Glyteer, Soybean Tar, Impairs IL-4/Stat6 Signaling in Murine Bone Marrow-Derived Dendritic Cells: The Basis of Its Therapeutic Effect on Atopic Dermatitis
Abstract
1. Introduction
2. Results
2.1. IL-4 Stimulation Induced Ccl17 and Ccl22 Production in BMDCs
2.2. Glyteer Treatment Inhibited IL-4-Induced Ccl17 and Ccl22 Production in BMDCs
2.3. Glyteer Treatment Inhibited IL-4-Induced Ccl17 and Ccl22 Production in an Ahr-Independent Manner in BMDCs
2.4. Glyteer Treatment Inhibited Nuclear Translocation of Stat6 Induced by IL-4 Stimulation without Affecting Phosphorylation of Stat6 in BMDCs
3. Discussion
4. Materials and Methods
4.1. Reagents
4.2. Generation of Bone Marrow-Derived DCs (BMDCs) and Cell Culture
4.3. WST-1 Assay
4.4. Quantitative Reverse Transcription (qRT)-PCR Analysis
4.5. Western Blotting Analysis
4.6. Cellular Nuclear Protein Preparation for Western Blot Analysis
4.7. ELISA
4.8. Statistical Analysis
Supplementary Materials
Acknowledgments
Author Contributions
Conflicts of Interest
Abbreviations
Ccl17 | Chemokine (C-C motif) ligand 17 |
Ccl22 | Chemokine (C-C motif) ligand 22 |
IL-4 | Interleukin-4 |
Stat6 | Signal transducer and activator of transcription 6 |
References
- Furue, M.; Chiba, T.; Tsuji, G.; Ulzii, D.; Kido-Nakahara, M.; Nakahara, T.; Kadono, T. Atopic dermatitis: Immune deviation, barrier dysfunction, IgE autoreactivity and new therapies. Allergol. Int. 2017, 66, 398–403. [Google Scholar] [CrossRef] [PubMed]
- Masuoka, M.; Shiraishi, H.; Ohta, S.; Suzuki, S.; Arima, K.; Aoki, S.; Toda, S.; Inagaki, N.; Kurihara, Y.; Hayashida, S.; et al. Periostin promotes chronic allergic inflammation in response to Th2 cytokines. J. Clin. Investig. 2012, 122, 2590–2600. [Google Scholar] [CrossRef] [PubMed]
- Soumelis, V.; Reche, P.A.; Kanzler, H.; Yuan, W.; Edward, G.; Homey, B.; Gilliet, M.; Ho, S.; Antonenko, S.; Lauerma, A.; et al. Human epithelial cells trigger dendritic cell mediated allergic inflammation by producing TSLP. Nat. Immunol. 2002, 7, 673–680. [Google Scholar] [CrossRef] [PubMed]
- Elentner, A.; Finke, D.; Schmuth, M.; Chappaz, S.; Ebner, S.; Malissen, B.; Kissenpfennig, A.; Romani, N.; Dubrac, S. Langerhans cells are critical in the development of atopic dermatitis-like inflammation and symptoms in mice. J. Cell. Mol. Med. 2009, 13, 2658–2672. [Google Scholar] [CrossRef] [PubMed]
- Stutte, S.; Quast, T.; Gerbitzki, N.; Savinko, T.; Novak, N.; Reifenberger, J.; Homey, B.; Kolanus, W.; Alenius, H.; Förster, I. Requirement of CCL17 for CCR7- and CXCR4-dependent migration of cutaneous dendritic cells. Proc. Natl. Acad. Sci. USA 2010, 107, 8736–8741. [Google Scholar] [CrossRef] [PubMed]
- Hashimoto, S.; Nakamura, K.; Oyama, N.; Kaneko, F.; Tsunemi, Y.; Saeki, H.; Tamaki, K. Macrophage-derived chemokine (MDC)/CCL22 produced by monocyte derived dendritic cells reflects the disease activity in patients with atopic dermatitis. J. Dermatol. Sci. 2006, 44, 93–99. [Google Scholar] [CrossRef] [PubMed]
- Nakahara, T.; Morimoto, H.; Murakami, N.; Furue, M. Mechanistic insights into topical tacrolimus for the treatment of atopic dermatitis. Pediatr. Allergy Immunol. 2017. [Google Scholar] [CrossRef] [PubMed]
- Van den Bogaard, E.H.; Bergboer, J.G.; Vonk-Bergers, M.; van Vlijmen-Willems, I.M.; Hato, S.V.; van der Valk, P.G.; Schröder, J.M.; Joosten, I.; Zeeuwen, P.L.; Schalkwijk, J. Coal tar induces AHR-dependent skin barrier repair in atopic dermatitis. J. Clin. Investig. 2013, 123, 917–927. [Google Scholar] [CrossRef] [PubMed]
- Takei, K.; Mitoma, C.; Hashimoto-Hachiya, A.; Uchi, H.; Takahara, M.; Tsuji, G.; Kido-Nakahara, M.; Nakahara, T.; Furue, M. Antioxidant soybean tar Glyteer rescues T-helper-mediated downregulation of filaggrin expression via aryl hydrocarbon receptor. J. Dermatol. 2015, 42, 71–80. [Google Scholar] [CrossRef] [PubMed]
- Tsuji, G.; Hashimoto-Hachiya, A.; Kiyomatsu-Oda, M.; Takemura, M.; Ohno, F.; Ito, T.; Morino-Koga, S.; Mitoma, C.; Nakahara, T.; Uchi, H.; et al. Aryl hydrocarbon receptor activation restores filaggrin expression via OVOL1 in atopic dermatitis. Cell Death Dis. 2017, 8, e2931. [Google Scholar] [CrossRef] [PubMed]
- Garritsen, F.M.; Brouwer, M.W.; Limpens, J.; Spuls, P.I. Photo(chemo)therapy in the management of atopic dermatitis: An updated systematic review with implications for practice and research. Br. J. Dermatol. 2014, 170, 501–513. [Google Scholar] [CrossRef] [PubMed]
- Kiyomatsu-Oda, M.; Uchi, H.; Morino-Koga, S.; Furue, M. Protective role of 6-formylindolo[3,2-b]carbazole (FICZ), an endogenous ligand for aryl hydrocarbon receptor, in chronic mite-induced dermatitis. J. Dermatol. Sci. 2018. [Google Scholar] [CrossRef] [PubMed]
- Sekhon, S.; Jeon, C.; Nakamura, M.; Afifi, L.; Yan, D.; Wu, J.J.; Liao, W.; Bhutani, T. Review of the mechanism of action of coal tar in psoriasis. J. Dermatol. Treat. 2017, 19, 1–3. [Google Scholar] [CrossRef] [PubMed]
- Ito, K.; Namikawa, S.; Takeuchi, K. Effect of the dry distillation tar of delipidated soybean (Glyteer) on a psoriatic model in the mouse (4). Nihon Yakurigaku Zasshi 1992, 1, 55–62. [Google Scholar] [CrossRef]
- Tsuji, G.; Takahara, M.; Uchi, H.; Matsuda, T.; Chiba, T.; Takeuchi, S.; Yasukawa, F.; Moroi, Y.; Furue, M. Identification of ketoconazole as an AhR-Nrf2 activator in cultured human keratinocytes: The basis of its anti-inflammatory effect. J. Investig. Dermatol. 2012, 1, 59–68. [Google Scholar] [CrossRef] [PubMed]
- Wei, Y.D.; Rannug, U.; Rannug, A. UV-induced CYP1A1 gene expression in human cells is mediated by tryptophan. Chem. Biol. Interact. 1999, 118, 127–140. [Google Scholar] [CrossRef]
- Furue, M.; Uchi, H.; Mitoma, C.; Hashimoto-Hachiya, A.; Chiba, T.; Ito, T.; Nakahara, T.; Tsuji, G. Antioxidants for healthy skin: The emerging role of aryl hydrocarbon receptors and nuclear factor-erythroid 2-related factor-2. Nutrients 2017, 9, 223. [Google Scholar] [CrossRef] [PubMed]
- Esser, C.; Rannug, A. The aryl hydrocarbon receptor in barrier organ physiology, immunology, and toxicology. Pharmacol. Rev. 2015, 67, 259–279. [Google Scholar] [CrossRef] [PubMed]
- Haas, K.; Weighardt, H.; Deenen, R.; Köhrer, K.; Clausen, B.; Zahner, S.; Boukamp, P.; Bloch, W.; Krutmann, J.; Esser, C. Aryl hydrocarbon receptor in keratinocytes is essential for murine skin barrier integrity. J. Investig. Dermatol. 2016, 36, 2260–2269. [Google Scholar] [CrossRef] [PubMed]
- Furue, M.; Takahara, M.; Nakahara, T.; Uchi, H. Role of AhR/ARNT system in skin homeostasis. Arch. Dermatol. Res. 2014, 306, 769–779. [Google Scholar] [CrossRef] [PubMed]
- Kado, S.; Chang, W.L.W.; Chi, A.N.; Wolny, M.; Shepherd, D.M.; Vogel, C.F.A. Aryl hydrocarbon receptor signaling modifies Toll-like receptor-regulated responses in human dendritic cells. Arch. Toxicol. 2017, 91, 2209–2221. [Google Scholar] [CrossRef] [PubMed]
- Goudot, C.; Coillard, A.; Villani, A.C.; Gueguen, P.; Cros, A.; Sarkizova, S.; Tang-Huau, T.L.; Bohec, M.; Baulande, S.; Hacohen, N.; et al. Aryl hydrocarbon receptor controls monocyte differentiation into dendritic cells versus macrophages. Immunity 2017, 47, 582–596. [Google Scholar] [CrossRef] [PubMed]
- Fujita, H.; Asahina, A.; Sugaya, M.; Nakamura, K.; Gao, P.; Fujiwara, H.; Tamaki, K. Differential production of Th1- and Th2-type chemokines by mouse Langerhans cells and splenic dendritic cells. J. Investig. Dermatol. 2005, 124, 343–350. [Google Scholar] [CrossRef] [PubMed]
- Frericks, M.; Meissner, M.; Esser, C. Microarray analysis of the AHR system: Tissue-specific flexibility in signal and target genes. Toxicol. Appl. Pharmacol. 2007, 220, 320–332. [Google Scholar] [CrossRef] [PubMed]
- Chomarat, P.; Banchereau, J. An update on interleukin-4 and its receptor. Eur. Cytokine Netw. 1997, 8, 333–344. [Google Scholar] [PubMed]
- Buglio, D.; Georgakis, G.V.; Hanabuchi, S.; Arima, K.; Khaskhely, N.M.; Liu, Y.J.; Younes, A. Vorinostat inhibits STAT6-mediated TH2 cytokine and TARC production and induces cell death in Hodgkin lymphoma cell lines. Blood 2008, 112, 1424–1433. [Google Scholar] [CrossRef] [PubMed]
- Hosoya, K.; Satoh, T.; Yamamoto, Y.; Saeki, K.; Igawa, K.; Okano, M.; Moriya, T.; Imamura, O.; Nemoto, Y.; Yokozeki, H. Gene silencing of STAT6 with siRNA ameliorates contact hypersensitivity and allergic rhinitis. Allergy 2011, 66, 124–131. [Google Scholar] [CrossRef] [PubMed]
- Jeong, K.T.; Hwang, S.J.; Oh, G.S.; Park, J.H. FICZ, a tryptophan photoproduct, suppresses pulmonary eosinophilia and Th2-type cytokine production in a mouse model of ovalbumin-induced allergic asthma. Int. Immunopharmacol. 2012, 13, 377–385. [Google Scholar] [CrossRef] [PubMed]
- Murai, M.; Tsuji, G.; Hashimoto-Hachiya, A.; Kawakami, Y.; Furue, M.; Mitoma, C. An endogenous tryptophan photo-product, FICZ, is potentially involved in photo-aging by reducing TGF-β-regulated collagen homeostasis. J. Dermatol. Sci. 2018, 89, 19–26. [Google Scholar] [CrossRef] [PubMed]
- Morino-Koga, S.; Uchi, H.; Mitoma, C.; Wu, Z.; Kiyomatsu, M.; Fuyuno, Y.; Nagae, K.; Yasumatsu, M.; Suico, M.A.; Kai, H.; et al. 6-Formylindolo[3,2-b]carbazole accelerates skin wound healing via activation of ERK, but not aryl hydrocarbon receptor. J. Investig. Dermatol. 2017, 137, 2217–2226. [Google Scholar] [CrossRef] [PubMed]
- Lehmann, G.M.; Xi, X.; Kulkarni, A.A.; Olsen, K.C.; Pollock, S.J.; Baglole, C.J.; Gupta, S.; Casey, A.E.; Huxlin, K.R.; Sime, P.J.; et al. The aryl hydrocarbon receptor ligand ITE inhibits TGFβ1-induced human myofibroblast differentiation. Am. J. Pathol. 2011, 178, 1556–1567. [Google Scholar] [CrossRef] [PubMed]
- Gooderham, M.J.; Hong, H.C.; Eshtiaghi, P.; Papp, K.A. Dupilumab: A review of its use in the treatment of atopic dermatitis. J. Am. Acad. Dermatol. 2018, 78, S28–S36. [Google Scholar] [CrossRef] [PubMed]
- Nakahara, T.; Kido-Nakahara, M.; Ohno, F.; Ulzii, D.; Chiba, T.; Tsuji, G.; Furue, M. The pruritogenic mediator endothelin-1 shifts the dendritic cell-T-cell response toward Th17/Th1 polarization. Allergy 2018, 73, 511–515. [Google Scholar] [CrossRef] [PubMed]
Gene | Sequence (5’ to 3’) | |
---|---|---|
β-actin | forward | GGCTGTATTCCCCTCCATCG |
reverse | CCAGTTGGTAACAATGCCATGT | |
Ccl17 | forward | AGGTCACTTCAGATGCTGCTC |
reverse | ACTCTCGGCCTACATTGGTG | |
Ccl22 | forward | GACACCTGACGAGGACACA |
reverse | GCAGAGGGTGACGGATGTAG | |
Cyp1a1 | forward | TCCTCCGTTACCTGCCTAACTC |
reverse | GATGTGGCCCTTCTCAAATGTCC |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Takemura, M.; Nakahara, T.; Hashimoto-Hachiya, A.; Furue, M.; Tsuji, G. Glyteer, Soybean Tar, Impairs IL-4/Stat6 Signaling in Murine Bone Marrow-Derived Dendritic Cells: The Basis of Its Therapeutic Effect on Atopic Dermatitis. Int. J. Mol. Sci. 2018, 19, 1169. https://doi.org/10.3390/ijms19041169
Takemura M, Nakahara T, Hashimoto-Hachiya A, Furue M, Tsuji G. Glyteer, Soybean Tar, Impairs IL-4/Stat6 Signaling in Murine Bone Marrow-Derived Dendritic Cells: The Basis of Its Therapeutic Effect on Atopic Dermatitis. International Journal of Molecular Sciences. 2018; 19(4):1169. https://doi.org/10.3390/ijms19041169
Chicago/Turabian StyleTakemura, Masaki, Takeshi Nakahara, Akiko Hashimoto-Hachiya, Masutaka Furue, and Gaku Tsuji. 2018. "Glyteer, Soybean Tar, Impairs IL-4/Stat6 Signaling in Murine Bone Marrow-Derived Dendritic Cells: The Basis of Its Therapeutic Effect on Atopic Dermatitis" International Journal of Molecular Sciences 19, no. 4: 1169. https://doi.org/10.3390/ijms19041169
APA StyleTakemura, M., Nakahara, T., Hashimoto-Hachiya, A., Furue, M., & Tsuji, G. (2018). Glyteer, Soybean Tar, Impairs IL-4/Stat6 Signaling in Murine Bone Marrow-Derived Dendritic Cells: The Basis of Its Therapeutic Effect on Atopic Dermatitis. International Journal of Molecular Sciences, 19(4), 1169. https://doi.org/10.3390/ijms19041169