Fusarium graminearum ATP-Binding Cassette Transporter Gene FgABCC9 Is Required for Its Transportation of Salicylic Acid, Fungicide Resistance, Mycelial Growth and Pathogenicity towards Wheat
Abstract
1. Introduction
2. Results
2.1. Sequence Analysis
2.2. Deletion and Complementation of FgABCC9 in F. graminearum
2.3. Importance of FgABCC9 for Mycelial Growth and Fungal Response to Stress Conditions
2.4. FgABCC9 Affects Pathogenicity and DON Production
2.5. Evaluation of the Function of FgABCC9 in A. thaliana
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Sequence Analysis
4.3. Construction of Deletion and Complementation Mutants
4.4. Conidial and Mycelial Growth Conditions
4.5. Virulence Assay
4.6. Gene Expression Analysis
4.7. Quantification of SA
4.8. Microscopic Assay
4.9. Statistical Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Appendix A

References
- Goswami, R.S.; Kistler, H.C. Heading for disaster: Fusarium graminearum on cereal crops. Mol. Plant Pathol. 2004, 5, 515–525. [Google Scholar] [CrossRef] [PubMed]
- Walter, S.; Nicholson, P.; Doohan, F.M. Action and reaction of host and pathogen during Fusarium head blight disease. New Phytol. 2010, 185, 54–66. [Google Scholar] [CrossRef] [PubMed]
- Kazan, K.; Gardiner, D.M.; Manners, J.M. On the trail of a cereal killer: Recent advances in Fusarium graminearum pathogenomics and host resistance. Mol. Plant Pathol. 2012, 13, 399–413. [Google Scholar] [CrossRef] [PubMed]
- Fernando, W.G.D.; Paulitz, T.C.; Seaman, W.L.; Dutilleul, P.; Miller, J.D. Head blight gradients caused by Gibberella zeae from area sources of inoculum in wheat field plots. Phytopathology 1997, 87, 414–421. [Google Scholar] [CrossRef] [PubMed]
- Chandler, E.A.; SimPson, D.R.; Thomsett, M.A.; Nicholson, P. Development of PCR assays to Tri7 and Tri13 trichothecene biosynthetic genes, and characterization of chemotypes of Fusarium graminearum, Fusarium culomrum and Fusarium cerealis. Physiol. Mol. Plant Pathol. 2003, 62, 355–367. [Google Scholar] [CrossRef]
- Higgins, C.F. ABC transporters: From microorganisms to man. Annu. Rev. Cell Biol. 1992, 8, 67–113. [Google Scholar] [CrossRef] [PubMed]
- Dassa, E.; Bouige, P. The ABC of ABCs: A phylogenetic and functional classification of ABC systems in living organisms. Res. Microbiol. 2001, 152, 211–229. [Google Scholar] [CrossRef]
- Sánchez-Fernández, R.; Davies, T.G.; Coleman, J.O.; Rea, P.A. The Arabidopsis thaliana ABC protein superfamily, a complete inventory. J. Biol. Chem. 2001, 276, 30231–30244. [Google Scholar] [CrossRef] [PubMed]
- Kovalchuk, A.; Driessen, A. Phylogenetic analysis of fungal ABC transporters. BMC Genom. 2010, 11, 177. [Google Scholar] [CrossRef] [PubMed]
- Ween, M.P.; Armstrong, M.A.; Oehler, M.K.; Ricciardelli, C. The role of ABC transporters in ovarian cancer progression and chemoresistance. Crit. Rev. Oncol./Hematol. 2015, 96, 220–256. [Google Scholar] [CrossRef] [PubMed]
- Kretschmer, M.; Leroch, M.; Mosbach, A.; Walker, A.S.; Fillinger, S.; Mernke, D.; Schoonbeek, H.J.; Pradier, J.M.; Leroux, P.; De Waard, M.A.; et al. Fungicide-driven evolution and molecular basis of multidrug resistance in field populations of the grey mould fungus Botrytis cinerea. PLoS Pathog. 2009, 5, e1000696. [Google Scholar] [CrossRef] [PubMed]
- Becher, R.; Weihmann, F.; Deising, H.B.; Wirsel, S.G. Development of a novel multiplex DNA microarray for Fusarium graminearum and analysis of azole fungicide responses. BMC Genom. 2011, 12, 12–52. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Son, H.; Lee, J.; Lee, Y.R.; Lee, Y.W. A putative ABC transporter gene, ZRA1, is required for zearalenone production in Gibberella zeae. Curr. Genet. 2011, 57, 343–351. [Google Scholar] [CrossRef] [PubMed]
- Stephens, A.E.; Gardiner, D.M.; White, R.G.; Munn, A.L.; Manners, J.M. Phases of infection and gene expression of Fusarium graminearum during crown rot disease of wheat. Mol. Plant Microbe Interact. 2008, 21, 1571–1581. [Google Scholar] [CrossRef] [PubMed]
- Abou Ammar, G.; Tryono, R.; Döll, K.; Karlovsky, P.; Deising, H.B.; Wirsel, S.G. Identification of ABC transporter genes of Fusarium graminearum with roles in azole tolerance and/or virulence. PLoS ONE 2013, 8, e79042. [Google Scholar] [CrossRef] [PubMed]
- Kosaka, A.; Ban, T.; Manickavelu, A. Genome-wide transcriptional profiling of wheat infected with Fusarium graminearum. Genom. Data 2015, 5, 260–262. [Google Scholar] [CrossRef] [PubMed]
- De Vos, M.; Van Oosten, V.R.; Van Poecke, R.M.P.; Van Pelt, J.A.; Pozo, M.J.; Mueller, M.J.; Buchala, A.J.; Metraux, J.P.; Van Loon, L.C.; Dicke, M.; et al. Signal signature and transcriptome changes of Arabidopsis during pathogen and insect attack. Mol. Plant Microbe Interact. 2005, 18, 923–937. [Google Scholar] [CrossRef] [PubMed]
- Glazebrook, J. Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu. Rev. Phytopathol. 2005, 43, 205–227. [Google Scholar] [CrossRef] [PubMed]
- Görlach, J.; Volrath, S.; Knauf-Beiter, G.; Hengy, G.; Beckhove, U.; Kogel, K.; Oostendorp, M.; Staub, T.; Ward, E.; Kessmann, H.; et al. Benzothiadiazole, a novel class of inducers of systemic acquired resistance, activates gene expression and disease resistance in wheat. Plant Cell 1996, 8, 629–643. [Google Scholar] [CrossRef] [PubMed]
- Ward, E.R.; Uknes, S.J.; Williams, S.C.; Dincher, S.S.; Wiederhold, D.L.; Alexander, D.C.; Ahl-Goy, P.; Metraux, J.P.; Ryals, J.A. Coordinate gene activity in response to agents that induce systemic acquired resistance. Plant Cell 1991, 3, 1085–1094. [Google Scholar] [CrossRef] [PubMed]
- Uknes, S.; Mauch-Mani, B.; Moyer, M.; Potter, S.; Williams, S.; Dincher, S.; Chandler, D.; Slusarenko, A.; Ward, E.; Ryals, J. Acquired resistance in Arabidopsis. Plant Cell 1992, 4, 645–656. [Google Scholar] [CrossRef] [PubMed]
- Qi, P.F.; Balcerzak, M.; Rocheleaub, H.; Leung, W.; Wei, Y.M.; Zheng, Y.L.; Ouellet, T. Jasmonic acid and abscisic acid play important roles in host-pathogen interaction between Fusarium graminearum and wheat during the early stages of fusarium head blight. Physiol. Mol. Plant Pathol. 2016, 93, 39–48. [Google Scholar] [CrossRef]
- Makandar, R.; Essig, J.S.; Schapaugh, M.A.; Trick, H.N.; Shah, J. Genetically engineered resistance to Fusarium head blight in wheat by expression of Arabidopsis NPR1. Mol. Plant Microbe Interact. 2006, 19, 123–129. [Google Scholar] [CrossRef] [PubMed]
- Qi, P.F.; Johnston, A.; Balcerzak, M.; Rocheleau, H.; Harris, L.J.; Long, X.Y.; Wei, Y.M.; Zheng, Y.L.; Ouellet, T. Effect of salicylic acid on Fusarium graminearum, the major causal agent of Fusarium Head Blight in wheat. Fungal Biol. 2012, 116, 413–426. [Google Scholar] [CrossRef] [PubMed]
- Harris, L.J.; Balcerzak, M.; Johnston, A.; Schneiderman, D.; Ouellet, T. Host-preferential Fusarium graminearum gene expression during infection of wheat, barley, and maize. Fungal Biol. 2016, 120, 111–123. [Google Scholar] [CrossRef] [PubMed]
- Locher, K.P. Review. Structure and mechanism of ATP-binding cassette transporters. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2009, 364, 239–245. [Google Scholar] [CrossRef] [PubMed]
- Pajerowska-Mukhtar, K.M.; Emerine, D.K.; Mukhtar, M.S. Tell me more: Roles of NPRs in plant immunity. Trends Plant Sci. 2013, 18, 402–411. [Google Scholar] [CrossRef] [PubMed]
- Seyfferth, C.; Tsuda, K. Salicylic acid signal transduction: The initiation of biosynthesis, perception and transcriptional reprogramming. Front. Plant Sci. 2014, 5, 697. [Google Scholar] [CrossRef] [PubMed]
- Giri, M.K.; Singh, N.; Banday, Z.Z.; Singh, V.; Ram, H.; Singh, D.; Chattopadhyay, S.; Nandi, A.K. GBF1 differentially regulates CAT2 and PAD4 transcription to promote pathogen defense in Arabidopsis thaliana. Plant J. 2017, 91, 802–815. [Google Scholar] [CrossRef] [PubMed]
- Gardiner, D.M.; Stephens, A.E.; Munn, A.L.; Manners, J.M. An ABC pleiotropic drug resistance transporter of Fusariumg raminearum with a role in crown and root diseases of wheat. FEMS Microbiol. Lett. 2013, 348, 36–45. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.Z.; Chen, Q.; Liu, C.H.; Liu, Y.B.; Yi, P.; Niu, K.; Wang, Y.Q.; Wang, A.Q.; Yu, H.Y.; Pu, Z.E.; et al. Chitin synthase gene FgCHS8 affects virulence and fungal cell wall sensitivity to environmental stress in Fusarium graminearum. Fungal Biol. 2016, 120, 764–774. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.Z.; Wei, Z.Z.; Liu, C.H.; Chen, Q.; Xu, B.J.; Guo, Z.R.; Cao, Y.L.; Wang, Y.; Han, Y.N.; Chen, C.; et al. Linoleic acid isomerase gene FgLAI12 affects sensitivity to salicylic acid, mycelial growth and virulence of Fusarium graminearum. Sci. Rep. 2017, 7, 46129. [Google Scholar] [CrossRef] [PubMed]
- Blandino, M.; Minelli, L.; Reyneri, A. Strategies for the chemical control of Fusarium head blight: Effect on yield, alveographic parameters and deoxynivalenol contamination in winter wheat grain. Eur. J. Agron. 2006, 25, 193–201. [Google Scholar] [CrossRef]
- De Waard, M.A.; Andrade, A.C.; Hayashi, K.; Schoonbeek, H.J.; Stergiopoulos, I.; Zwiers, L.H. Impact of fungal drug transporters on fungicide sensitivity, multidrug resistance and virulence. Pest Manag. Sci. 2006, 62, 195–207. [Google Scholar] [CrossRef] [PubMed]
- Leroux, P.; Albertini, C.; Gautier, A.; Gredt, M.; Walker, A.S. Mutations in the CYP51 gene correlated with changes in sensitivity to sterol 14 alpha-demethylation inhibitors in field isolates of Mycosphaerella graminicola. Pest Manag. Sci. 2007, 63, 688–698. [Google Scholar] [CrossRef] [PubMed]
- Luo, C.X.; Schnabel, G. The cytochrome P450 lanosterol 14alpha-demethylase gene is a demethylation inhibitor fungicide resistance determinant in Monilinia fructicola field isolates from Georgia. Appl. Environ. Microbiol. 2008, 74, 359–366. [Google Scholar] [CrossRef] [PubMed]
- Katzmann, D.J.; Hallstrom, T.C.; Voet, M.; Wysock, W.; Golin, J.; Volckaert, G.; Moye-Rowley, W.S. Expression of an ATP-binding cassette transporter-encoding gene (YOR1) is required for oligomycin resistance in Saccharomyces cerevisiae. Mol. Cell. Biol. 1995, 15, 6875–6883. [Google Scholar] [CrossRef] [PubMed]
- Cui, Z.; Hirata, D.; Tsuchiya, E.; Osada, H.; Miyakawa, T. The multidrug resistance-associated protein (MRP) subfamily (Yrs1/Yor1) of Saccharomyces cerevisiae is important for the tolerance to a broad range of organic anions. J. Biol. Chem. 1996, 271, 14712–14716. [Google Scholar] [CrossRef] [PubMed]
- Decottignies, A.; Grant, A.M.; Nichols, J.W.; de Wet, H.; McIntosh, D.B.; Goffeau, A. ATPase and multidrug transport activities of the overexpressed yeast ABC protein Yor1p. J. Biol. Chem. 1998, 273, 12612–12622. [Google Scholar] [CrossRef] [PubMed]
- Clough, S.J.; Bent, A.F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998, 16, 735–743. [Google Scholar] [CrossRef] [PubMed]
- Kelley, L.A.; Mezulis, S.; Yates, C.M.; Wass, M.N.; Sternberg, M.J. The Phyre2 web portal for protein modeling, prediction and analysis. Nat. Protoc. 2015, 10, 845–858. [Google Scholar] [CrossRef] [PubMed]
- Remans, T.; Smeets, K.; Opdenakker, K.; Mathijsen, D.; Vangronsveld, J.; Cuypers, A. Normalisation of real-time RT-PCR gene expression measurements in Arabidopsis thaliana exposed to increased metal concentrations. Planta 2008, 227, 1343–1349. [Google Scholar] [CrossRef] [PubMed]
- Tandon, G.; Jaiswal, S.; Iquebal, M.A.; Kumar, S.; Kaur, S.; Rai, A.; Kumar, D. Evidence of salicylic acid pathway with EDS1 and PAD4 proteins by molecular dynamics simulation for grape improvement. J. Biomol. Struct. Dyn. 2015, 33, 2180–2191. [Google Scholar] [CrossRef] [PubMed]
- Gatz, C. From pioneers to team players: TGA transcription factors provide a molecular link between different stress pathways. Mol. Plant Microbe Interact. 2013, 26, 151–159. [Google Scholar] [CrossRef] [PubMed]
- Lodhi, M.A.; Ye, G.N.; Weeden, N.F.; Reisch, B.I. A simple and efficient method for DNA extraction from grapevine cultivars and Vitis species. Plant Mol. Biol. Rep. 1994, 12, 6–13. [Google Scholar] [CrossRef]
- Frandsen, R.J.; Andersson, J.A.; Kristensen, M.B.; Giese, H. Efficient four fragment cloning for the construction of vectors for targeted gene replacement in filamentous fungi. BMC Mol. Biol. 2008, 9, 70. [Google Scholar] [CrossRef] [PubMed]
- Capellini, R.A.; Peterson, J.L. Macroconidium formation in submerged cultures by a non-sporulating strains of Gibberella zeae. Mycologia 1965, 57, 962–966. [Google Scholar] [CrossRef]
- Fang, S.; Yan, X.; Liao, H. 3D reconstruction and dynamic modeling of root architecture in situ and its application to crop phosphorus research. Plant J. 2009, 60, 1096–1108. [Google Scholar] [CrossRef] [PubMed]
- Miller, D.; Blackwell, B.A. Biosynthesis of 3-acetyldeoxynivalenol and other metabolites by Fusarium culmorum HLK 1503 in a stirred jar fermentor. Can. J. Bot. 1986, 64, 1–5. [Google Scholar] [CrossRef]
- Siciliano, I.; Amaral Carneiro, G.; Spadaro, D.; Garibaldi, A.; Gullino, M.L. Jasmonic acid, abscisic acid, and salicylic acid are involved in the phytoalexin responses of rice to Fusarium fujikuroi, a high gibberellin producer pathogen. J. Agric. Food Chem. 2015, 63, 8134–8142. [Google Scholar] [CrossRef] [PubMed]
- Tang, Q.Y.; Zhang, C.X. Data Processing System (DPS) software with experimental design, statistical analysis and data mining developed for use in entomological research. Insect Sci. 2013, 20, 254–260. [Google Scholar] [CrossRef] [PubMed]




| Primer | Sequence (5′–3′) | Source |
|---|---|---|
| LB-F | GCGGGCCCAGGCTACTATGGCTGTT | This study |
| LB-R | GCGAGCTCAGATGCGAAAGGGTC | This study |
| RB-F | GGAAGCTTCAATCCCGTTGTTCTGGT | This study |
| RB -R | GGACTAGTAGCCTGCTTCGTGTTCC | This study |
| P1-F | CTTTTCTCTTAGGTTTACCCG | [31] |
| P2-R | TAATGCAGGAGTCGCATAAG | [31] |
| P3-F | CCCAAAAAGTGCTCCTTCAA | [31] |
| P4-R | TGTGCTGCAAGGCGATTAA | [31] |
| ΔJ-U-F | CCTCGGGCGGTCTGTTT | This study |
| ΔJ-U-R | TTCGGCGTGGGTATGG | This study |
| ΔJ-D-F | TCCTCGTTCCTGTCTG | This study |
| ΔJ-D-R | CTCCGATGATGAGAAGT | This study |
| C-FgABCC9-F | TGCCATGGTATTACCGTACTTCCCTA | This study |
| C-FgABCC9-R | GGACTAGTCGACTGTCTACTCGACTC | This study |
| CJ-FgABCC9-F | AAGAAGGCAAAGAAAGCAAA | This study |
| CJ-FgABCC9-R | GAACAAGGCCAGTGATGAGA | This study |
| Fg-GAPDH-F | TGACTTGACTGTTCGCCTCGAGAA | [24] |
| Fg-GAPDH-R | ATGGAGGAGTTGGTGTTGCCGTTA | [24] |
| Fg-β-tubulin-F | GTTGATCTCCAAGATCCGTG | [24] |
| Fg-β-tubulin-R | CATGCAAATGTCGTAGAGGG | [24] |
| Fg-elongation Factor1-F | CCTCCAGGATGTCTACAAGA | [24] |
| Fg-elongation Factor1-R | CTCAACGGACTTGACTTCAG | [24] |
| Aox-F | GACTTGTCATGGTAGATGCCTG | [24] |
| Aox-R | CAGGACGAGCATAACCATTCTC | [24] |
| w-GAPDH-F | AACTGTTCATGCCATCACTGCCAC | [24] |
| w-GAPDH-R | AGGACATACCAGTGAGCTTGCCAT | [24] |
| hn-RNP-Q-F | TCACCTTCGCCAAGCTCAGAACTA | [24] |
| hn-RNP-Q-R | AGTTGAACTTGCCCGAAACATGCC | [24] |
| Rj-FgABCC9-F | GCGGGACCACAAGGGATT | This study |
| Rj-FgABCC9-R | GATGTAGGCACCGTAGACAGACC | This study |
| ACT2-F | CTTGCACCAAGCAGCATGAA | [42] |
| ACT2-R | CCGATCCAGACACTGTACTTCCTT | [42] |
| UBQ10-F | GGCCTTGTATAATCCCTGATGAATAAG | [42] |
| UBQ10-R | AAAGAGATAACAGGAACGGAAACATAGT | [42] |
| EF-1α-F | TGAGCACGCTCTTCTTGCTTTCA | [42] |
| EF-1α-R | GGTGGTGGCATCCATCTTGTTACA | [42] |
| EDS1-F | GGATAGAAGATGAATACAAGCC | [43] |
| EDS1-R | ACCTAAGGTTCAGGTATCTGT | [43] |
| PR1F | TGGCTATTCTCGATTTTTAATCG | [29] |
| PR1R | CCATTGCACGTGTTCGCAG | [29] |
| NPR1-F | CATTCTCTCAAAGGCCGACT | [44] |
| NPR1-R | AAGACGTTGAGCAAGTGCAA | [44] |
| PAD4-F | ATGGACGATTGTCGATTCGAG | [43] |
| PAD4-R | CTAAGTCTCCATTGCGTCACT | [43] |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qi, P.-F.; Zhang, Y.-Z.; Liu, C.-H.; Zhu, J.; Chen, Q.; Guo, Z.-R.; Wang, Y.; Xu, B.-J.; Zheng, T.; Jiang, Y.-F.; et al. Fusarium graminearum ATP-Binding Cassette Transporter Gene FgABCC9 Is Required for Its Transportation of Salicylic Acid, Fungicide Resistance, Mycelial Growth and Pathogenicity towards Wheat. Int. J. Mol. Sci. 2018, 19, 2351. https://doi.org/10.3390/ijms19082351
Qi P-F, Zhang Y-Z, Liu C-H, Zhu J, Chen Q, Guo Z-R, Wang Y, Xu B-J, Zheng T, Jiang Y-F, et al. Fusarium graminearum ATP-Binding Cassette Transporter Gene FgABCC9 Is Required for Its Transportation of Salicylic Acid, Fungicide Resistance, Mycelial Growth and Pathogenicity towards Wheat. International Journal of Molecular Sciences. 2018; 19(8):2351. https://doi.org/10.3390/ijms19082351
Chicago/Turabian StyleQi, Peng-Fei, Ya-Zhou Zhang, Cai-Hong Liu, Jing Zhu, Qing Chen, Zhen-Ru Guo, Yan Wang, Bin-Jie Xu, Ting Zheng, Yun-Feng Jiang, and et al. 2018. "Fusarium graminearum ATP-Binding Cassette Transporter Gene FgABCC9 Is Required for Its Transportation of Salicylic Acid, Fungicide Resistance, Mycelial Growth and Pathogenicity towards Wheat" International Journal of Molecular Sciences 19, no. 8: 2351. https://doi.org/10.3390/ijms19082351
APA StyleQi, P.-F., Zhang, Y.-Z., Liu, C.-H., Zhu, J., Chen, Q., Guo, Z.-R., Wang, Y., Xu, B.-J., Zheng, T., Jiang, Y.-F., Wang, J.-P., Zhou, C.-Y., Feng, X., Kong, L., Lan, X.-J., Jiang, Q.-T., Wei, Y.-M., & Zheng, Y.-L. (2018). Fusarium graminearum ATP-Binding Cassette Transporter Gene FgABCC9 Is Required for Its Transportation of Salicylic Acid, Fungicide Resistance, Mycelial Growth and Pathogenicity towards Wheat. International Journal of Molecular Sciences, 19(8), 2351. https://doi.org/10.3390/ijms19082351

