D.; Li, H. Lactobacillus salivarius alleviates inflammation via NF-κB signaling in ETEC K88-induced IPEC-J2 cells. J. Anim. Sci. Biotechnol. 2020, 11, 76. [Google Scholar] [CrossRef]
  46. Chen, L.; Guanglin, J.; Ying, Q.; Kang, S.; Yan, M.; Pengyan, W.; Jianjun, J. Effect of Pig Lactobacillus to Salmonella, Escherichia coli Adhesion on Pig Small Intestinal Epithelial Cell. Acta Agric. Boreali-Occident. Sin. 2013, 9, 18–23. [Google Scholar]
  47. Muyyarikkandy, M.S.; Amalaradjou, M.A. Lactobacillus bulgaricus, Lactobacillus rhamnosus and Lactobacillus paracasei Attenuate Salmonella Enteritidis, Salmonella Heidelberg and Salmonella Typhimurium Colonization and Virulence Gene Expression In Vitro. Int. J. Mol. Sci. 2017, 18, 2381. [Google Scholar] [CrossRef] [Green Version]
  48. Khaneghah, A.M.; Abhari, K.; Eş, I.; Soares, M.B.; Oliveira, R.B.; Hosseini, H.; Rezaei, M.; Balthazar, C.F.; Silva, R.; Cruz, A.G.; et al. Interactions between probiotics and pathogenic microorganisms in hosts and foods: A review. Trends Food Sci. Technol. 2020, 95, 205–218. [Google Scholar] [CrossRef]
  49. Geraldo, B.M.C.; Batalha, M.N.; Milhan, N.V.M.; Rossoni, R.D.; Scorzoni, L.; Anbinder, A.L. Heat-killed Lactobacillus reuteri and cell-free culture supernatant have similar effects to viable probiotics during interaction with Porphyromonas gingivalis. J. Periodontal Res. 2019, 55, 215–220. [Google Scholar] [CrossRef]
  50. Varga, J.; Therit, B.; Melville, S.B. Type IV Pili and the CcpA Protein Are Needed for Maximal Biofilm Formation by the Gram-Positive Anaerobic Pathogen Clostridium perfringens. Infect. Immun. 2008, 76, 4944–4951. [Google Scholar] [CrossRef] [Green Version]
  51. Biel, M.A. Photodynamic Therapy of Bacterial and Fungal Biofilm Infections. In Photodynamic Therapy; Humana Press: Totowa, NJ, USA, 2010; Volume 635, pp. 175–194. [Google Scholar]
  52. Ołdak, A.; Zielińska, D.; Rzepkowska, A.; Kołożyn-Krajewska, D. Comparison of Antibacterial Activity of Lactobacillus plantarum Strains Isolated from Two Different Kinds of Regional Cheeses from Poland: Oscypek and Korycinski Cheese. BioMed Res. Int. 2017, 2017, 6820369. [Google Scholar] [CrossRef] [Green Version]
  53. Li, J.; McClane, B.A. Comparative Effects of Osmotic, Sodium Nitrite-Induced, and pH-Induced Stress on Growth and Survival of Clostridium perfringens Type A Isolates Carrying Chromosomal or Plasmid-Borne Enterotoxin Genes. Appl. Environ. Microbiol. 2006, 72, 7620–7625. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Adachi, K.; Ohtani, K.; Kawano, M.; Singh, R.P.; Yousuf, B.; Sonomoto, K.; Shimizu, T.; Nakayama, J. Metabolic dependent and independent pH-drop shuts down VirSR quorum sensing in Clostridium perfringens. J. Biosci. Bioeng. 2018, 125, 525–531. [Google Scholar] [CrossRef] [PubMed]
  55. Zhang, J.; Deng, J.; Li, Y.; Yang, Q. The effect of Lactobacillus on the expression of porcine β-defensin-2 in the digestive tract of piglets. Livest. Sci. 2011, 138, 259–265. [Google Scholar] [CrossRef]
  56. Liu, H.; Hou, C.; Wang, G.; Jia, H.; Yu, H.; Zeng, X.; A Thacker, P.; Zhang, G.; Qiao, S. Lactobacillus reuteri I5007 Modulates Intestinal Host Defense Peptide Expression in the Model of IPEC-J2 Cells and Neonatal Piglets. Nutrients 2017, 9, 559. [Google Scholar] [CrossRef] [Green Version]
  57. Wang, J.; Zhang, W.; Wang, S.; Liu, H.; Zhang, D.; Wang, Y.; Ji, H. Swine-Derived Probiotic Lactobacillus plantarum Modulates Porcine Intestinal Endogenous Host Defense Peptide Synthesis Through TLR2/MAPK/AP-1 Signaling Pathway. Front. Immunol. 2019, 10, 2691. [Google Scholar] [CrossRef] [Green Version]
  58. Veldhuizen, E.J.; Rijnders, M.; Claassen, E.A.; van Dijk, A.; Haagsman, H.P. Porcine β-defensin 2 displays broad antimicrobial activity against pathogenic intestinal bacteria. Mol. Immunol. 2008, 45, 386–394. [Google Scholar] [CrossRef]
  59. Navarro, M.A.; McClane, B.A.; Uzal, F.A. Mechanisms of Action and Cell Death Associated with Clostridium perfringens Toxins. Toxins 2018, 10, 212. [Google Scholar] [CrossRef] [Green Version]
  60. Chan, F.K.-M.; Moriwaki, K.; De Rosa, M.J. Detection of Necrosis by Release of Lactate Dehydrogenase Activity. Methods Mol. Biol. 2013, 979, 65–70. [Google Scholar] [CrossRef] [Green Version]
  61. Rayamajhi, M.; Zhang, Y.; Miao, E.A. Detection of Pyroptosis by Measuring Released Lactate Dehydrogenase Activity. Methods Mol. Biol. 2013, 1040, 85–90. [Google Scholar] [CrossRef] [Green Version]
  62. Mazkour, S.; Shekarforoush, S.S.; Basiri, S.; Nazifi, S.; Yektaseresht, A.; Honarmand, M. Effects of two probiotic spores of Bacillus species on hematological, biochemical, and inflammatory parameters in Salmonella Typhimurium infected rats. Sci. Rep. 2020, 10, 8035. [Google Scholar] [CrossRef]
  63. Wu, Q.; Zhu, Y.-H.; Xu, J.; Liu, X.; Duan, C.; Wang, M.-J.; Wang, J.-F. Lactobacillus rhamnosus GR-1 Ameliorates Escherichia coli-Induced Activation of NLRP3 and NLRC4 Inflammasomes with Differential Requirement for ASC. Front. Microbiol. 2018, 9, 1661. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  64. Qiao, Z.; Chen, J.; Zhou, Q.; Wang, X.; Shan, Y.; Yi, Y.; Liu, B.; Zhou, Y.; Lü, X. Purification, characterization, and mode of action of a novel bacteriocin BM173 from Lactobacillus crustorum MN047 and its effect on biofilm formation of Escherichia coli and Staphylococcus aureus. J. Dairy Sci. 2021, 104, 1474–1483. [Google Scholar] [CrossRef] [PubMed]
  65. Wang, B.; Hussain, A.; Zhou, Y.; Zeng, Z.; Wang, Q.; Zou, P.; Gong, L.; Zhao, P.; Li, W. Saccharomyces boulardii attenuates inflammatory response induced by Clostridium perfringens via TLR4/TLR15-MyD8 pathway in HD11 avian macrophages. Poult. Sci. 2020, 99, 5356–5365. [Google Scholar] [CrossRef] [PubMed]
  66. Gudiña, E.J.; Fernandes, E.C.; Teixeira, J.A.; Rodrigues, L.R. Antimicrobial and anti-adhesive activities of cell-bound biosurfactant from Lactobacillus agilis CCUG31450. RSC Adv. 2015, 5, 90960–90968. [Google Scholar] [CrossRef] [Green Version]
  67. Salminen, S.; Nybom, S.; Meriluoto, J.; Collado, M.C.; Vesterlund, S.; El-Nezami, H. Interaction of probiotics and pathogens—benefits to human health? Curr. Opin. Biotechnol. 2010, 21, 157–167. [Google Scholar] [CrossRef] [PubMed]
  68. Liu, W.; Devi, S.; Park, J.; Kim, I. Effects of complex probiotic supplementation in growing pig diets with and without palm kernel expellers on growth performance, nutrient digestibility, blood parameters, fecal microbial shedding and noxious gas emission. Anim. Sci. J. 2018, 89, 552–560. [Google Scholar] [CrossRef]
  69. A McClane, B. Clostridium perfringens type C isolates rapidly upregulate their toxin production upon contact with host cells. Virulence 2010, 1, 97–100. [Google Scholar] [CrossRef] [Green Version]
  70. Collado, M.C.; Grześkowiak, Ł.; Salminen, S. Probiotic Strains and Their Combination Inhibit In Vitro Adhesion of Pathogens to Pig Intestinal Mucosa. Curr. Microbiol. 2007, 55, 260–265. [Google Scholar] [CrossRef]
  71. Chelakkot, C.; Ghim, J.; Ryu, S.H. Mechanisms regulating intestinal barrier integrity and its pathological implications. Exp. Mol. Med. 2018, 50, 1–9. [Google Scholar] [CrossRef] [Green Version]
  72. Fan, H.; Chen, Z.; Lin, R.; Liu, Y.; Wu, X.; Puthiyakunnon, S.; Wang, Y.; Zhu, B.; Zhang, Q.; Bai, Y.; et al. Bacteroides fragilis Strain ZY-312 Defense against Cronobacter sakazakii-Induced Necrotizing Enterocolitis In Vitro and in a Neonatal Rat Model. mSystems 2019, 4, e00305-19. [Google Scholar] [CrossRef] [Green Version]
  73. Hartsock, A.; Nelson, W.J. Adherens and tight junctions: Structure, function and connections to the actin cytoskeleton. Biochim. Biophys. Acta (BBA)-Biomembr. 2008, 1778, 660–669. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  74. Lee, B.; Moon, K.M.; Kim, C.Y. Tight Junction in the Intestinal Epithelium: Its Association with Diseases and Regulation by Phytochemicals. J. Immunol. Res. 2018, 2018, 2645465. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  75. Awad, W.A.; Hess, C.; Hess, M. Enteric Pathogens and Their Toxin-Induced Disruption of the Intestinal Barrier through Alteration of Tight Junctions in Chickens. Toxins 2017, 9, 60. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  76. Blackwood, B.P.; Yuan, C.Y.; Wood, D.R.; Nicolas, J.D.; Grothaus, J.S.; Hunter, C.J. Probiotic Lactobacillus Species Strengthen Intestinal Barrier Function and Tight Junction Integrity in Experimental Necrotizing Enterocolitis. J. Probiotics Health 2017, 5, 159. [Google Scholar] [CrossRef]
  77. Che, S.-Y.; Yuan, J.-W.; Zhang, L.; Ruan, Z.; Sun, X.-M.; Lu, H. Puerarin prevents epithelial tight junction dysfunction induced by ethanol in Caco-2 cell model. J. Funct. Foods 2020, 73, 104079. [Google Scholar] [CrossRef]
  78. Eichner, M.; Protze, J.; Piontek, A.; Krause, G.; Piontek, J. Targeting and alteration of tight junctions by bacteria and their virulence factors such as Clostridium perfringens enterotoxin. Pflügers Arch.-Eur. J. Physiol. 2016, 469, 77–90. [Google Scholar] [CrossRef]
  79. Xiao, Z.; Liu, L.; Tao, W.; Pei, X.; Wang, G.; Wang, M. 334 Clostridium tyrobutyricum protect intestinal barrier function from LPS-induced apoptosis via p38/JNK signaling pathway in IPEC-J2. J. Anim. Sci. 2018, 96, 166–167. [Google Scholar] [CrossRef]
  80. Kimura, J.; Abe, H.; Kamitani, S.; Toshima, H.; Fukui, A.; Miyake, M.; Kamata, Y.; Sugita-Konishi, Y.; Yamamoto, S.; Horiguchi, Y. Clostridium perfringens Enterotoxin Interacts with Claudins via Electrostatic Attraction. J. Biol. Chem. 2010, 285, 401–408. [Google Scholar] [CrossRef] [Green Version]
  81. Krause, G.; Winkler, L.; Mueller, S.L.; Haseloff, R.F.; Piontek, J.; Blasig, I.E. Structure and function of claudins. Biochim. Biophys. Acta (BBA)—Biomembr. 2008, 1778, 631–645. [Google Scholar] [CrossRef] [Green Version]
  82. Turner, J.R. Intestinal mucosal barrier function in health and disease. Nat. Rev. Immunol. 2009, 9, 799–809. [Google Scholar] [CrossRef]
  83. Zakrzewski, S.S.; Richter, J.F.; Krug, S.; Jebautzke, B.; Lee, I.-F.M.; Rieger, J.; Sachtleben, M.; Bondzio, A.; Schulzke, J.D.; Fromm, M.; et al. Improved Cell Line IPEC-J2, Characterized as a Model for Porcine Jejunal Epithelium. PLoS ONE 2013, 8, e79643. [Google Scholar] [CrossRef] [Green Version]
  84. Nguyen, T.T.T.; Nguyen, H.T.; Wang, P.-C.; Chen, S.-C. Identification and expression analysis of two pro-inflammatory cytokines, TNF-α and IL-8, in cobia (Rachycentron canadum L.) in response to Streptococcus dysgalactiae infection. Fish Shellfish. Immunol. 2017, 67, 159–171. [Google Scholar] [CrossRef]
  85. Ertel, W.; Kremer, J.; Kenney, J.; Steckholzer, U.; Jarrar, D.; Trentz, O.; Schildberg, F. Downregulation of proinflammatory cytokine release in whole blood from septic patients. Blood 1995, 85, 1341–1347. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  86. Xiao, Y.; Yan, H.; Diao, H.; Yu, B.; He, J.; Yu, J.; Zheng, P.; Mao, X.; Luo, Y.; Chen, D. Early Gut Microbiota Intervention Suppresses DSS-Induced Inflammatory Responses by Deactivating TLR/NLR Signalling in Pigs. Sci. Rep. 2017, 7, 3224. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  87. Kamada, N.; Seo, S.-U.; Chen, G.Y.; Núñez, G. Role of the gut microbiota in immunity and inflammatory disease. Nat. Rev. Immunol. 2013, 13, 321–335. [Google Scholar] [CrossRef] [PubMed]
  88. Miyake, K. Innate immune sensing of pathogens and danger signals by cell surface Toll-like receptors. Semin. Immunol. 2007, 19, 3–10. [Google Scholar] [CrossRef]
  89. Brubaker, S.W.; Bonham, K.S.; Zanoni, I.; Kagan, J.C. Innate Immune Pattern Recognition: A Cell Biological Perspective. Annu. Rev. Immunol. 2015, 33, 257–290. [Google Scholar] [CrossRef] [Green Version]
  90. Vora, P.; Youdim, A.; Thomas, L.S.; Fukata, M.; Tesfay, S.Y.; Lukasek, K.; Michelsen, K.S.; Wada, A.; Hirayama, T.; Arditi, M.; et al. β-Defensin-2 Expression Is Regulated by TLR Signaling in Intestinal Epithelial Cells. J. Immunol. 2004, 173, 5398–5405. [Google Scholar] [CrossRef] [Green Version]
  91. Wu, Q.; Liu, M.-C.; Yang, J.; Wang, J.-F.; Zhu, Y.-H. Lactobacillus rhamnosus GR-1 Ameliorates Escherichia coli-Induced Inflammation and Cell Damage via Attenuation of ASC-Independent NLRP3 Inflammasome Activation. Appl. Environ. Microbiol. 2016, 82, 1173–1182. [Google Scholar] [CrossRef] [Green Version]
  92. Li, Q.; Cui, K.; Wu, M.; Xu, D.; Mai, K.; Ai, Q. Polyunsaturated Fatty Acids Influence LPS-Induced Inflammation of Fish Macrophages Through Differential Modulation of Pathogen Recognition and p38 MAPK/NF-κB Signaling. Front. Immunol. 2020, 11, 559332. [Google Scholar] [CrossRef]
  93. Quadri, S.S.; Cooper, C.; Ghaffar, D.; Vaishnav, H.; Nahar, L. The Pathological Role of Pro (Renin) Receptor in Renal Inflammation. J. Exp. Pharmacol. 2021, 13, 339–344. [Google Scholar] [CrossRef]
  94. Coulombe, P.; Meloche, S. Atypical mitogen-activated protein kinases: Structure, regulation and functions. Biochim. Biophys. Acta (BBA)—Bioenerg. 2007, 1773, 1376–1387. [Google Scholar] [CrossRef] [Green Version]
  95. Zhu, Z.; Xueying, L.; Chunlin, L.; Wen, X.; Rongrong, Z.; Jing, H.; Meilan, J.; Yuwei, X.; Zili, W. Effect of berberine on LPS-induced expression of NF-κB/MAPK signalling pathway and related inflammatory cytokines in porcine intestinal epithelial cells. Innate Immun. 2020, 26, 627–634. [Google Scholar] [CrossRef] [PubMed]
  96. Qi, F.; Bai, S.; Wang, D.; Xu, L.; Hu, H.; Zeng, S.; Chai, R.; Liu, B. Macrophages produce IL-33 by activating MAPK signaling pathway during RSV infection. Mol. Immunol. 2017, 87, 284–292. [Google Scholar] [CrossRef]
  97. Qi, M.; Elion, E.A. MAP kinase pathways. J. Cell Sci. 2005, 118, 3569–3572. [Google Scholar] [CrossRef] [Green Version]
  98. Conti, F.; Boucherit, N.; Baldassarre, V.; Trouplin, V.; Toman, R.; Mottola, G.; Mege, J.-L.; Ghigo, E. Coxiella burnetii lipopolysaccharide blocks p38α-MAPK activation through the disruption of TLR-2 and TLR-4 association. Front. Cell. Infect. Microbiol. 2015, 4, 182. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  99. Lee, J.; Kim, H.J.; Nguyen, T.T.H.; Kim, S.C.; Ree, J.; Choi, T.G.; Sohng, J.K.; Park, Y.I. Emodin 8-O-glucoside primes macrophages more strongly than emodin aglycone via activation of phagocytic activity and TLR-2/MAPK/NF-κB signalling pathway. Int. Immunopharmacol. 2020, 88, 106936. [Google Scholar] [CrossRef]
  100. Vallabhapurapu, S.; Karin, M. Regulation and Function of NF-κB Transcription Factors in the Immune System. Annu. Rev. Immunol. 2009, 27, 693–733. [Google Scholar] [CrossRef] [PubMed]
  101. Tak, P.P.; Firestein, G.S. NF-κB: A key role in inflammatory diseases. J. Clin. Investig. 2001, 107, 7–11. [Google Scholar] [CrossRef]
  102. Xia, B.; Yu, J.; He, T.; Liu, X.; Su, J.; Wang, M.; Wang, J.; Zhu, Y. Lactobacillus johnsonii L531 ameliorates enteritis via elimination of damaged mitochondria and suppression of SQSTM1-dependent mitophagy in a Salmonella infantis model of piglet diarrhea. FASEB J. 2019, 34, 2821–2839. [Google Scholar] [CrossRef] [Green Version]
  103. Yin, H.; Ye, P.; Lei, Q.; Cheng, Y.; Yu, H.; Du, J.; Pan, H.; Cao, Z. In vitro probiotic properties of Pediococcus pentosaceus L1 and its effects on enterotoxigenic Escherichia coli-induced inflammatory responses in porcine intestinal epithelial cells. Microb. Pathog. 2020, 144, 104163. [Google Scholar] [CrossRef] [PubMed]
  104. Jiang, Y.; Kong, Q.; Roland, K.L.; Wolf, A.; Curtiss, R. Multiple effects of Escherichia coli Nissle 1917 on growth, biofilm formation, and inflammation cytokines profile of Clostridium perfringens type A strain CP4. Pathog. Dis. 2014, 70, 390–400. [Google Scholar] [CrossRef] [PubMed]
  105. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  106. Nie, Y.; Hu, J.; Hou, Q.; Zheng, W.; Zhang, X.; Yang, T.; Ma, L.; Yan, X. Lactobacillus frumenti improves antioxidant capacity via nitric oxide synthase 1 in intestinal epithelial cells. FASEB J. 2019, 33, 10705–10716. [Google Scholar] [CrossRef] [PubMed]
Ijms 22 12388 g001 550
Figure 1. Antimicrobial activity of L. plantarum Lac16 on C. perfringens. (A) Agar well diffusion assay—1: de Man–Rogosa–Sharpe (MRS) broth; 2: 100 µg/mL of ampicillin; 3 and 4: LFS. (B) The growth of C. perfringens in different groups was measured at OD600 after 12 h of incubation. (C) Biofilm formation was measured at OD590. (D) C. perfringens levels in the co-culture experiment. (E) pH values of cultures in different groups. Data are presented as the means ± SD for n = 3; * p < 0.05, ** p < 0.01, *** p < 0.001 (t test).
Figure 1. Antimicrobial activity of L. plantarum Lac16 on C. perfringens. (A) Agar well diffusion assay—1: de Man–Rogosa–Sharpe (MRS) broth; 2: 100 µg/mL of ampicillin; 3 and 4: LFS. (B) The growth of C. perfringens in different groups was measured at OD600 after 12 h of incubation. (C) Biofilm formation was measured at OD590. (D) C. perfringens levels in the co-culture experiment. (E) pH values of cultures in different groups. Data are presented as the means ± SD for n = 3; * p < 0.05, ** p < 0.01, *** p < 0.001 (t test).
Ijms 22 12388 g001
Ijms 22 12388 g002 550
Figure 2. Gene expression levels of HDPs in L. plantarum Lac16-treated IPEC-J2 cells. (A) pBD1, (B) pBD2, (C) pBD3, (D) pEP2C. mRNA expression was standardized to β-actin expression. Data are presented as the means ± SD for n = 3; * p < 0.05, ** p < 0.01, *** p < 0.001 (one-way ANOVA).
Figure 2. Gene expression levels of HDPs in L. plantarum Lac16-treated IPEC-J2 cells. (A) pBD1, (B) pBD2, (C) pBD3, (D) pEP2C. mRNA expression was standardized to β-actin expression. Data are presented as the means ± SD for n = 3; * p < 0.05, ** p < 0.01, *** p < 0.001 (one-way ANOVA).
Ijms 22 12388 g002
Ijms 22 12388 g003 550
Figure 3. Cytotoxicity and C. perfringens adhesion assays. (A) Concentrations of LDH in the supernatants of IPEC-J2 cells. (B) Adhesions of C. perfringens to IPEC-J2 cells were detected by tryptose sulfite cycloserine (TSC) agar. Adherence ratio of the C. perfringens group was normalized to 100%. (C) Adhesions of C. perfringens (green) to IPEC-J2 cells were detected by fluorescence labeling method. (D) The mean relative fluorescence intensity of fluorescein isothiocyanate (FITC) in panel C. Data are presented as the means ± SD for n = 3; * p < 0.05, ** p < 0.01, *** p < 0.001 (t test).
Figure 3. Cytotoxicity and C. perfringens adhesion assays. (A) Concentrations of LDH in the supernatants of IPEC-J2 cells. (B) Adhesions of C. perfringens to IPEC-J2 cells were detected by tryptose sulfite cycloserine (TSC) agar. Adherence ratio of the C. perfringens group was normalized to 100%. (C) Adhesions of C. perfringens (green) to IPEC-J2 cells were detected by fluorescence labeling method. (D) The mean relative fluorescence intensity of fluorescein isothiocyanate (FITC) in panel C. Data are presented as the means ± SD for n = 3; * p < 0.05, ** p < 0.01, *** p < 0.001 (t test).
Ijms 22 12388 g003
Ijms 22 12388 g004 550
Figure 4. Intestinal barrier functions and tight junction proteins of IPEC-J2 cell monolayers. (A) Papp of IPEC-J2 monolayers based on apical-to-basolateral flux of fluorescein sodium. (B) Mucin production was detected by PAS staining (Mucin, carmine). (C) Relative gene expression level of Mucin 2. mRNA expression was standardized to β-actin expression. (D) Western blot detection of occludin and claudin-1 in IPEC-J2 cells, and the quantitative analysis of the expression levels of bands. β-actin was used as an indicator of protein loading. (E) Immunofluorescence staining of zona occludens-1 (ZO-1, green) in IPEC-J2 cells. Nuclei were counterstained using 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI, blue). All images were obtained at 63× magnification in oil. (F) The mean relative fluorescence intensity of ZO-1 in panel E. Data are presented as the means ± SD for n = 3; * p < 0.05, ** p < 0.01, *** p < 0.001 (t test).
Figure 4. Intestinal barrier functions and tight junction proteins of IPEC-J2 cell monolayers. (A) Papp of IPEC-J2 monolayers based on apical-to-basolateral flux of fluorescein sodium. (B) Mucin production was detected by PAS staining (Mucin, carmine). (C) Relative gene expression level of Mucin 2. mRNA expression was standardized to β-actin expression. (D) Western blot detection of occludin and claudin-1 in IPEC-J2 cells, and the quantitative analysis of the expression levels of bands. β-actin was used as an indicator of protein loading. (E) Immunofluorescence staining of zona occludens-1 (ZO-1, green) in IPEC-J2 cells. Nuclei were counterstained using 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI, blue). All images were obtained at 63× magnification in oil. (F) The mean relative fluorescence intensity of ZO-1 in panel E. Data are presented as the means ± SD for n = 3; * p < 0.05, ** p < 0.01, *** p < 0.001 (t test).
Ijms 22 12388 g004
Ijms 22 12388 g005 550
Figure 5. Relative gene expression levels of inflammatory cytokines during C. perfringens infection in IPEC-J2 cells preincubated with L. plantarum Lac16. (A) IL-1β, (B) IL-6, (C) IL-8, (D)TNF-α. mRNA expression was standardized to β-actin expression. Data are presented as the means ± SD for n = 3; * p < 0.05, ** p < 0.01, *** p < 0.001 (t test).
Figure 5. Relative gene expression levels of inflammatory cytokines during C. perfringens infection in IPEC-J2 cells preincubated with L. plantarum Lac16. (A) IL-1β, (B) IL-6, (C) IL-8, (D)TNF-α. mRNA expression was standardized to β-actin expression. Data are presented as the means ± SD for n = 3; * p < 0.05, ** p < 0.01, *** p < 0.001 (t test).
Ijms 22 12388 g005
Ijms 22 12388 g006 550
Figure 6. Relative gene expression levels of PRRs during C. perfringens infection in IPEC-J2 cells preincubated with L. plantarum Lac16. (A) TLR1, (B) TLR2, (C) TLR4, (D) NOD1, (E) NOD2. mRNA expression was standardized to β-actin expression. Data are presented as the means ± SD for n = 3; * p < 0.05, ** p < 0.01, *** p < 0.001 (t test).
Figure 6. Relative gene expression levels of PRRs during C. perfringens infection in IPEC-J2 cells preincubated with L. plantarum Lac16. (A) TLR1, (B) TLR2, (C) TLR4, (D) NOD1, (E) NOD2. mRNA expression was standardized to β-actin expression. Data are presented as the means ± SD for n = 3; * p < 0.05, ** p < 0.01, *** p < 0.001 (t test).
Ijms 22 12388 g006
Ijms 22 12388 g007 550
Figure 7. Western blot detection of MAPK and NF-κB pathways in IPEC-J2 cells. (A) Western blot analysis of MAPK and NF-κB pathways. (B) Quantitative analysis of the expression levels of phospho-p38/p38, phospho-JNK/JNK, phospho-ERK/ERK, and phosphor-p65/p65. Data are presented as the means ± SD for n = 3; * p < 0.05, ** p < 0.01, *** p < 0.001 (t test).
Figure 7. Western blot detection of MAPK and NF-κB pathways in IPEC-J2 cells. (A) Western blot analysis of MAPK and NF-κB pathways. (B) Quantitative analysis of the expression levels of phospho-p38/p38, phospho-JNK/JNK, phospho-ERK/ERK, and phosphor-p65/p65. Data are presented as the means ± SD for n = 3; * p < 0.05, ** p < 0.01, *** p < 0.001 (t test).
Ijms 22 12388 g007
Table
Table 1. Primers used for quantitative real-time PCR.
Table 1. Primers used for quantitative real-time PCR.
Gene NameForward Sequence
(5′→3′)		Reverse Sequence
(5′→3′)		Accession Number
β-actinCCAGGTCATCACCATCGGCAACCAGCACCGTGTTGGCGTAGAGDQ845171.1
pBD1TTCCTCCTCATGGTCCTGTTAGGTGCCGATCTGTTTCATCNM_213838.1
pBD2TGTCTGCCTCCTCTCTTCCAACAGGTCCCTTCAATCCTGAY506573.1
pBD3CCTTCTCTTTGCCTTGCTCTTGCCACTCACAGAACAGCTACCXM_021074698.1
pEP2CACTGCTTGTTCTCCAGAGCCTGGCACAGATGACAAAGCCTBK005522.1
Mucin 2GGTCATGCTGGAGCTGGACAGTTGCCTCCTCGGGGTCGTCACXM_021082584.1
IL-1βAGAGGGACATGGAGAAGCGAGCCCTCTGGGTATGGCTTTNM_001302388.2
IL-6ATCAGGAGACCTGCTTGATGTGGTGGCTTTGTCTGGATTCNM_001252429.1
IL-8TCCTGCTTTCTGCAGCTCTCGGGTGGAAAGGTGTGGAATGNM_213867.1
TNF-αCTGTAGGTTGCTCCCACCTGCCAGTAGGGCGGTTACAGACNM_214022.1
TLR-1GTCAGTCAGCACCGCAGTAACAGACAAACTGGAGGGTGGTNM_001031775
TLR-2TCACTTGTCTAACTTATCATCCTCTTCAGCGAAGGTGTCATTATTGCNM_213761.1
TLR-4GCCATCGCTGCTAACATCATCCTCATACTCAAAGATACACCATCGNM_001113039.2
NOD-1CTGTCGTCAACACCGATCCACCAGTTGGTGACGCAGCTTAB187219.1
NOD-2CCTTTTGAAGATGCTGCCTGGATTCTCTGCCCCATCGTAGNM_001105295.1
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Zhou, Y.; Wang, B.; Wang, Q.; Tang, L.; Zou, P.; Zeng, Z.; Zhang, H.; Gong, L.; Li, W. Protective Effects of Lactobacillus plantarum Lac16 on Clostridium perfringens Infection-Associated Injury in IPEC-J2 Cells. Int. J. Mol. Sci. 2021, 22, 12388. https://doi.org/10.3390/ijms222212388

AMA Style

Zhou Y, Wang B, Wang Q, Tang L, Zou P, Zeng Z, Zhang H, Gong L, Li W. Protective Effects of Lactobacillus plantarum Lac16 on Clostridium perfringens Infection-Associated Injury in IPEC-J2 Cells. International Journal of Molecular Sciences. 2021; 22(22):12388. https://doi.org/10.3390/ijms222212388

Chicago/Turabian Style

Zhou, Yuanhao, Baikui Wang, Qi Wang, Li Tang, Peng Zou, Zihan Zeng, Huihua Zhang, Li Gong, and Weifen Li. 2021. "Protective Effects of Lactobacillus plantarum Lac16 on Clostridium perfringens Infection-Associated Injury in IPEC-J2 Cells" International Journal of Molecular Sciences 22, no. 22: 12388. https://doi.org/10.3390/ijms222212388

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop