Next Article in Journal
Identification and Characterization of a Bursaphelenchus xylophilus (Aphelenchida: Aphelenchoididae) Thermotolerance-Related Gene: Bx-HSP90
Previous Article in Journal
Extraction of Dihydroquercetin from Larix gmelinii with Ultrasound-Assisted and Microwave-Assisted Alternant Digestion
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 13
Issue 7
10.3390/ijms13078805
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Isolation and Characterization of Cross-Amplification Microsatellite Panels for Species of Procapra (Bovidae; Antilopinae)

by
Jing Chen
1,2,
Chunlin Li
1,2,3,
Ji Yang
1,2,
Zhenhua Luo
1,2,
Songhua Tang
1,
Feng Li
1,2,
Chunwang Li
1,
Bingwan Liu
4 and
Zhigang Jiang
1,2,*
1
Key Laboratory of Animal Ecology and Conservation Biology, Institute of Zoology, Chinese Academy of Sciences, No. 1 Beichen West Road, Beijing 100101, China
2
Graduate School of the Chinese Academy of Sciences, No. 19 (A) Yuquan Road, Beijing 100049, China
3
School of Resources and Environmental Engineering, Anhui University, Hefei 230000, China
4
College of Wildlife Resources, Northeast Forestry University, Harbin 150040, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2012, 13(7), 8805-8818; https://doi.org/10.3390/ijms13078805
Submission received: 30 May 2012 / Revised: 4 July 2012 / Accepted: 9 July 2012 / Published: 16 July 2012
(This article belongs to the Section Molecular Pathology, Diagnostics, and Therapeutics)
Browse Figure
Versions Notes

Abstract

:
The three Procapra species, Tibetan gazelle (P. picticaudata), Mongolian gazelle (P. gutturosa) and Przewalski’s gazelle (P. przewalskii) are endemic to Asia. Several intraspecific genetic issues have been studied with species-specific microsatellite loci in these Asian gazelles. However, cross-species microsatellite panels are absent, which inhibits comparative conservation and evolutionary studies of the Procapra. In this study, we isolated 20 cross-species microsatellite loci for Procapra from both related species and the genomic library of P. przewalskii. Fifty-three samples of the three gazelles were used to characterize the markers. Allele numbers ranged from three to 20, with a mean of 7.93 per locus. Observed heterozygosity (HO) averaged 0.680 and expected heterozygosity (HE) 0.767. The mean polymorphic information content (PIC) was 0.757 for P. picticaudata, 0.803 for P. gutturosa and 0.590 for P. przewalskii. Nine loci were significantly deviated from Hardy-Weinberg (H-W) equilibrium in the three species. Significant linkage disequilibrium was detected in four pairs of loci in P. przewalskii, five pairs in P. gutturosa and 51 pairs in P. picticaudata. Considering the abundance of published loci and their high success rates of cross-amplification, testing and utilization of loci from related species is efficient for wild species of Bovidae. The cross-species microsatellite loci we developed will facilitate further interspecies genetic studies in Procapra.

1. Introduction

Microsatellites (SSRs) are simple tandem repeated DNA sequence elements of one to six bases distributed in all prokaryotic and eukaryotic genomes [1,2]. Microsatellites are powerful and versatile genetic markers for their high degree of variability induced by replication slippage [3–6]. They can be used for studies of estimating genetic diversity [7,8], detecting gene flow [9], measuring genetic differentiation [10], rebuilding genetic structure [11], tracking the biological history of populations [12], distinguishing individuals [13,14], and analyzing pedigree relationship [15]. However, one drawback restricts the utilization of microsatellites: Primer sets must be developed or tested freshly for those species, which are studied for the first time [16]. A possible reason for this is that primer annealing might fail for the high evolutionary rates of flanking regions [16–18].
Procapra are ancient Asian antelopes that are important in terms of their phylogenetic and conservation position. The group split from the tribe Antilopini at the first radiation event of gazelles during 11–12 Ma [19], but their populations are threatened by extinction making them a focus of global conservation [20,21]. The genus has three existent species: Tibetan gazelle (P. picticaudata) that spreads over the Qinghai-Tibet Plateau in China with a small population in Ladakh and Sikkim [22–24], the Mongolian gazelle (P. gutturosa) that has survived in Mongolia and inner-Mongolia of China [25,26], and the Przewalski’s gazelle (P. przewalskii) that could be found in the North and West of China 150 years ago, whose range, however, has recently shrunk to fragmented patches around Qinghai Lake [27–29]. Recently one population of P. przewalskii has been found living sympatrically with P. picticaudata in upper the Buha River valley [30,31]. According to locations of type specimen, P. przewalskii used to live sympatrically with P. gutturosa in inner Mongolia 60 years ago as well [32] (Figure 1). Populations of the three species are declining and are threatened by hunting, excessive livestock grazing, and habitat loss or fragmentation [26,33–36]. They are listed as Category I (P. przewalskii) or Category II (P. picticaudata, P. gutturosa) of the National Key Protected Wild Animals in China, and as “Near Threatened” (P. picticaudata), “Least Concern” (P. gutturosa) or “Endangered” (P. przewalskii) in the IUCN Red List [20,37]. Their threatened status is drawing attention of both scientific and conservation communities, and field conservation projects have been launched for the endangered Przewalski’s gazelle [27].
The green area represents the distribution range of P. picticaudata and the orange area represents the distribution of P. gutturosa. The red triangles represent the scattered distributed patches of P. przewalskii. The blue, red and yellow pentagrams indicate sampling locations of P. picticaudata, P. gutturosa and P. przewalskii, respectively. The shaded rectangle on the inset indicates the location of the main map in China.
Population genetics studies on these Asian gazelles have been performed and they provide recommendations for conservation and management of Procapra. Zhang et al. demonstrated that P. picticaudata had divided into three geographic populations according to the results of phylogenetic analysis of mtDNA [38]. Yang et al. employed 13 microsatellite loci and revealed that populations of P. przewalskii possessed a moderate nuclear genetic diversity [39], and that anthropogenic landscape was one of the main factors that shaped their genetic structure [34]. A study of P. gutturosa showed high mitochondrial genetic diversity with no obvious genetic structure [40]. All the previous genetic studies focused on single species and obtained intraspecific findings, however, important issues about the speciation in Procapra can only be addressed using interspecific comparisons. For example, how did the three species diverge or coexist in the contiguous or sympatric habitats? Is there any evidence of interspecific hybridization, and if not, what reproductive isolation mechanisms are there? The distribution range of P. przewalskii overlaps with that of P. picticaudata, but in fact it was split from P. gutturosa phylogenetically, how did this happen in evolution [41]? To find answers for these interspecific issues, it is essential to develop new microsatellite markers, which are suitable for cross amplification among the three species of Procapra.
Zhang developed nine microsatellite loci for P. picticaudata among which three were shared with P. przewalskii [42,43]. Yang isolated ten more microsatellite primers for P. przewalskii from related species [41]. However, we do not know whether these loci can be used across the three Procapra species. In this study, we tested their cross-amplification utility. In addition, we employed two methods, testing loci from related species and the construction of an enriched genomic library, to isolate more cross-species microsatellite primer sets for the three species of Procapra.

2. Results and Discussion

2.1. Isolation and Characterization of Cross-Amplification Microsatellite Loci

Five of 13 loci of P. przewalskii were amplified robustly and proved to be polymorphic in P. picticaudata and P. gutturosa. Eight of the 13 loci from four related species were amplified successfully in the three Procapra species and six of them were highly polymorphic. Regarding the method of construction of the genomic library, 300 clones were initially obtained, of which 110 positive clones were screened successfully by PCR, and finally 49 of them contained repeat motifs. Nineteen primer pairs were designed and nine of them yielded specific products among the three species. The nine loci were labeled and all of them were proved to be of high polymorphism. In total, 20 microsatellite loci suitable for the three species were isolated and characterized by the two methods (Table 1).
Allele numbers per polymorphic locus across the three species ranged from 3 to 20, with a mean of 7.93 (8.00 for P. picticaudata, 11.05 for P. gutturosa and 4.75 for P. przewalskii). The average observed heterozygosity (HO) was 0.680 (0.663 for P. picticaudata, 0.784 for P. gutturosa, and 0.593 for P. przewalskii). Expected heterozygosity (HE) averaged at 0.767 (0.804, 0.841 and 0.654 for P. picticaudata, P. gutturosa and P. przewalskii, respectively). The polymorphic information content (PIC) ranged from 0.271 to 0.907, and averaged 0.757 for P. picticaudata, 0.803 for P. gutturosa and 0.590 for P. przewalskii (Tables 2–4). After adjustment by the Bonferroni correction [48], nine loci were significantly deviated from Hardy-Weinberg (H-W) equilibrium, among which six were found in P. picticaudata, one in P. gutturosa, and four in P. przewalskii. Significant linkage disequilibrium was detected in four pairs of loci in P. przewalskii (AC29-AC230, AC1-AC77, AC77-CSSM43 and AC230-VH34), five pairs in P. gutturosa (HD28-MAF23, AC1-VH34, TANXAN-15-AF5, AC29-AC299 and BM4505-VH34) and 51 pairs of loci in P. picticaudata.

2.2. General Discussion of Results

2.2.1. Isolation Strategies for Polymorphic Microsatellite

In our study, 39 percent of 13 primer pairs used in P. przewalskii were applicable in the other two species, and 46 percent of 13 primer pairs from four other species were usable in all the species of Procapra. Sequence conservation of the flanking regions of microsatellite loci allowed primer pairs designed for one species to be shared with closely related taxa [49,50]. Among the Bovidae species, cross-species amplification of microsatellite primer pairs of Bos taurus showed 30 percent success rate in Capra hircus [51] and 40 percent in Ovis aries [49]. Considering the absence of sequence screening and primer designing, developing microsatellite loci from related species is economical both in time and funds. However, for some target species without enough usable reference primers or sequences, construction of a genomic library is the only way to develop microsatellite loci [52,53]. Notwithstanding, cloning efficiency is always low in traditional isolation processes. Among the primer notes published in Molecular Ecology from 1999 to March 2001, which used traditional genomic library protocols, percentages of positive clones were as low as 0.04 percent, and averaged at 1.67 percent in mammals [16]. Thus, many optimized protocols and alternative approaches were proposed to solve the problem [16,52]. In our study, selective hybridization and enrichment were applied to increase cloning efficiency and finally 16 percent positive clones were obtained.
Recently, several advanced approaches of isolating microsatellites were developed. Despite the advantages, there are also some limitations. For example, methods of screening expressed sequence tags (ESTs) database [54–56] rely on published data, which are always unavailable for less studied species. Outputs of microsatellite loci through the newly developed next-generation sequencing technologies are of larger quantity but are usually redundant for studies of wildlife molecular ecology [57,58].
In summary, as there are almost 500 microsatellite markers of Bovidae deposited in the database of Molecular Ecology Resource till May 2012 [59], cross-amplification of microsatellite primers from related species seems to be feasible and economical for wild species of Bovidae.

2.2.2. Genetic Diversity of the Three Procapra Species

In our study, both P. picticaudata, and P. gutturosa showed a high genetic diversity with high expected heterozygosity (HE = 0.804 and 0.840), which was consistent with the results of Zhang [42] (HE = 0.788 for P. picticaudata) and Sorokin et al. (5.85 ± 2.92 percent of average nucleotide diversity for P. gutturosa) [40], indicating high representative power of our primer sets. However, the number of alleles (N = 4.75), observed heterozygosity (HO = 0.593) and expected heterozygosity (HE = 0.654) of P. przewalskii were all significantly lower than for both P. picticaudata, and P. gutturosa, manifesting lower genetic diversity in the endangered gazelle. Yang et al. also got similar results (HO = 0.525 and HE = 0.552) in the study of genotyping and analyzing 169 individuals from nine subpopulations of P. przewalskii [39]. Possible reasons are that P. przewalskii has recently experienced a severe population decline and a genetic bottleneck [26,39,43]. Our result highlights the conservation emergency of the endangered P. przewalskii again.

3. Experimental Section

3.1. Sample Collection and Genomic DNA Extraction

Fifteen skin and muscle samples of P. przewalskii in one subpopulation (Hudong) were plucked from carcasses, which died from natural predation and disease. One blood sample of the Bird Island subpopulation was provided by the Qinghai Lake National Nature Reserve. Sixteen muscle samples of P. picticaudata were collected from local hunters in Dulan, Qinghai Province. Twelve muscle samples of P. gutturosa came from body remains killed by wolves in grasslands around Arihashate Manzhouli Customs, Inner Mongolia in 2004, and ten additional samples, which were confiscated as smuggled goods in 2010, were provided by A Day Hasha Te Manzhouli Customs (Figure 1).
Genomic DNA was extracted from the samples using the Universal Genomic DNA Extraction Kit Ver.3.0 (TaKaRa) on a Clean Bench. Extraction followed the manufacturer’s instructions except that digestion was prolonged by two hours to make sure that dried muscle or skin samples were fully digested. Genomic DNA yield was checked by gel electrophoresis with 1.5 percent of agarose.

3.2. Isolation of Microsatellite Markers

3.2.1. Cross-Amplification of Microsatellite Loci from Related Species

Thirteen primer pairs developed for P. przewalskii by Yang [43] including the three loci which were already known to be usable in P. picticaudata [42] were tested in both P. picticaudata and P. gutturosa. Thirteen microsatellite primer pairs from four related species (Gazella granti [45], Madoqua kirkii [60], Gazella dorcas [61] and Antilocapra americana [44]) with long repeat motifs and high polymorphism were chosen and tested in all the three Procapra species by cross-species amplification.
All the PCR reactions were performed in a 10 μL volume containing 1× PCR buffer, 2.0 mM MgCl2, 0.2 mM of each dNTPs, 0.5 μM of each primer, 0.25 units Hotstart Taq DNA polymerase (TaKaRa) and 10 ng genomic DNA. Amplification cycles were carried out on a Thermo Hybaid MBS 0.2 S PCR Thermal Cycler (Thermo Fisher Scientific). The optimized touchdown PCR thermal cycling profile was: 10 min at 95 °C for initial polymerase activation, followed by 14 or 16 cycles of 30 s at 95 °C, 45 s at 64 °C and 1 min at 72 °C, with the annealing temperature decreasing 1 °C per cycle, then 35 cycles of 30 s at 95 °C, 45 s at 50 °C or 48 °C and 1 min at 72 °C, and a final extension step at 72 °C for 30 min. PCR products were visualized on two percent of agarose gel. Loci which produced robust and specific bands in all the three species were sequenced to make sure that the products contained microsatellites. Finally, the suitable loci were labeled with a fluorescent dye (6′-FAM, TAMARA, or HEX) on the 5′ end of forward primer.

3.2.2. Construction of Enriched Genomic Library

To get further cross-species microsatellite loci for Procapra, an enriched genomic library of P. przewalskii was constructed according to Techen et al. [53], Zane et al. [16] and Liu et al. [62] with optimization of the processes. Briefly, genomic DNA extracted from the blood samples was digested by Sau3A I (TaKaRa), and the products were ligated to a phosphorylated adaptor (Oligo A 5′-GCGGTACCCGGGAAGCTTGG-3′, Oligo B 5′-pGATCCCAAGCTTCCCGGGTACCGC-3′) designed by Hamilton et al. [63]. Fragments ranging from 200 bp to 1000 bp were selected and hybridized with the biotin-labeled (AC)15 probe (Life Technologies). Fragments containing repeats were captured by streptavidin-coated magnetic beads (Promega). After elution and PCR enrichment, the target fragments were inserted into pMD18-T vectors (TaKaRa) and transformed to a E. coli JM109 strain (TransGen Biotech). Clones that contained AC repeat were screened by PCR reaction and sequenced with an ABI PRISM 3730XL DNA sequencer (Applied Biosystems). Primers were designed with Primer Premier 6.0 (Premier Biosoft International) for the appropriate sequences which contained large numbers of repeats and long enough flanking regions. The primers which produced single bands with the right size were labeled with fluorescent dye (6′-FAM, TAMARA, or HEX).

3.3. Polymorphisms Assessment

Polymorphism and the performance of all the chosen loci were assessed by 15 samples of P. przewalskii (excluding the blood sample from the Bird Island subpopulation), 16 of P. picticaudata and 22 of P. gutturosa. PCR reaction was performed in the previous touchdown profiles with different annealing temperatures for each primer pair. Products were resolved with an ABI PRISM 3730XL DNA sequencer (Applied Biosystems) and scored by GeneMarker V1.7 (SoftGenetics). Genepop ver.4 [64] was used to calculate the number of alleles, observed and expected heterozygosity (HO and HE). The frequency of null alleles and the polymorphic information content (PIC) were estimated by CERVUS 2.0 [65]. Tests for deviation from H-W equilibrium and linkage disequilibrium were performed in Genepop ver.4 and corrected for multiple comparisons using a sequential Bonferroni correction.

4. Conclusions

This study is the first attempt to isolate cross-species microsatellite loci for Procapra. The 20 microsatellite primer pairs isolated by two methods are usable in both intraspecific and interspecific research of Procapra species. These microsatellites can be utilized in studies of genetic structure, genetic diversity, hybridization, speciation, and evolution of Procapra, making a contribution to conservation and management of the three Asian gazelles. Our study also suggests that obtaining primers from related species may be a good strategy for the development of microsatellite loci for bovid species.

Acknowledgments

This work was funded by the Key Program of Knowledge Innovation Program of Chinese Academy of Sciences (KSCX2-EW-Z-4), Science and Technology Supporting Project, Ministry of Science and Technology of China (2008BAC39B04) and National Nature Science Foundation (31070469, 31070348). The authors would like to thank Lei Zhang, Boshi Wang and Hongxia Fang for laboratory assistance. We thank Fangfang Zhang, Shaopeng Cui, Aichun Xu and Zhangqiang You for collecting samples. We are also grateful to Yan Zeng, Xiaoge Ping, Philippe Chouteau, Feng Gao, Shaopeng Cui, Daiqiang Chen, Xiaowei Zhang and Junhua Hu for providing helpful advice regarding the early draft of this paper.
  • Conflict of InterestThe authors declare no conflict of interest in this study.

References

  1. Messier, W; Li, S.H; Stewart, C.B. The birth of microsatellites. Nature 1996, 381, 483. [Google Scholar]
  2. Chambers, G.K; MacAvoy, E.S. Microsatellites: Consensus and controversy. Comp. Biochem. Physiol. B 2000, 126, 455–476. [Google Scholar]
  3. Schlotterer, C. Evolutionary dynamics of microsatellite DNA. Chromosoma 2000, 109, 365–371. [Google Scholar]
  4. Buschiazzo, E; Gemmell, N.J. The rise, fall and renaissance of microsatellites in eukaryotic genomes. Bioessays 2006, 28, 1040–1050. [Google Scholar]
  5. Kruglyak, S; Durrett, R.T; Schug, M.D; Aquadro, C.F. Equilibrium distributions of microsatellite repeat length resulting from a balance between slippage events and point mutations. Proc. Natl. Acad. Sci. USA 1998, 95, 10774. [Google Scholar]
  6. Ellegren, H. Microsatellites: Simple sequences with complex evolution. Nat. Rev. Genet 2004, 5, 435–445. [Google Scholar]
  7. Jarne, P; Lagoda, P.J.L. Microsatellites, from molecules to populations and back. Trends Ecol. Evol. (Amst.) 1996, 11, 424–429. [Google Scholar]
  8. Paetkau, D; Strobeck, C. Microsatellite analysis of genetic variation in black bear populations. Mol. Ecol 1994, 3, 489–495. [Google Scholar]
  9. Rannala, B; Mountain, J.L. Detecting immigration by using multilocus genotypes. Proc. Natl. Acad. Sci. USA 1997, 94, 9197–9201. [Google Scholar]
  10. Balloux, F; Lugon-Moulin, N. The estimation of population differentiation with microsatellite markers. Mol. Ecol 2002, 11, 155–165. [Google Scholar]
  11. Paetkau, D; Calvert, W; Stirling, I; Strobeck, C. Microsatellite analysis of population structure in Canadian polar bears. Mol. Ecol 1995, 4, 347–354. [Google Scholar]
  12. Goldstein, D.B; Linares, A.R; Cavallisforza, L.L; Feldman, M.W. Genetic absolute dating based on microsatellites and the origin of modern humans. Proc. Natl. Acad. Sci. USA 1995, 92, 6723–6727. [Google Scholar]
  13. Palsboll, P.J; Allen, J; Berube, M; Clapham, P.J; Feddersen, T.P; Hammond, P.S; Hudson, R.R; Jorgensen, H; Katona, S; Larsen, A.H; et al. Nature 1997, 388, 767–769.
  14. Woods, J.G; Paetkau, D; Lewis, D; McLellan, B.N; Proctor, M; Strobeck, C. Genetic tagging of free-ranging black and brown bears. Wildl. Soc. Bull 1999, 27, 616–627. [Google Scholar]
  15. Queller, D.C; Strassmann, J.E; Hughes, C.R. Microsatellites and kinship. Trends Ecol. Evol. (Amst.) 1993, 8, 285–288. [Google Scholar]
  16. Zane, L; Bargelloni, L; Patarnello, T. Strategies for microsatellite isolation: A review. Mol. Ecol 2002, 11, 1–16. [Google Scholar]
  17. Hedgecock, D; Li, G; Hubert, S; Bucklin, K; Ribes, V. Widespread null alleles and poor cross-species amplification of microsatellite DNA loci cloned from the Pacific oyster, Crassostrea gigas. J. Shellfish Res 2004, 23, 379–386. [Google Scholar]
  18. Chapuis, M.P; Estoup, A. Microsatellite null alleles and estimation of population differentiation. Mol. Biol. Evol 2007, 24, 621–631. [Google Scholar]
  19. Hassanin, A; Delsuc, F; Ropiquet, A; Hammer, C; Jansen van Vuuren, B; Matthee, C; Ruiz-Garcia, M; Catzeflis, F; Areskoug, V; Nguyen, T.T; et al. Pattern and timing of diversification of Cetartiodactyla (Mammalia, Laurasiatheria), as revealed by a comprehensive analysis of mitochondrial genomes. C. R. Biol 2012, 335, 32–50. [Google Scholar]
  20. Jiang, Z.G; Gao, Z; Sun, Y. Current status of antelopes in China. J. For. Rev 1996, 7, 58–62. [Google Scholar]
  21. Mallon, D.P; Jiang, Z.G. Grazers on the plains: Challenges and prospects for large herbivores in Central Asia. J. Appl. Ecol. 2009, 46, 516–519. [Google Scholar]
  22. Jiang, Z.G; Wang, S. IUCN Antelope Survey and Action Plan Part 4: North America, the Middle East and Asia, Chapter 33 China. In Global Survey and Regional Action Plans on Antelope; Mallon, D.P., Kingswood, S.C., Eds.; IUCN: Gland, Switzerland, and Cambridge, UK, 2001; pp. 168–177. [Google Scholar]
  23. Bhatnagar, Y.V; Wangchuk, R; Mishra, C. Decline of the Tibetan gazelle Procapra picticaudata in Ladakh, India. Oryx 2006, 40, 229–232. [Google Scholar]
  24. Namgail, T; Bagchi, S; Mishra, C; Bhatnagar, Y.V. Distributional correlates of the Tibetan gazelle Procapra picticaudata in Ladakh, northern India: Towards a recovery programme. Oryx 2008, 42, 107–112. [Google Scholar]
  25. Jin, K; Gao, Z. X; Guan, D.M; Bao, X.K; Bai, L.J; Wang, K.W. Variations of Distribution and Population Quantity of Mongolian Gazelle in the World. Chin. J. Ecol 1997, 38–42. [Google Scholar]
  26. Sokolov, V.E; Lushchekina, A.A. Procapra gutturosa. Mamm. Spec 1997, 1–5. [Google Scholar]
  27. Li, C.L; Jiang, Z.G; Ping, X.G; Cai, J; You, Z.Q; Li, C.W; Wu, Y.H. Current status and conservation of the Endangered Przewalski’s gazelle Procapra przewalskiiendemic to the Qinghai-Tibetan Plateau, China. Oryx 2012, 46, 145–153. [Google Scholar]
  28. Jiang, Z.G; Li, D.Q; Wang, Z.W. Population declines of Przewalski’s gazelle around Qinghai Lake, China. Oryx 2000, 34, 129–135. [Google Scholar]
  29. Jiang, Z.G. Przewalski’s Gazelle; China Forestry Publishing House: Beijing, China, 2004. [Google Scholar]
  30. Li, Z.Q; Jiang, Z.G; Beauchamp, G. Nonrandom mixing between groups of Przewalski’s gazelle and Tibetan gazelle. J. Mammal. 2010, 91, 674–680. [Google Scholar]
  31. Hu, J.H; Jiang, Z.G. Detecting the potential sympatric range and niche divergence between Asian endemic ungulates of Procapra. Naturwissenschaften 2012, 99, 553–565. [Google Scholar]
  32. Jiang, Z.G; Feng, Z.J; Wang, Z.W; Chen, L.W; Cai, P; Li, Y.B. Historical and current distributions of Przewalski’s gazelle. Acta Theriol. Sin 1995, 15, 241–245. [Google Scholar]
  33. Li, Z.Q; Jiang, Z.G; Li, C.W. Dietary overlap of Przewalski's gazelle, Tibetan gazelle, and Tibetan sheep on the Qinghai-Tibet Plateau. J. Wildl. Manage 2008, 72, 944–948. [Google Scholar]
  34. Yang, J; Jiang, Z.G; Zeng, Y; Turghan, M; Fang, H; Li, C.W. Effect of anthropogenic landscape features on population genetic differentiation of Przewalski’s gazelle: Main role of human settlement. PLoS One 2011, 6, e20144. [Google Scholar]
  35. Lhagvasuren, B; Milner-Gulland, E. The status and management of the Mongolian gazelle Procapra gutturosa population. Oryx 1997, 31, 127–134. [Google Scholar]
  36. Bhatnagar, Y.V; Seth, C; Takpa, J; Ul-Haq, S; Namgail, T; Bagchi, S; Mishra, C. A strategy for conservation of the Tibetan gazelle Procapra picticaudata in Ladakh. Conserv. Soc 2007, 5, 262. [Google Scholar]
  37. IUCN Red List of Threatened Species. Version 2011.2. Available online: http://www.iucnredlist.org accessed on 1 May 2012.
  38. Zhang, F.F; Jiang, Z.G. Mitochondrial phylogeography and genetic diversity of Tibetan gazelle (Procapra picticaudata): Implications for conservation. Mol. Phylogenet. Evol 2006, 41, 313–321. [Google Scholar]
  39. Yang, J; Jiang, Z.G. Genetic diversity, population genetic structure and demographic history of Przewalski's gazelle (Procapra przewalskii): Implications for conservation. Conserv. Genet 2011, 12, 1457–1468. [Google Scholar]
  40. Sorokin, P; Kiriliuk, V; Lushchekina, A; Kholodova, M. Genetic diversity of the Mongolian gazelle Procapra guttorosa Pallas, 1777. Russ. J. Genet 2005, 41, 1101–1105. [Google Scholar]
  41. Lei, R.H; Jiang, Z.G; Hu, Z; Yang, W.L. Phylogenetic relationships of Chinese antelopes (subfamily Antilopinae) based on mitochondrial ribosomal RNA gene sequences. J. Zool 2003, 261, 227–237. [Google Scholar]
  42. Zhang, F.F. Comparative study on phylogeography and demogaphy of Tibetan antelope (Patholops hodgsonii) and Tibetan gazelle (Procapra picticaudata). M.S. Thesis, Institute of Zoology, Chinese Academy of Sciences, Beijing, China, July 2007. [Google Scholar]
  43. Yang, J. Phylogeography and Landscape Genetics of Przewalski’s Gazelle Procapra Przewalskii. M.S. Thesis, Institute of Zoology, Chinese Academy of Sciences, Beijing, China, July 2011. [Google Scholar]
  44. Dunn, S.J; Barnowe-Meyer, K.K; Gebhardt, K.J; Balkenhol, N; Waits, L.P; Byers, J.A. Ten polymorphic microsatellite markers for pronghorn (Antilocapra americana). Conserv. Genet. Resour 2010, 2, 81–84. [Google Scholar]
  45. Huebinger, R.M; de Maar, T.W.J; Woodruff, L.H; Pomp, D; Louis, E.E., Jr. Characterization of eight microsatellite loci in Grant’s gazelle (Gazella granti). Mol. Ecol. Notes 2006, 6, 1150–1151. [Google Scholar]
  46. Crawford, A; Dodds, K; Ede, A; Pierson, C; Montgomery, G; Garmonsway, H; Beattie, A; Davies, K; Maddox, J; Kappes, S. An autosomal genetic linkage map of the sheep genome. Genetics 1995, 140, 703–724. [Google Scholar]
  47. Bishop, M.D; Kappes, S.M; Keele, J.W; Stone, R.T; Sunden, S.L.F; Hawkins, G.A; Toldo, S.S; Fries, R; Grosz, M.D; Yoo, J. A genetic linkage map for cattle. Genetics 1994, 136, 619–639. [Google Scholar]
  48. Rice, W.R. Analyzing tables of statistical tests. Evolution 1989, 43, 223–225. [Google Scholar]
  49. Moore, S.S; Sargeant, L.L; King, T.J; Mattick, J.S; Georges, M; Hetzel, D.J.S. The conservation of dinucleotide microsatellites among mammalian genomes allows the use of heterologous PCR primer pairs in closely related species. Genomics 1991, 10, 654–660. [Google Scholar]
  50. Hendrix, R; Hauswaldt, J.S; Veith, M; Steinfartz, S. Strong correlation between cross-amplification success and genetic distance across all members of ‘True Salamanders’ (Amphibia: Salamandridae) revealed by Salamandra salamandra-specific microsatellite loci. Mol. Ecol. Resour 2010, 10, 1038–1047. [Google Scholar]
  51. Pepin, L; Amigues, Y; Lepingle, A; Berthier, J.L; Bensaid, A; Vaiman, D. Sequence conservation of microsatellites between Bos taurus (cattle), Capra hircus (goat) and related species. Heredity 1995, 74, 53–61. [Google Scholar]
  52. Pillay, K; Dawson, D.A; Horsburgh, G.J; Perrin, M.R; Burke, T; Taylor, T.D. Twenty-two polymorphic microsatellite loci aimed at detecting illegal trade in the Cape parrot, Poicephalus robustus (Psittacidae, AVES). Mol. Ecol. Resour 2010, 10, 142–149. [Google Scholar]
  53. Techen, N; Arias, R.S; Glynn, N.C; Pan, Z.Q; Khan, I.A; Scheffler, B.E. Optimized construction of microsatellite-enriched libraries. Mol. Ecol. Resour 2010, 10, 508–515. [Google Scholar]
  54. Yang, X.M; Sun, J.T; Xue, X.F; Zhu, W.C; Hong, X.Y. Development and Characterization of 18 Novel EST-SSRs from the Western Flower Thrips, Frankliniella occidentalis (Pergande). Int. J. Mol. Sci 2012, 13, 2863–2876. [Google Scholar]
  55. Xu, T.J; Sun, D.Q; Sun, Y.N; Wang, R.X. Development of 30 Novel Polymorphic Expressed Sequence Tags (EST)-Derived Microsatellite Markers for the Miiuy CroakerMiichthys miiuy. Int. J. Mol. Sci. 2011, 12, 4021–4026. [Google Scholar]
  56. Dawson, D.A; Horsburgh, G.J; Kupper, C; Stewart, I.R.K; Ball, A.D; Durrant, K.L; Hansson, B; Bacon, I; Bird, S; Klein, A; et al. New methods to identify conserved microsatellite loci and develop primer sets of high cross-species utility—As demonstrated for birds. Mol. Ecol. Resour 2010, 10, 475–494. [Google Scholar]
  57. Guichoux, E; Lagache, L; Wagner, S; Chaumeil, P; Leger, P; Lepais, O; Lepoittevin, C; Malausa, T; Revardel, E; Salin, F; et al. Current trends in microsatellite genotyping. Mol. Ecol. Resour 2011, 11, 591–611. [Google Scholar]
  58. Castoe, T.A; Poole, A.W; Gu, W.J; de Koning, A.P.J; Daza, J.M; Smith, E.N; Pollock, D.D. Rapid identification of thousands of copperhead snake (Agkistrodon contortrix) microsatellite loci from modest amounts of 454 shotgun genome sequence. Mol. Ecol. Resour 2010, 10, 341–347. [Google Scholar]
  59. Database for Molecular Ecology Resources. Available online: http://tomato.bio.trinity.edu accessed on 1 May 2004.
  60. Brotherton, P.N.M; Pemberton, J.M; Komers, P.E; Malarky, G. Genetic and behavioural evidence of monogamy in a mammal, Kirk’s dik–dik (Madoqua kirkii). Proc. R. Soc. Lond. B Biol. Sci 1997, 264, 675–681. [Google Scholar]
  61. Beja-Pereira, A; Zeyl, E; Ouragh, L; Nagash, H; Ferrand, N; Taberlet, P; Luikart, G. Twenty polymorphic microsatellites in two of North Africa’s most threatened ungulates: Gazella dorcas and Ammotragus lervia (Bovidae; Artiodactyla). Mol. Ecol. Notes 2004, 4, 452–455. [Google Scholar]
  62. Liu, Z.J; Zhang, B.W; Wei, F.W; Li, M. Isolation and characterization of microsatellite loci for the red panda, Ailurus fulgens. Mol. Ecol. Notes 2005, 5, 27–29. [Google Scholar]
  63. Hamilton, M.B; Pincus, E.L; di Fiore, A; Fleischer, R.C. Universal linker and ligation procedures for construction of genomic DNA libraries enriched for microsatellites. Biotechniques 1999, 27, 500–504. [Google Scholar]
  64. Raymond, M; Rousset, F. Population genetics software for exact tests and ecumenicism. J. Hered 1995, 86, 248–249. [Google Scholar]
  65. Marshall, T.C; Slate, J; Kruuk, L.E.B; Pemberton, J.M. Statistical confidence for likelihood-based paternity inference in natural populations. Mol. Ecol 1998, 7, 639–655. [Google Scholar]
Ijms 13 08805f1 1024
Figure 1. Map of the distribution ranges and sampling locations of Procapra (P. picticaudata, P. gutturosa and P. przewalskii).
Figure 1. Map of the distribution ranges and sampling locations of Procapra (P. picticaudata, P. gutturosa and P. przewalskii).
Ijms 13 08805f1
Table
Table 1. Twenty microsatellite loci isolated for three species of Procapra.
Table 1. Twenty microsatellite loci isolated for three species of Procapra.
LocusRepeat motifPrimer sequences (5′–3′)Size range (bp)Tm (°C)Source
AC1 #(AC)14F: TTGGCAGGTGGATTATTTAC
R: TGGTTGTCAATGGAAGGAA		171–19950This study
AC29 #(AC)14F: AGGACGGCACTTAAACTTATG
R: TATCATTGTCAGGCTTCTCT		169–19850This study
AC35 #(AC)12GAAGTATA
T(AC)4		F: TGGACAGAAGAGCGTAATG
R: TCCTTGTGGCTGAGTAGTA		210–22250This study
AC77 #(GT)13F: CACAGTCTCTTCTCATAATGC
R: CGGATTCTTTACCTCATACAC		147–16150This study
AC91 #(AC)14F: TTGGTCGTACTGACTGGTA
R: GGAGTGACTGAGGACAGA		176–20050This study
AC170 #(AC)19F: TCTCAAGAGGCAGGTCAG
R: GATTCCTTTGGCTCCTAGAAG		230–26050This study
AC230 #(AC)16ATATGC
(AC)6		F: TGGCTGAGCAACTAAGAG
R: GGGAAATACTTGGGTAACAG		152–16850This study
AC244 #(AC)6 (GT)14
(T)5G(T)9C(T)9		F: GGGATAGCAGAGAGTCAGA
R: GGAAGGAACAATTAGGAGTATG		332–35050This study
AC299 #(AC)5T(AC)8F: CGGTGTTCATATAACAGATTCC
R: GGTTGCTCAGTGGTCTCA		159–18950This study
Aam9 †(GT)15F: ATGTGGGAGACTTGATGATG
R: AAGACTGGAGACTGGGATTATC		205–22752[44]
HDZ8 †(AC)14F: GACAAACACTCAGAAGGCAAAG
R: GGTGGCAGGACTGAGCAAG		132–16650[45]
HDZ496 †(AC)15F: GTTTTTCCAGATGGTATTTTCCTC
R: GTATTCGGCTGAAGGGACC		228–25048[45]
MAF23 †(GT)20F: GTGGAGGAATCTTGACTTGTGATAG
R: GGCTATAGTCCATGGAGTCGCAG		124–16050[46]
VH34 †(AC)17F: TCGTAAGAGTGGACACAACTGAGCG
R: CGCAGTATTTAGTCCTTTTAATAATGGC		81–10150[46]
BM4505 †(ACAT)4(AC)11F: TTATCTTGGCTTCTGGGTGC
R: ATCTTCACTTGGGATGCAGG		240–25848[47]
AF5 ‡(CA)18F: GTGGGAAGAGATAGAGGAAGC
R: GAGCCACAAGGCACAGCCAAC		135–15751[43]
BM1225 ‡(CT)13TA(CA)18F: TTTCTCAACAGAGGTGTCCAC
R: ACCCCTATCACCATGCTCTG		231–27550[43]
CSSM43 ‡(CA)15AT(CT)5F: AAAACTCTGGGAACTTGAAAACTA
R: GTTACAAATTTAAGAGACAGAGTT		246–26848[43]
RT1 ‡(GT)22F: TGCCTTCTTTCATCCAACAA
R: CATCTTCCCATCCTCTTTAC		195–23350[43]
TEXAN-15 ‡(CT)9TT(CT)5GCAG
ATA(CA)20		F: TCGCAAACAGTCAGAGACCACTC
R: TGGATGAGAAAGAAGAGCAGAGTTG		203–22750[43]
Tm, annealing temperature.
#Loci isolated by construction of genomic library.
†Loci from related species.
‡Loci from P. przewalskii.
Table
Table 2. Characterization of the twenty cross-species microsatellite loci in P. picticaudata.
Table 2. Characterization of the twenty cross-species microsatellite loci in P. picticaudata.
LocusNo. of samplesNo. of allelesHOHEPICPHWNull allele frequency
AC11660.5000.7720.7090.0100.209
AC291660.3750.6670.6950.0040.276
AC351650.4380.6270.5570.0030.212
AC771660.0000.8070.7480.000 *1.000
AC911680.6250.8510.8010.0040.145
AC17016131.0000.9230.8850.000 *−0.057
AC2301670.6880.8150.7570.0130.064
AC2441660.6250.5930.5460.836−0.091
AC2991690.8130.8590.8140.0380.014
Aam91670.8130.8290.7760.252−0.008
HDZ816130.9380.9250.8880.003−0.026
HDZ49616110.8750.9050.8650.0770.005
MAF2316120.8750.8970.8570.052−0.003
VH341680.6250.8570.8100.002* 0.145
BM45051640.5630.5990.5310.3790.020
AF51680.7500.8690.8230.0960.064
BM122516110.6880.9190.8810.000 *0.123
CSSM431630.9380.6430.5520.029−0.223
RT11680.5000.8590.8100.001 *0.242
TEXAN-151690.6250.8710.8250.000 *0.157
HO, observed heterozygosity; HE, expected heterozygosity; PIC, estimated polymorphic information content; PHW, probability of deviation for Hardy-Weinberg (H-W) proportions (p-value); Null allele frequency, estimated null allele frequency;
*loci which deviate from H-W equilibrium (after sequential Bonferroni correction, p = 0.0025).
Table
Table 3. Characterization of the twenty cross-species microsatellite loci in P. gutturosa.
Table 3. Characterization of the twenty cross-species microsatellite loci in P. gutturosa.
LocusNo. of samplesNo. of allelesHOHEPICPHWNull allele frequency
AC122120.8640.9040.8720.0100.009
AC2922140.9090.9270.8980.573−0.003
AC352250.6820.7230.6530.6460.022
AC772250.5000.6610.6100.1500.133
AC9122100.8180.8810.8450.0260.025
AC17022120.8640.9210.8910.001 *0.020
AC23022100.7730.8700.8330.2010.052
AC24422150.8180.9140.8840.1190.044
AC29922110.8180.8250.7910.2730.001
Aam922120.6820.8830.8500.0370.120
HDZ822120.8180.7930.7590.610−0.058
HDZ4962290.6360.8190.7750.0570.112
MAF2322140.9550.9280.9000.018−0.028
VH3422100.7270.7640.7260.5210.020
BM45052240.5000.6020.5420.0750.063
AF522140.9550.8860.8560.814−0.053
BM122522200.8180.9350.9070.0080.056
CSSM432280.8640.8040.7540.981−0.048
RT122130.9090.8920.8600.465−0.024
TEXAN-1522110.7730.8840.8500.0910.063
HO, observed heterozygosity; HE, expected heterozygosity; PIC, estimated polymorphic information content; PHW, probability of deviation for H-W proportions (p-value); Null allele frequency, estimated null allele frequency;
*loci which deviate from H-W equilibrium (after sequential Bonferroni correction, p = 0.0025).
Table
Table 4. Characterization of the twenty cross-species microsatellite loci for P. gutturosa.
Table 4. Characterization of the twenty cross-species microsatellite loci for P. gutturosa.
LocusNo. of samplesNo. of allelesHOHEPICPHWNull allele frequency
AC11550.6000.5430.4960.895−0.079
AC291550.9330.7860.7210.470−0.112
AC351530.8000.5700.4560.093−0.200
AC771550.3330.8160.7550.000 *0.400
AC911540.6670.5590.4911.000−0.116
AC1701550.7330.7930.7280.1010.025
AC2301550.7330.7630.6900.278−0.002
AC2441540.3330.7150.6350.000 *0.368
AC2991550.4670.7490.6860.0050.231
Aam91550.3330.5780.5450.0090.282
HDZ81550.3330.4120.3810.1920.059
HDZ4961540.6000.5240.4320.000 *−0.103
MAF231560.5330.6830.6260.0230.138
VH341560.8000.7490.6860.921−0.041
BM45051540.8000.7330.6560.215−0.071
AF51530.2670.3010.2710.0090.105
BM12251570.6670.8090.7500.000 *0.079
CSSM431550.4670.7590.6860.0130.231
RT11550.6000.5750.5200.104−0.026
TEAXAN-151540.8670.6710.5860.252−0.150
HO, observed heterozygosity; HE, expected heterozygosity; PIC, estimated polymorphic information content; PHW, probability of deviation for H-W proportions (p-value); Null allele frequency, estimated null allele frequency;
*, loci which deviate from H-W equilibrium (after sequential Bonferroni correction, p = 0.0025).

Share and Cite

MDPI and ACS Style

Chen, J.; Li, C.; Yang, J.; Luo, Z.; Tang, S.; Li, F.; Li, C.; Liu, B.; Jiang, Z. Isolation and Characterization of Cross-Amplification Microsatellite Panels for Species of Procapra (Bovidae; Antilopinae). Int. J. Mol. Sci. 2012, 13, 8805-8818. https://doi.org/10.3390/ijms13078805

AMA Style

Chen J, Li C, Yang J, Luo Z, Tang S, Li F, Li C, Liu B, Jiang Z. Isolation and Characterization of Cross-Amplification Microsatellite Panels for Species of Procapra (Bovidae; Antilopinae). International Journal of Molecular Sciences. 2012; 13(7):8805-8818. https://doi.org/10.3390/ijms13078805

Chicago/Turabian Style

Chen, Jing, Chunlin Li, Ji Yang, Zhenhua Luo, Songhua Tang, Feng Li, Chunwang Li, Bingwan Liu, and Zhigang Jiang. 2012. "Isolation and Characterization of Cross-Amplification Microsatellite Panels for Species of Procapra (Bovidae; Antilopinae)" International Journal of Molecular Sciences 13, no. 7: 8805-8818. https://doi.org/10.3390/ijms13078805

Article Metrics

Back to TopTop