Natural Antioxidant Resveratrol Suppresses Uterine Fibroid Cell Growth and Extracellular Matrix Formation In Vitro and In Vivo
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents and Antibodies
2.2. Preparation of RSV
2.3. Cell Culture
2.4. Tumor Xenograft in Nude (Foxn1nu) Mice
2.5. Immunohistochemistry Analysis
2.6. Western Blot Analysis
2.7. Cell Viability Assay
2.8. Quantitative Real-Time RT–PCR (qRT–PCR)
2.9. Hoechst 33342 Staining
2.10. Apoptosis Analysis
2.11. Cell Cycle Analysis
2.12. Statistical Analysis
3. Results
3.1. The Inhibitory Effect of RSV on the Growth of UF in Vivo
3.2. Effects of RSV on Leiomyoma Cell Proliferation and Extracellular Matrix (ECM) Accumulation in Vitro
3.3. Effects of RSV on Apoptosis and Cell Cycle Progression of Leiomyoma Cells in Vitro
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
Abbreviations
| RSV | Resveratrol |
| ELT-3 | Eker uterine leiomyoma cells |
| UF | Uterine fibroids |
| ECM | Extracellular matrix |
| PCNA | Proliferating cell nuclear antigen |
| α-SMA | Alpha-smooth muscle actin |
| SDS-PAGE | Sodium dodecyl sulfate polyacrylamide gel electrophoresis |
| IVIS | In vivo imaging system (IVIS) |
References
- Cramer, S.F.; Patel, A. The frequency of uterine leiomyomas. Am. J. Clin. Pathol. 1990, 94, 435–438. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Day Baird, D.; Dunson, D.B.; Hill, M.C.; Cousins, D.; Schectman, J.M. High cumulative incidence of uterine leiomyoma in black and white women: Ultrasound evidence. Am. J. Obstet. Gynecol. 2003, 188, 100–107. [Google Scholar] [CrossRef] [Scilit]
- Okolo, S. Incidence, aetiology and epidemiology of uterine fibroids. Best Pract. Res. Clin. Obstet. Gynaecol. 2008, 22, 571–588. [Google Scholar] [CrossRef] [Scilit]
- Islam, M.S.; Protic, O.; Giannubilo, S.R.; Toti, P.; Tranquilli, A.L.; Petraglia, F.; Castellucci, M.; Ciarmela, P. Uterine leiomyoma: Available medical treatments and new possible therapeutic options. J. Clin. Endocrinol. Metab. 2013, 98, 921–934. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Islam, M.S.; Ciavattini, A.; Petraglia, F.; Castellucci, M.; Ciarmela, P. Extracellular matrix in uterine leiomyoma pathogenesis: A potential target for future therapeutics. Hum. Reprod. Update 2018, 24, 59–85. [Google Scholar] [CrossRef] [Scilit]
- Arici, A.; Sozen, I. Transforming growth factor-beta3 is expressed at high levels in leiomyoma where it stimulates fibronectin expression and cell proliferation. Fertil. Steril. 2000, 73, 1006–1011. [Google Scholar] [CrossRef] [Scilit]
- Leppert, P.C.; Baginski, T.; Prupas, C.; Catherino, W.H.; Pletcher, S.; Segars, J.H. Comparative ultrastructure of collagen fibrils in uterine leiomyomas and normal myometrium. Fertil. Steril. 2004, 82, 1182–1187. [Google Scholar] [CrossRef] [Scilit]
- Commandeur, A.E.; Styer, A.K.; Teixeira, J.M. Epidemiological and genetic clues for molecular mechanisms involved in uterine leiomyoma development and growth. Hum. Reprod. Update 2015, 21, 593–615. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tinelli, A.; Mynbaev, O.A.; Sparić, R.; Kadija, S.; Stefanović, A.; Tinelli, R.; Malvasi, A. Physiology and Importance of the Myoma’s Pseudocapsule. In Hysteroscopy; Tinelli, A., Alonso Pacheco, L., Haimovich, S., Eds.; Springer International Publishing: Cham, Switaerland, 2018; pp. 337–356. [Google Scholar]
- Zhang, D.; Al-Hendy, M.; Richard-Davis, G.; Montgomery-Rice, V.; Sharan, C.; Rajaratnam, V.; Khurana, A.; Al-Hendy, A. Green tea extract inhibits proliferation of uterine leiomyoma cells in vitro and in nude mice. Am. J. Obstet. Gynecol. 2010, 202, e281–e289. [Google Scholar] [CrossRef] [Scilit]
- Roshdy, E.; Rajaratnam, V.; Maitra, S.; Sabry, M.; Allah, A.S.; Al-Hendy, A. Treatment of symptomatic uterine fibroids with green tea extract: A pilot randomized controlled clinical study. Int. J. Womens Health 2013, 5, 477–486. [Google Scholar] [CrossRef] [Scilit]
- Islam, M.S.; Giampieri, F.; Janjusevic, M.; Gasparrini, M.; Forbes-Hernandez, T.Y.; Mazzoni, L.; Greco, S.; Giannubilo, S.R.; Ciavattini, A.; Mezzetti, B.; et al. An anthocyanin rich strawberry extract induces apoptosis and ROS while decreases glycolysis and fibrosis in human uterine leiomyoma cells. Oncotarget 2017, 8, 23575–23587. [Google Scholar] [CrossRef] [Scilit]
- Dei Cas, M.; Ghidoni, R. Cancer Prevention and Therapy with Polyphenols: Sphingolipid-Mediated Mechanisms. Nutrients 2018, 10, 940. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lyons, M.M.; Yu, C.; Toma, R.B.; Cho, S.Y.; Reiboldt, W.; Lee, J.; van Breemen, R.B. Resveratrol in Raw and Baked Blueberries and Bilberries. J. Agric. Food Chem. 2003, 51, 5867–5870. [Google Scholar] [CrossRef] [Scilit]
- Sales, J.M.; Resurreccion, A.V.A. Resveratrol in Peanuts. Crit. Rev. Food Sci. Nutr. 2014, 54, 734–770. [Google Scholar] [CrossRef] [Scilit]
- Jeandet, P.; Bessis, R.; Gautheron, B. The Production of Resveratrol (3,5,4’-trihydroxystilbene) by Grape Berries in Different Developmental Stages. Am. J. Enol. Vitic. 1991, 42, 41–46. [Google Scholar]
- Jeandet, P.; Bessis, R.; Maume, B.F.; Meunier, P.; Peyron, D.; Trollat, P. Effect of Enological Practices on the Resveratrol Isomer Content of Wine. J. Agric. Food Chem. 1995, 43, 316–319. [Google Scholar] [CrossRef] [Scilit]
- Jeandet, P.; Bessis, R.; Sbaghi, M.; Meunier, P. Production of the Phytoalexin Resveratrol by Grapes as a Response to Botrytis Attack Under Natural Conditions. J. Phytopathol. 1995, 143, 135–139. [Google Scholar] [CrossRef] [Scilit]
- Aggarwal, B.B.; Bhardwaj, A.; Aggarwal, R.S.; Seeram, N.P.; Shishodia, S.; Takada, Y. Role of resveratrol in prevention and therapy of cancer: Preclinical and clinical studies. Anticancer Res. 2004, 24, 2783–2840. [Google Scholar] [PubMed]
- Shahidi, F.; Ambigaipalan, P. Phenolics and polyphenolics in foods, beverages and spices: Antioxidant activity and health effects—A review. J. Funct. Foods 2015, 18, 820–897. [Google Scholar] [CrossRef] [Scilit]
- De Sa Coutinho, D.; Pacheco, M.T.; Frozza, R.L.; Bernardi, A. Anti-Inflammatory Effects of Resveratrol: Mechanistic Insights. Int. J. Mol. Sci. 2018, 19, 1812. [Google Scholar] [CrossRef] [Scilit]
- Wong, D.H.; Villanueva, J.A.; Cress, A.B.; Duleba, A.J. Effects of resveratrol on proliferation and apoptosis in rat ovarian theca-interstitial cells. Mol. Hum. Reprod. 2010, 16, 251–259. [Google Scholar] [CrossRef] [Scilit]
- Carpene, C.; Les, F.; Casedas, G.; Peiro, C.; Fontaine, J.; Chaplin, A.; Mercader, J.; Lopez, V. Resveratrol Anti-Obesity Effects: Rapid Inhibition of Adipocyte Glucose Utilization. Antioxidants (Basel) 2019, 8, 74. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, C.Y.; Hsiao, W.C.; Wright, D.E.; Hsu, C.L.; Lo, Y.C.; Wang Hsu, G.S.; Kao, C.F. Resveratrol activates the histone H2B ubiquitin ligase, RNF20, in MDA-MB-231 breast cancer cells. J. Funct. Foods 2013, 5, 790–800. [Google Scholar] [CrossRef] [Scilit]
- Hudson, T.S.; Hartle, D.K.; Hursting, S.D.; Nunez, N.P.; Wang, T.T.; Young, H.A.; Arany, P.; Green, J.E. Inhibition of prostate cancer growth by muscadine grape skin extract and resveratrol through distinct mechanisms. Cancer Res. 2007, 67, 8396–8405. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsia, S.M.; Wang, K.L.; Wang, P.S. Effects of resveratrol, a grape polyphenol, on uterine contraction and Ca(2)+ mobilization in rats in vivo and in vitro. Endocrinology 2011, 152, 2090–2099. [Google Scholar] [CrossRef] [Scilit]
- Bai, Y.; Lu, H.; Wu, C.; Liang, Y.; Wang, S.; Lin, C.; Chen, B.; Xia, P. Resveratrol inhibits epithelial-mesenchymal transition and renal fibrosis by antagonizing the hedgehog signaling pathway. Biochem. Pharmacol. 2014, 92, 484–493. [Google Scholar] [CrossRef] [Scilit]
- Wu, C.H.; Shieh, T.M.; Wei, L.H.; Cheng, T.F.; Chen, H.Y.; Huang, T.C.; Wang, K.L.; Hsia, S.M. Resveratrol inhibits proliferation of myometrial and leiomyoma cells and decreases extracellular matrix-associated protein expression. J. Funct. Foods 2016, 23, 241–252. [Google Scholar] [CrossRef] [Scilit]
- Hsia, S.M.; Lin, K.H.; Chiang, W.C.; Wu, C.H.; Shieh, T.M.; Huang, T.C.; Chen, H.Y.; Lin, L.C. Effects of Adlay Hull and Testa Ethanolic Extracts on the Growth of Uterine Leiomyoma Cells. Adapt. Med. 2017, 9, 85–96. [Google Scholar] [CrossRef] [Scilit]
- Garvin, S.; Ollinger, K.; Dabrosin, C. Resveratrol induces apoptosis and inhibits angiogenesis in human breast cancer xenografts in vivo. Cancer Lett. 2006, 231, 113–122. [Google Scholar] [CrossRef] [Scilit]
- Kimura, Y.; Okuda, H. Resveratrol Isolated from Polygonum cuspidatum Root Prevents Tumor Growth and Metastasis to Lung and Tumor-Induced Neovascularization in Lewis Lung Carcinoma-Bearing Mice. J. Nutr. 2001, 131, 1844–1849. [Google Scholar] [CrossRef] [Scilit]
- Walle, T.; Hsieh, F.; DeLegge, M.H.; Oatis, J.E., Jr.; Walle, U.K. High absorption but very low bioavailability of oral resveratrol in humans. Drug. Metab. Dispos. 2004, 32, 1377–1382. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, C.; Shin, Y.G.; Chow, A.; Li, Y.; Kosmeder, J.W.; Lee, Y.S.; Hirschelman, W.H.; Pezzuto, J.M.; Mehta, R.G.; van Breemen, R.B. Human, rat, and mouse metabolism of resveratrol. Pharm. Res. 2002, 19, 1907–1914. [Google Scholar] [CrossRef] [Scilit]
- Caddeo, C.; Nacher, A.; Vassallo, A.; Armentano, M.F.; Pons, R.; Fernandez-Busquets, X.; Carbone, C.; Valenti, D.; Fadda, A.M.; Manconi, M. Effect of quercetin and resveratrol co-incorporated in liposomes against inflammatory/oxidative response associated with skin cancer. Int. J. Pharm. 2016, 513, 153–163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Szadvari, I.; Krizanova, O.; Babula, P. Athymic nude mice as an experimental model for cancer treatment. Physiol. Res. 2016, 65, S441–S453. [Google Scholar] [PubMed]
- Suzuki, Y.; Ii, M.; Saito, T.; Terai, Y.; Tabata, Y.; Ohmichi, M.; Asahi, M. Establishment of a novel mouse xenograft model of human uterine leiomyoma. Sci. Rep. 2018, 8, 8872. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vaezy, S.; Fujimoto, V.Y.; Walker, C.; Martin, R.W.; Chi, E.Y.; Crum, L.A. Treatment of uterine fibroid tumors in a nude mouse model using high-intensity focused ultrasound. Am. J. Obstet. Gynecol. 2000, 183, 6–11. [Google Scholar] [CrossRef] [Scilit]
- Strzalka, W.; Ziemienowicz, A. Proliferating cell nuclear antigen (PCNA): A key factor in DNA replication and cell cycle regulation. Ann. Bot. 2011, 107, 1127–1140. [Google Scholar] [CrossRef] [Scilit]
- Halder, S.K.; Sharan, C.; Al-Hendy, A. 1, 25-dihydroxyvitamin D3 treatment shrinks uterine leiomyoma tumors in the Eker rat model. Biol. Reprod. 2012, 86, 116. [Google Scholar] [CrossRef] [Scilit]
- Csatlos, E.; Mate, S.; Laky, M.; Rigo, J., Jr.; Joo, J.G. Role of Apoptosis in the Development of Uterine Leiomyoma: Analysis of Expression Patterns of Bcl-2 and Bax in Human Leiomyoma Tissue with Clinical Correlations. Int. J. Gynecol. Pathol. 2015, 34, 334–339. [Google Scholar] [CrossRef] [Scilit]
- Kovacs, K.A.; Lengyel, F.; Kornyei, J.L.; Vertes, Z.; Szabo, I.; Sumegi, B.; Vertes, M. Differential expression of Akt/protein kinase B, Bcl-2 and Bax proteins in human leiomyoma and myometrium. J. Steroid. Biochem. Mol. Biol. 2003, 87, 233–240. [Google Scholar] [CrossRef] [Scilit]
- Rybka, V.; Suzuki, Y.J.; Shults, N.V. Effects of Bcl-2/Bcl-x(L) Inhibitors on Pulmonary Artery Smooth Muscle Cells. Antioxidants (Basel) 2018, 7, 150. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baarine, M.; Thandapilly, S.J.; Louis, X.L.; Mazué, F.; Yu, L.; Delmas, D.; Netticadan, T.; Lizard, G.; Latruffe, N. Pro-apoptotic versus anti-apoptotic properties of dietary resveratrol on tumoral and normal cardiac cells. Genes Nutr. 2011, 6, 161–169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Walker, C.L.; Stewart, E.A. Uterine fibroids: The elephant in the room. Science 2005, 308, 1589–1592. [Google Scholar] [CrossRef] [Scilit]
- Darby, I.A.; Hewitson, T.D. Fibroblast differentiation in wound healing and fibrosis. Int. Rev. Cytol. 2007, 257, 143–179. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rao, K.B.; Malathi, N.; Narashiman, S.; Rajan, S.T. Evaluation of myofibroblasts by expression of alpha smooth muscle actin: A marker in fibrosis, dysplasia and carcinoma. J. Clin. Diagn. Res. 2014, 8, ZC14-17. [Google Scholar] [CrossRef] [Scilit]
- Holdsworth-Carson, S.J.; Zaitseva, M.; Vollenhoven, B.J.; Rogers, P.A. Clonality of smooth muscle and fibroblast cell populations isolated from human fibroid and myometrial tissues. Mol. Hum. Reprod. 2014, 20, 250–259. [Google Scholar] [CrossRef] [Scilit]
- Ko, Y.A.; Jamaluddin, M.F.B.; Adebayo, M.; Bajwa, P.; Scott, R.J.; Dharmarajan, A.M.; Nahar, P.; Tanwar, P.S. Extracellular matrix (ECM) activates beta-catenin signaling in uterine fibroids. Reproduction 2018, 155, 61–71. [Google Scholar] [CrossRef] [Scilit]
- Tanwar, P.S.; Lee, H.J.; Zhang, L.; Zukerberg, L.R.; Taketo, M.M.; Rueda, B.R.; Teixeira, J.M. Constitutive activation of Beta-catenin in uterine stroma and smooth muscle leads to the development of mesenchymal tumors in mice. Biol. Reprod. 2009, 81, 545–552. [Google Scholar] [CrossRef] [Scilit]






| Gene | Forward (5′ to 3′) | Reverse (5′ to 3′) |
|---|---|---|
| FN11 | GGCCAGTCCTACAACCAGTAT | TCGGGAATCTTCTCTGTCAGC |
| GAPDH2 | TGCACCACCAACTGCTTAGC | GGCATGGACTGTGGTCATGAG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, H.-Y.; Lin, P.-H.; Shih, Y.-H.; Wang, K.-L.; Hong, Y.-H.; Shieh, T.-M.; Huang, T.-C.; Hsia, S.-M. Natural Antioxidant Resveratrol Suppresses Uterine Fibroid Cell Growth and Extracellular Matrix Formation In Vitro and In Vivo. Antioxidants 2019, 8, 99. https://doi.org/10.3390/antiox8040099
Chen H-Y, Lin P-H, Shih Y-H, Wang K-L, Hong Y-H, Shieh T-M, Huang T-C, Hsia S-M. Natural Antioxidant Resveratrol Suppresses Uterine Fibroid Cell Growth and Extracellular Matrix Formation In Vitro and In Vivo. Antioxidants. 2019; 8(4):99. https://doi.org/10.3390/antiox8040099
Chicago/Turabian StyleChen, Hsin-Yuan, Po-Han Lin, Yin-Hwa Shih, Kei-Lee Wang, Yong-Han Hong, Tzong-Ming Shieh, Tsui-Chin Huang, and Shih-Min Hsia. 2019. "Natural Antioxidant Resveratrol Suppresses Uterine Fibroid Cell Growth and Extracellular Matrix Formation In Vitro and In Vivo" Antioxidants 8, no. 4: 99. https://doi.org/10.3390/antiox8040099
APA StyleChen, H.-Y., Lin, P.-H., Shih, Y.-H., Wang, K.-L., Hong, Y.-H., Shieh, T.-M., Huang, T.-C., & Hsia, S.-M. (2019). Natural Antioxidant Resveratrol Suppresses Uterine Fibroid Cell Growth and Extracellular Matrix Formation In Vitro and In Vivo. Antioxidants, 8(4), 99. https://doi.org/10.3390/antiox8040099

