Non-Typeable Haemophilus influenzae Invade Choroid Plexus Epithelial Cells in a Polar Fashion
Abstract
:1. Introduction
2. Results
2.1. Characterization of Different Haemophilus Strains for Capsule Markers and Virulence Factors
2.2. Maintenance of Barrier Integrity upon HIBCPP Exposure to NTHI
2.3. NTHI Polarly Invade into Human CP Epithelial Cells
2.4. Adhesion of NTHI and H. Influenzae to HIBCPP Cells
2.5. A Capsule Attenuates Invasion of H. Influenzae into HIBCPP Cells
2.6. Fimbriae Attenuate Invasion and Adhesion into HIBCPP Cells
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains and Growth Conditions
4.2. Verification of Bacterial Strains
Gene Symbol | Forward Primer | Reverse Primer | Size (bp) | Reference |
---|---|---|---|---|
bexA | CGTTTGTATGATGTTGATCCAGACT | TGTCCATGTCTTCAAAATGATG | 343 | [100] |
capB | GCTTACGCTTCTATCTCGGTGAA | ACCATGAGAAAGTGTTAGCG | 370 | [6] |
capF | GCTACTATCAAGTCCAAATC | CGCAATTATGGAAGAAAGCT | 450 | [102] |
hifA | ATGAAAAAAACACT(AT)CTTGGTAGC | TTAT(CT)CGTAAGCAATT(GT)GGAAACC | 650 | [103] |
lpsA | TTGAATATCGTTTAGCAC | GCGTGGCGACAATTAGGC | 994 | [38] |
hia | CGCGGCTTGGGCTGGGTCATTTCT | TCAGCCGTACCGTCAGCATTCAGTTCA | 766 | [32] |
omp1 | TGATAAATTCGCGCTGGGTG | GGCAGTGCGGTCAGTAAAAT | 454 | this study |
omp2 | ATAACAACGAAGGGACTAACG | TCTACACCGAATAATACTGCT | 1000 | [104] |
hel | ATTGGATCCGAATTCTTAAAAGGAAT | ATTAAATATTGGATCCAGTAAAAACTGAGC | 1047 | [105] |
ompA | CGTGCCTCTGGTTTATTTGC | GCGATTTCTACACGACGGTC | 581 | forward modified from [81] reverse this study |
omp6 | ACTTTTGGCGGTTACTCTGT | TGTGCCTAATTTACCAGCAT | 273 | [100] |
4.3. Standard and Inverted Cell Culture of HIBCPP Cells
4.4. TEER Measurements
4.5. Infection Assays and Barrier Integrity
4.6. Double Immunofluorescence Staining and Subsequent Determination of Bacterial Invasion
4.7. Measurement of Cell Viability
4.8. Ultrathin Sections, Transmission and Scanning Electron Microscopy
4.9. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
ATP | adenosine triphosphate |
BBB | Blood–brain barrier |
BCSFB | Blood–cerebrospinal fluid barrier |
BexA | capsule expression A |
bp | Base pairs |
CapB | capsular B antigene |
CapF | capsular F antigene |
CEACAM | carcinoembryonic antigen-related cell adhesion molecule |
CFU | Colony forming units |
CNS | Central nervous system |
COPD | chronic obstructive pulmonary disease |
CP | Choroid plexus |
CSF | Cerebrospinal fluid |
DNA | Desoxyribonucleid acid |
DIF | Double immunofluorescence |
EDTA | ethylenediaminetetraacetic acid |
FCS | Fetal calf serum |
Hap | Haemophilus adhesion and penetration protein |
hel | Gene encoding for H. influenzae outer membrane protein P4 |
HEPES | (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid |
Hia | Haemophilus influenzae adhesin |
H. influenzae | Haemophilus influenzae |
HiB | Haemophilus influenzae serotype B |
HIBCPP | Human choroid plexus papilloma cells |
Hif | Haemophjilus influenzae fimbriae |
hifA | Haemophilus influenzae fimbrial gene |
HiF | Haemophilus influenzae serotype F |
Hmw | High molecular weight protein |
h | hours |
Hsf | Haemophilus influenzae type B surface fibril |
ICAM | Intercellular adhesion molecule |
IF | Immunofluorescence |
LKP | long, thick, hemagglutination-positive pili |
LOS | Lipooligosaccharide |
LPS | Lipopolysaccharide |
LpsA | Lipopolysaccharide glycosyl transferase |
LV | low viscosity |
MOI | Multiplicity of infection |
NRZMHi | National reference center for meningococci and Haemophilus influenzae |
NTHI | Non-typeable Haemophilus influenzae |
Omp | Outer membrane protein |
ompA | Gene encoding for Haemophilus influenzae outer membrane protein P5 |
PCR | Polymerase chain reaction |
SAS | Statistical Analysis System |
SEM | Scanning electron microscopy |
T4SS | Bacterial type IV secretion system |
TE | Buffer containing Tris-HCl and EDTA |
TEER | Transepithelial electrical resistance |
TEM | Transmission electron microscopy |
TLR | Toll like receptor |
References
- Moxon, E.R.; Kroll, J.S. Type b capsular polysaccharide as a virulence factor of Haemophilus influenzae. Vaccine 1988, 6, 113–115. [Google Scholar] [CrossRef]
- Sutton, A.; Schneerson, R.; Kendall-Morris, S.; Robbins, J.B. Differential complement resistance mediates virulence of Haemophilus influenzae type b. Infect. Immun. 1982, 35, 95–104. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hoiseth, S.K.; Gilsdorf, J.R. The Relationship between Type b and Nontypable Haemophilus influenzae Isolated fromthe Same Patient. J. Infect. Dis. 1988, 158, 643–645. [Google Scholar] [CrossRef] [PubMed]
- Kroll, J.S.; Hopkins, I.; Moxon, E.R. Capsule loss in H. influenzae type b occurs by recombination-mediated disruption of a gene essential for polysaccharide export. Cell 1988, 53, 347–356. [Google Scholar] [CrossRef]
- Van Eldere, J.; Slack, M.P.E.; Ladhani, S.; Cripps, A.W. Non-typeable Haemophilus influenzae, an under-recognised pathogen. Lancet Infect. Dis. 2014, 14, 1281–1292. [Google Scholar] [CrossRef] [Green Version]
- Falla, T.J.; Crook, D.W.; Brophy, L.N.; Maskell, D.; Kroll, J.S.; Moxon, E.R. PCR for capsular typing of Haemophilus influenzae. J. Clin. Microbiol. 1994, 32, 2382–2386. [Google Scholar] [CrossRef] [Green Version]
- Peltola, H. World wide Haemophilus influenzae Type b Disease at the Beginning of the 21st Century: Global Analysis of the Disease Burden 25 Years after the Use of the Polysaccharide Vaccineand a Decade after the Advent of Conjugates. Clin. Microbiol. Rev. 2000, 13, 302–317. [Google Scholar] [CrossRef]
- Berndsen, M.R.; Erlendsdottir, H.; Gottfredsson, M. Evolving epidemiology of invasive Haemophilus infections in the post-vaccination era: Results from a long-term population-based study. Clin. Microbiol. Infect. 2012, 18, 918–923. [Google Scholar] [CrossRef] [Green Version]
- Rubach, M.P.; Bender, J.M.; Mottice, S.; Hanson, K.; Weng, H.Y.; Korgenski, K.; Daly, J.A.; Pavia, A.T. Increasing incidence of invasive Haemophilus influenzae disease in adults, Utah, USA. Emerg. Infect. Dis. 2011, 17, 1645–1650. [Google Scholar] [CrossRef]
- Watt, J.P.; Chen, S.; Santosham, M. Haemophilus Influenzae Type b Conjugate Vaccine: Review of Observational Data on Long Term Vaccine Impact to Inform Recommendations for Vaccine Schedules; World Health Organization: Geneva, Switzerland, 2012. [Google Scholar]
- Morris, S.K.; Moss, W.J.; Halsey, N. Haemophilus influenzae type b conjugate vaccine use and effectiveness. Lancet Infect. Dis. 2008, 8, 435–443. [Google Scholar] [CrossRef]
- MacNeil, J.R.; Cohn, A.C.; Farley, M.; Mair, R.; Baumbach, J.; Bennett, N.; Gershman, K.; Harrison, L.H.; Lynfield, R.; Petit, S.; et al. Current epidemiology and trends in invasive Haemophilus influenzae disease—United States, 1989–2008. Clin. Infect. Dis. 2011, 53, 1230–1236. [Google Scholar] [CrossRef] [PubMed]
- Desai, S.; Jamieson, F.B.; Patel, S.N.; Seo, C.Y.; Dang, V.; Fediurek, J.; Navaranjan, D.; Deeks, S.L. The Epidemiology of Invasive Haemophilus influenzae Non-Serotype B Disease in Ontario, Canada from 2004 to 2013. PLoS ONE 2015, 10, e0142179. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wan Sai Cheong, J.; Smith, H.; Heney, C.; Robson, J.; Schlebusch, S.; Fu, J.; Nourse, C. Trends in the epidemiology of invasive Haemophilus influenzae disease in Queensland, Australia from 2000 to 2013: What is the impact of an increase in invasive non-typable H. influenzae (NTHi)? Epidemiol. Infect. 2015, 143, 2993–3000. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Collins, S.; Litt, D.; Almond, R.; Findlow, J.; Linley, E.; Ramsay, M.; Borrow, R.; Ladhani, S. Haemophilus influenzae type b (Hib) seroprevalence and current epidemiology in England and Wales. J. Infect. 2018, 76, 335–341. [Google Scholar] [CrossRef] [PubMed]
- Puig, C.; Grau, I.; Marti, S.; Tubau, F.; Calatayud, L.; Pallares, R.; Linares, J.; Ardanuy, C. Clinical and molecular epidemiology of haemophilus influenzae causing invasive disease in adult patients. PLoS ONE 2014, 9, e112711. [Google Scholar] [CrossRef] [PubMed]
- Kyo, Y.; Kato, K.; Park, Y.S.; Gajghate, S.; Umehara, T.; Lillehoj, E.P.; Suzaki, H.; Kim, K.C. Antiinflammatory role of MUC1 mucin during infection with nontypeable Haemophilus influenzae. Am. J. Respir. Cell Mol. Biol. 2012, 46, 149–156. [Google Scholar] [CrossRef] [Green Version]
- Jalalvand, F.; Riesbeck, K. Update on non-typeable Haemophilus influenzae-mediated disease and vaccine development. Expert Rev. Vaccines 2018, 17, 503–512. [Google Scholar] [CrossRef]
- Ito, T.; Shibata, H.; Nakazawa, M.; Myokai, M.; Ikegaya, K.; Tsuchiya, K.; Kamimaki, T. Meningitis and septicemia caused by nontypeable Haemophilus influenzae in a previously healthy 2-year-old girl. J. Infect. Chemother. 2011, 17, 559–562. [Google Scholar] [CrossRef] [Green Version]
- Cardines, R.; Giufre, M.; Mastrantonio, P.; Ciofi degli Atti, M.L.; Cerquetti, M. Nontypeable Haemophilus influenzae meningitis in children: Phenotypic and genotypic characterization of isolates. Pediatric Infect. Dis. J. 2007, 26, 577–582. [Google Scholar] [CrossRef]
- Kay, S.E.; Nack, Z.; Jenner, B.M. Meningitis and Septicaemia in a Child caused by Non-Typable Haemophilus Influenzae Biotype III. Med. J. Aust. 2001, 175, 484–485. [Google Scholar] [CrossRef]
- Cuthill, S.L.; Farley, M.M.; Donowitz, L.G. Nontypeable haemophilus influenzae meningitis. Pediatric Infect. Dis. J. 1999, 18, 660–662. [Google Scholar] [CrossRef] [PubMed]
- Nizet, V.; Colina, K.F.; Almquist, J.R.; Rubens, C.E.; Smith, A.L. A virulent Nonencapsulated Haemophilus influenzae. J. Infect. Dis. 1996, 173, 180–186. [Google Scholar] [CrossRef] [Green Version]
- Bakaletz, L.O.; Novotny, L.A. Nontypeable Haemophilus influenzae (NTHi). Trends Microbiol. 2018, 26, 727–728. [Google Scholar] [CrossRef] [PubMed]
- St Geme, J.W.R.; Kumar, V.V.; Cutter, D.; Barenkamp, S.J. Prevalence and Distribution of the hmw and hia Genes and the HMW and Hia Adhesins among Genetically Diverse Strains of Nontypeable Haemophilus influenzae. Infect. Immun. 1998, 66, 364–368. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Avadhanula, V.; Rodriguez, C.A.; Ulett, G.C.; Bakaletz, L.O.; Adderson, E.E. Nontypeable Haemophilus influenzae adheres to intercellular adhesion molecule 1 (ICAM-1) on respiratory epithelial cells and upregulates ICAM-1 expression. Infect. Immun. 2006, 74, 830–838. [Google Scholar] [CrossRef] [Green Version]
- Berenson, C.S.; Murphy, T.F.; Wrona, C.T.; Sethi, S. Outer membrane protein P6 of nontypeable Haemophilus influenzae is a potent and selective inducer of human macrophage proinflammatory cytokines. Infect. Immun. 2005, 73, 2728–2735. [Google Scholar] [CrossRef] [Green Version]
- Su, Y.C.; Mukherjee, O.; Singh, B.; Hallgren, O.; Westergren-Thorsson, G.; Hood, D.; Riesbeck, K. Haemophilus influenzae P4 Interacts with Extracellular Matrix Proteins Promoting Adhesion and Serum Resistance. J. Infect. Dis. 2016, 213, 314–323. [Google Scholar] [CrossRef] [Green Version]
- Ostberg, K.L.; Russell, M.W.; Murphy, T.F. Mucosal immunization of mice with recombinant OMP P2 induces antibodies that bind to surface epitopes of multiple strains of nontypeable Haemophilus influenzae. Mucosal Immunol. 2009, 2, 63–73. [Google Scholar] [CrossRef]
- Lichtenegger, S.; Bina, I.; Durakovic, S.; Glaser, P.; Tutz, S.; Schild, S.; Reidl, J. Serum resistance and phase variation of a nasopharyngeal non-typeable Haemophilus influenzae isolate. Int. J. Med. Microbiol. 2017, 307, 139–146. [Google Scholar] [CrossRef]
- Rosadini, C.V.; Ram, S.; Akerley, B.J. Outer membrane protein P5 is required for resistance of nontypeable Haemophilus influenzae to both the classical and alternative complement pathways. Infect. Immun. 2014, 82, 640–649. [Google Scholar] [CrossRef] [Green Version]
- Ecevit, I.Z.; McCrea, K.W.; Pettigrew, M.M.; Sen, A.; Marrs, C.F.; Gilsdorf, J.R. Prevalence of the hifBC, hmw1A, hmw2A, hmwC, and hia Genes in Haemophilus influenzae Isolates. J. Clin. Microbiol. 2004, 42, 3065–3072. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Atack, J.M.; Winter, L.E.; Jurcisek, J.A.; Bakaletz, L.O.; Barenkamp, S.J.; Jennings, M.P. Selection and Counterselection of Hia Expression Reveals a Key Role for Phase-Variable Expression of Hia in Infection Caused by Nontypeable Haemophilus influenzae. J. Infect. Dis. 2015, 212, 645–653. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Swords, W.E.; Buscher, B.A.; Ver Steeg, K., II; Preston, A.; Nichols, W.A.; Weiser, J.N.; Gibson, B.W.; Apicella, M.A. Non-typeable Haemophilus influenzae adhere to and invade human bronchial epithelial cells via an interaction of lipooligosaccharide with the PAF receptor. Mol. Microbiol. 2000, 37, 13–27. [Google Scholar] [CrossRef]
- Swords, W.E.; Ketterer, M.R.; Shao, J.; Campbell, C.A.; Weiser, J.N.; Apicella, M.A. Binding of the non-typeable Haemophilus influenzae lipooligosaccharide to the PAF receptor initiates host cell signalling. Cell. Microbiol. 2001, 3, 525–536. [Google Scholar] [CrossRef] [PubMed]
- St Geme, J.W.R. Molecular and cellular determinants of non-typeable Haemophilus influenzae adherence and invasion. Cell. Microbiol. 2002, 4, 191–200. [Google Scholar] [CrossRef] [PubMed]
- Osman, K.L.; Jefferies, J.M.; Woelk, C.H.; Cleary, D.W.; Clarke, S.C. The adhesins of non-typeable Haemophilus influenzae. Expert Rev. Anti-Infect. Ther. 2018, 16, 187–196. [Google Scholar] [CrossRef] [Green Version]
- Deadman, M.E.; Lundstrom, S.L.; Schweda, E.K.; Moxon, E.R.; Hood, D.W. Specific amino acids of the glycosyltransferase LpsA direct the addition of glucose or galactose to the terminal inner core heptose of Haemophilus influenzae lipopolysaccharide via alternative linkages. J. Biol. Chem. 2006, 281, 29455–29467. [Google Scholar] [CrossRef] [Green Version]
- Clementi, C.F.; Murphy, T.F. Non-typeable Haemophilus influenzae invasion and persistence in the human respiratory tract. Front. Cell. Infect. Microbiol. 2011, 1, 1. [Google Scholar] [CrossRef] [Green Version]
- Daum, R.S.; Scheifele, D.W.; Syriopoulou, V.P.; Averill, D.; Smith, A.L. Ventricular involvement in experimental Hemophilus influenzae meningitis. J. Pediatrics 1978, 93, 927–930. [Google Scholar] [CrossRef]
- Smith, A.L. Pathogenesis of Haemophilus influenzae meningitis. Pediatric Infect. Dis. J. 1987, 6, 783–786. [Google Scholar] [CrossRef]
- Scheifele, D.W.; Daum, R.S.; Syriopoulou, V.P.; Averill, D.R.; Smith, A.L. Haemophilus influenzae bacteremia and meningitis in infant primates. J. Lab. Clin. Med. 1980, 95, 450–462. [Google Scholar] [CrossRef] [PubMed]
- Häuser, S.; Wegele, C.; Stump-Guthier, C.; Borkowski, J.; Weiss, C.; Rohde, M.; Ishikawa, H.; Schroten, H.; Schwerk, C.; Adam, R. Capsule and fimbriae modulate the invasion of Haemophilus influenzae in a human blood-cerebrospinal fluid barrier model. Int. J. Med. Microbiol. 2018, 308, 829–839. [Google Scholar] [CrossRef] [PubMed]
- Guarner, J.; Greer, P.W.; Whitney, A.; Shieh, W.J.; Fischer, M.; White, E.H.; Carlone, G.M.; Stephens, D.S.; Popovic, T.; Zaki, S.R. Pathogenesis and diagnosis of human meningococcal disease using immunohistochemical and PCR assays. Am. J. Clin. Pathol. 2004, 122, 754–764. [Google Scholar] [CrossRef] [PubMed]
- Pron, B.; Taha, M.K.; Rambaud, C.; Fournet, J.C.; Pattey, N.; Monnet, J.P.; Musilek, M.; Beretti, J.L.; Nassif, X. Interaction of Neisseria maningitidis with the components of the blood-brain barrier correlates with an increased expression of PilC. J. Infect. Dis. 1997, 176, 1285–1292. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Berche, P. Bacteremia is required for invasion of the murine central nervous system by Listeria monocytogenes. Microb. Pathog. 1995, 18, 323–336. [Google Scholar] [CrossRef]
- Prats, N.; Briones, V.; Blanco, M.M.; Altimira, J.; Ramos, J.A.; Domínguez, L.; Marco, A. Choroiditis and meningitis in experimental murine infection with Listeria monocytogenes. Eur. J. Clin. Microbiol. Infect. Dis. 1992, 11, 744–747. [Google Scholar] [CrossRef]
- Schlüter, D.; Chahoud, S.; Lassmann, H.; Schumann, A.; Hof, H.; Deckert-Schlüter, M. Intracerebral targets and immunomodulation of murine Listeria monocytogenes meningoencephalitis. J. Neuropathol. Exp. Neurol. 1996, 55, 14–24. [Google Scholar] [CrossRef] [Green Version]
- Witcomb, L.A.; Collins, J.W.; McCarthy, A.J.; Frankel, G.; Taylor, P.W. Bioluminescent imaging reveals novel patterns of colonization and invasion in systemic Escherichia coli K1 experimental infection in the neonatal rat. Infect. Immun. 2015, 83, 4528–4540. [Google Scholar] [CrossRef] [Green Version]
- Dalgakiran, F.; Witcomb, L.A.; McCarthy, A.J.; Birchenough, G.M.; Taylor, P.W. Non-invasive model of neuropathogenic Escherichia coli infection in the neonatal rat. J. Vis. Exp. 2014, e52018. [Google Scholar] [CrossRef] [Green Version]
- Zelmer, A.; Bowen, M.; Jokilammi, A.; Finne, J.; Luzio, J.P.; Taylor, P.W. Differential expression of the polysialyl capsule during blood-to-brain transit of neuropathogenic Escherichia coli K1. Microbiology 2008, 154 Pt 8, 2522–2532. [Google Scholar] [CrossRef] [Green Version]
- Sanford, S.E. Gross and histopathological findings in unusual lesions caused by Streptococcus suis in pigs. II. Central nervous system lesions. Can. J. Vet. Res. Rev. Can. Rech. Vet. 1987, 51, 486–489. [Google Scholar]
- Williams, A.E.; Blakemore, W.F. Pathogenesis of meningitis caused by Streptococcus suis type 2. J. Infect. Dis. 1990, 162, 474–481. [Google Scholar] [CrossRef] [PubMed]
- Madsen, L.W.; Svensmark, B.; Elvestad, K.; Aalbaek, B.; Jensen, H.E. Streptococcus suis serotype 2 infection in pigs: New diagnostic and pathogenetic aspects. J. Comp. Pathol. 2002, 126, 57–65. [Google Scholar] [CrossRef] [PubMed]
- Domínguez-Punaro, M.C.; Segura, M.; Plante, M.M.; Lacouture, S.; Rivest, S.; Gottschalk, M. Streptococcus suis serotype 2, an important swine and human pathogen, induces strong systemic and cerebral inflammatory responses in a mouse model of infection. J. Immunol. 2007, 179, 1842–1854. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schwerk, C.; Papandreou, T.; Schuhmann, D.; Nickol, L.; Borkowski, J.; Steinmann, U.; Quednau, N.; Stump, C.; Weiss, C.; Berger, J.; et al. Polar Invasion and Translocation of Neisseria meningitidis and Streptococcus suis in a Novel Human Model of the Blood-Cerebrospinal Fluid Barrier. PLoS ONE 2012, 7, e30069. [Google Scholar] [CrossRef] [PubMed]
- Gründler, T.; Quednau, N.; Stump, C.; Orian-Rousseau, V.; Ishikawa, H.; Wolburg, H.; Schroten, H.; Tenenbaum, T.; Schwerk, C. The surface proteins InlA and InlB are interdependently required for polar basolateral invasion by Listeria monocytogenes in a human model of the blood-cerebrospinal fluid barrier. Microbes Infect. Inst. Pasteur 2013, 15, 291–301. [Google Scholar] [CrossRef]
- Rose, R.; Hauser, S.; Stump-Guthier, C.; Weiss, C.; Rohde, M.; Kim, K.S.; Ishikawa, H.; Schroten, H.; Schwerk, C.; Adam, R. Virulence factor-dependent basolateral invasion of choroid plexus epithelial cells by pathogenic Escherichia coli in vitro. FEMS Microbiol. Lett. 2018, 365. [Google Scholar] [CrossRef]
- Tenenbaum, T.; Papandreou, T.; Gellrich, D.; Friedrichs, U.; Seibt, A.; Adam, R.; Wewer, C.; Galla, H.J.; Schwerk, C.; Schroten, H. Polar bacterial invasion and translocation of Streptococcus suis across the blood-cerebrospinal fluid barrier in vitro. Cell. Microbiol. 2009, 11, 323–336. [Google Scholar] [CrossRef]
- Murphy, T.F. Vaccines for Nontypeable Haemophilus influenzae: The Future Is Now. Clin. Vaccine Immunol. 2015, 22, 459–466. [Google Scholar] [CrossRef] [Green Version]
- Ishiwata, I.; Ishiwata, C.; Ishiwata, E.; Sato, Y.; Kiguchi, K.; Tachibana, T.; Hashimoto, H.; Ishikawa, H. Establishment and characterization of a human malignant choroids plexus papilloma cell line (HIBCPP). Hum. Cell 2005, 18, 67–72. [Google Scholar] [CrossRef]
- Engelhardt, B.; Wolburg-Buchholz, K.; Wolburg, H. Involvement of the choroid plexus in central nervous system inflammation. Microsc. Res. Tech. 2001, 52, 112–129. [Google Scholar] [CrossRef]
- Van Alphen, L.; Poole, J.; Overbeeke, M. The Anton blood group antigen is the erythrocyte receptor for Haemophilus influenzae. FEMS Microbiol. Lett. 1986, 37, 69–71. [Google Scholar]
- Brinton, C.C., Jr.; Carter, M.J.; Derber, D.B.; Kar, S.; Kramarik, J.A.; To, A.C.; To, S.C.; Wood, S.W. Design and development of pilus vaccines for Haemophilus influenzae diseases. Pediatric Infect. Dis. J. 1989, 8 (Suppl. 1), S54–S61. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, C.A.; Avadhanula, V.; Buscher, A.; Smith, A.L.; St Geme, J.W., III; Adderson, E.E. Prevalence and Distribution of Adhesins in Invasive Non-Type b Encapsulated Haemophilus influenzae. Infect. Immun. 2003, 71, 1635–1642. [Google Scholar] [CrossRef] [Green Version]
- St Geme, J.W., 3rd; Cutter, D.; Barenkamp, S.J. Characterization of the genetic locus encoding Haemophilus influenzae type b surface fibrils. J. Bacteriol. 1996, 178, 6281–6287. [Google Scholar] [CrossRef] [Green Version]
- Dinner, S.; Borkowski, J.; Stump-Guthier, C.; Ishikawa, H.; Tenenbaum, T.; Schroten, H.; Schwerk, C. A Choroid Plexus Epithelial Cell-based Model of the Human Blood-Cerebrospinal Fluid Barrier to Study Bacterial Infection from the Basolateral Side. J. Vis. Exp. 2016. [Google Scholar] [CrossRef] [Green Version]
- St Geme, J.W.R.; Falkow, S. Loss of Capsule expression by Haemophilus influenzae Type b results in enhanced adherence to and invasion of human cells. Infect. Immun. 1991, 59, 1325–1333. [Google Scholar] [CrossRef] [Green Version]
- Faden, H.; Duffy, L.; Williams, A.; Krystofik, D.A.; Wolf, J. Epidemiology of Nasopharyngeal Colonization with Nontypeable Haemophilus influenzae inthe First 2 Years of Life. J. Infect. Dis. 1995, 172, 132–135. [Google Scholar] [CrossRef]
- Rao, V.K.; Krasan, G.P.; Hendrixson, D.R.; Dawid, S.; St Geme, J.W.R. Molecular determinants of the pathogenesis of disease due to non-typable Haemophilus influenzae. FEMS Microbiol. Lett. 1999, 23, 99–129. [Google Scholar] [CrossRef] [Green Version]
- Foxwell, A.R.; Kyd, J.M.; Cripps, A.W. Nontypeable Haemophilus influenzae: Pathogenesis and Prevention. Microbiol. Mol. Biol. Rev. 1998, 62, 294–308. [Google Scholar] [CrossRef] [Green Version]
- Parisi, D.N.; Martinez, L.R. Intracellular Haemophilus influenzae invades the brain: Is zyxin a critical blood brain barrier component regulated by TNF-alpha? Virulence 2014, 5, 645–647. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wispelwey, B.; Lesse, A.J.; Hansen, E.J.; Scheld, W.M. Haemophilus influenzae lipopolysaccharide-induced blood brain barrier permeability during experimental meningitis in the rat. J. Clin. Investig. 1988, 82, 1339–1346. [Google Scholar] [CrossRef] [PubMed]
- Wispelwey, B.; Hansen, E.J.; Scheld, W.M. Haemophilus influenzae outer membrane vesicle-induced blood-brain barrier permeability during experimental meningitis. Infect. Immun. 1989, 57, 2559–2562. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Caporarello, N.; Olivieri, M.; Cristaldi, M.; Scalia, M.; Toscano, M.A.; Genovese, C.; Addamo, A.; Salmeri, M.; Lupo, G.; Anfuso, C.D. Blood-Brain Barrier in a Haemophilus influenzae Type a In Vitro Infection: Role of Adenosine Receptors A2A and A2B. Mol. Neurobiol. 2018, 55, 5321–5336. [Google Scholar] [CrossRef] [PubMed]
- Miyazaki, Y.; Yusa, T.; Matsuo, S.; Terauchi, Y.; Miyazaki, S. Zyxin modulates the transmigration of Haemophilus influenzae to the central nervous system. Virulence 2014, 5, 665–672. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tunkel, A.R.; Wispelwey, B.; Quagliarello, V.J.; Rosser, S.W.; Lesse, A.J.; Hansen, E.J.; Scheld, W.M. Pathophysiology of Blood-Brain Barrier alterations during experimental Haemophilus influenzae meningitis. J. Infect. Dis. 1992, 165 (Suppl. 1), 119–120. [Google Scholar] [CrossRef] [PubMed]
- LaClaire, L.L.; Tondella, M.L.C.; Beall, D.S.; Noble, C.A.; Raghunathan, P.L.; Rosenstein, N.E.; Popovic, T. Identification of Haemophilus influenzae Serotypes by Standard Slide Agglutination Serotyping and PCR-Based Capsule Typing. J. Clin. Microbiol. 2003, 41, 393–396. [Google Scholar] [CrossRef] [Green Version]
- Erwin, A.L.; Smith, A.L. Nontypeable Haemophilus influenzae: Understanding virulence and commensal behavior. Trends Microbiol. 2007, 15, 355–362. [Google Scholar] [CrossRef]
- Reddy, M.S.; Bernstein, J.M.; Murphy, T.F.; Faden, H.S. Binding between outer membrane proteins of nontypeable Haemophilus influenzae and human nasopharyngeal mucin. Infect. Immun. 1996, 64, 1477–1479. [Google Scholar] [CrossRef] [Green Version]
- Duim, B.; Bowler, L.D.; Eijk, P.; Jansen, H.M.; Dankert, J.; van Alphen, L. Molecular Variation in the Major Outer Membrane Protein P5 Gene of NonencapsulatedHaemophilus influenzaeduring Chronic Infections. Infect. Immun. 1997, 65, 1351–1356. [Google Scholar] [CrossRef] [Green Version]
- Langereis, J.D.; de Jonge, M.I.; Weiser, J.N. Binding of human factor H to outer membrane protein P5 of non-typeable Haemophilus influenzae contributes to complement resistance. Mol. Microbiol. 2014, 94, 89–106. [Google Scholar] [CrossRef] [Green Version]
- Tchoupa, A.K.; Lichtenegger, S.; Reidl, J.; Hauck, C.R. Outer membrane protein P1 is the CEACAM-binding adhesin of Haemophilus influenzae. Mol. Microbiol. 2015, 98, 440–455. [Google Scholar] [CrossRef] [Green Version]
- Hill, D.J.; Toleman, M.A.; Evans, D.J.; Villullas, S.; van Alphen, L.; Virji, M. The variable P5 proteins of typeable and non-typeable Haemophilus influenzae target human CEACAM1. Mol. Microbiol. 2001, 39, 850–862. [Google Scholar] [CrossRef] [Green Version]
- Orihuela, C.J.; Mahdavi, J.; Thornton, J.; Mann, B.; Wooldridge, K.G.; Abouseada, N.; Oldfield, N.J.; Self, T.; Ala’Aldeen, D.A.; Tuomanen, E.I. Laminin receptor initiates bacterial contact with the blood brain barrier in experimental meningitis models. J. Clin. Investig. 2009, 119, 1638–1646. [Google Scholar] [CrossRef] [Green Version]
- Ronander, E.; Brant, M.; Eriksson, E.; Morgelin, M.; Hallgren, O.; Westergren-Thorsson, G.; Forsgren, A.; Riesbeck, K. Nontypeable Haemophilus influenzae adhesin protein E: Characterization and biological activity. J. Infect. Dis. 2009, 199, 522–531. [Google Scholar] [CrossRef] [Green Version]
- Borkowski, J.; Li, L.; Steinmann, U.; Quednau, N.; Stump-Guthier, C.; Weiss, C.; Findeisen, P.; Gretz, N.; Ishikawa, H.; Tenenbaum, T.; et al. Neisseria meningitidis elicits a pro-inflammatory response involving IκBζ in a human blood-cerebrospinal fluid barrier model. J. Neuroinflamm. 2014, 11, 163. [Google Scholar] [CrossRef] [Green Version]
- St Geme, J.W.R.; Cutter, D. The Haemophilus influenzae Hia Adhesin Is an Autotransporter Protein That Remains Uncleaved at the C Terminus and Fully Cell Associated. J. Bacteriol. 2000, 182, 6005–6013. [Google Scholar] [CrossRef] [Green Version]
- Laarmann, S.; Cutter, D.; Juehne, T.; Barenkamp, S.J.; St Geme, J.W. The Haemophilus influenzae Hia autotransporter harbours two adhesive pockets that reside in the passenger domain and recognize the same host cell receptor. Mol. Microbiol. 2002, 46, 731–743. [Google Scholar] [CrossRef]
- Yeo, H.J.; Cotter, S.E.; Laarmann, S.; Juehne, T.; St Geme, J.W., 3rd; Waksman, G. Structural basis for host recognition by the Haemophilus influenzae Hia autotransporter. EMBO J. 2004, 23, 1245–1256. [Google Scholar] [CrossRef] [Green Version]
- Krasan, G.P.; Cutter, D.; Block, S.L.; St Geme, J.W.R. Adhesin Expression in matched nasopharyngeal and middle ear isolates of Nontypeable Haemophilus influenzae from children with acute otitis media. Infect. Immun. 1999, 67, 449–454. [Google Scholar] [CrossRef] [Green Version]
- Van Alphen, L.; van den Berghe, N.; Geelen-Van Den Broek, L. Interaction of Haemophilus influenzae with human erythrocytes and oropharyngeal epithelial cells Is mediated by a common fimbrial epitope. Infect. Immun. 1988, 56, 1800–1806. [Google Scholar] [CrossRef] [Green Version]
- Weber, A.; Harris, K.; Lohrke, S.; Forney, L.; Smith, A.L. Inability to express fimbriae results in impaired ability of Haemophilus influenzae b to colonize the Nasopharynx. Infect. Immun. 1991, 59, 4724–4728. [Google Scholar] [CrossRef] [Green Version]
- Kubiet, M.; Ramphal, R.; Weber, A.; Smith, A. Pilus-mediated adherence of Haemophilus influenzae to human respiratory mucins. Infect. Immun. 2000, 68, 3362–3367. [Google Scholar] [CrossRef] [Green Version]
- Mason, E.O., Jr.; Kaplan, S.L.; Wiedermann, B.L.; Norrod, E.P.; Stenback, W.A. Frequency and properties of naturally occurring adherent piliated strains of Haemophilus influenzae type b. Infect. Immun. 1985, 49, 98–103. [Google Scholar] [CrossRef] [Green Version]
- Gilsdorf, J.R.; Chang, H.Y.; McCrea, K.W.; Bakaletz, L.O. Comparison of Hemagglutinating Pili of Haemophilus influenzae Type b with similar structures of Nontypeable H. influenzae. Infect. Immun. 1992, 60, 374–379. [Google Scholar] [CrossRef] [Green Version]
- Hallström, T.; Resman, F.; Ristovski, M.; Riesbeck, K. Binding of complement regulators to invasive nontypeable Haemophilus influenzae isolates is not increased compared to nasopharyngeal isolates, but serum resistance is linked to disease severity. J. Clin. Microbiol. 2010, 48, 921–927. [Google Scholar] [CrossRef] [Green Version]
- Pichichero, M.E.; Porter, A.; Loeb, M.; Smith, D.H. Do Pili play a role a pathogenicity of Haemophilus influenzae Type B? Lancet 1982, 320, 960–962. [Google Scholar] [CrossRef]
- Gilsdorf, J.R. What the pediatrician should know about non-typeable Haemophilus influenzae. J. Infect. 2015, 71 (Suppl. 1), S10–S14. [Google Scholar] [CrossRef]
- Van Ketel, R.J.; de Wever, B.; van Alphen, L. Detection of Haemophilus influenzae in cerebrospinal fluids by polymerase chain reaction DNA amplification. J. Med. Microbiol. 1990, 33, 271–276. [Google Scholar] [CrossRef] [Green Version]
- Rozen, S.; Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. (Clifton, N.J.) 2000, 132, 365–386. [Google Scholar] [CrossRef] [Green Version]
- Bagherzadeh Khodashahri, S.; Siadat, S.D.; Rahbar, M.; Abdollahpour-Alitappeh, M.; Vaziri, F.; Rahnamaye-Farzami, M.; Mohammadzadeh, M.; Davari, M.; Fateh, A.; Masoumi, M. Genotyping of Haemophilus influenzae type b strains and their incidence in the clinical samples isolated from Iranian patients. Iran. J. Microbiol. 2015, 7, 136–143. [Google Scholar]
- Clemans, D.L.; Marrs, C.F.; Patel, M.; Duncan, M.; Gilsdorf, J.R. Comparative Analysis of Haemophilus influenzae hifA (Pilin) Genes. Infect. Immun. 1998, 66, 656–663. [Google Scholar] [CrossRef] [Green Version]
- Forbes, K.J.; Bruce, K.D.; Ball, A.; Pennington, T.H. Variation in length and sequence of porin (ompP2) alleles of non-capsulate Haemophilus influenzae. Mol. Microbiol. 1992, 6, 2107–2112. [Google Scholar] [CrossRef]
- Reidl, J.; Mekalanos, J.J. Lipoprotein e(P4) Is Essential for Hemin Uptake by Haemophilus influenzae. J. Exp. Med. 1996, 183, 621–629. [Google Scholar] [CrossRef] [Green Version]
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wegele, C.; Stump-Guthier, C.; Moroniak, S.; Weiss, C.; Rohde, M.; Ishikawa, H.; Schroten, H.; Schwerk, C.; Karremann, M.; Borkowski, J. Non-Typeable Haemophilus influenzae Invade Choroid Plexus Epithelial Cells in a Polar Fashion. Int. J. Mol. Sci. 2020, 21, 5739. https://doi.org/10.3390/ijms21165739
Wegele C, Stump-Guthier C, Moroniak S, Weiss C, Rohde M, Ishikawa H, Schroten H, Schwerk C, Karremann M, Borkowski J. Non-Typeable Haemophilus influenzae Invade Choroid Plexus Epithelial Cells in a Polar Fashion. International Journal of Molecular Sciences. 2020; 21(16):5739. https://doi.org/10.3390/ijms21165739
Chicago/Turabian StyleWegele, Christian, Carolin Stump-Guthier, Selina Moroniak, Christel Weiss, Manfred Rohde, Hiroshi Ishikawa, Horst Schroten, Christian Schwerk, Michael Karremann, and Julia Borkowski. 2020. "Non-Typeable Haemophilus influenzae Invade Choroid Plexus Epithelial Cells in a Polar Fashion" International Journal of Molecular Sciences 21, no. 16: 5739. https://doi.org/10.3390/ijms21165739