Oxidative Stress-Induced Misfolding and Inclusion Formation of Nrf2 and Keap1
Abstract
1. Introduction
2. Materials and Methods
2.1. Prediction of Intrinsically Disordered Regions
2.2. Protein Sequence Alignment
2.3. Yeast Growth Assays and Microscopy
2.4. Cell Lines and Culture Conditions
2.5. Cell Viability Assays
2.6. Fluorescence and Immunofluorescence Microscopy
2.7. RNA Isolation and Quantitative Reverse Transcription PCR (RT-qPCR)
2.8. Protein Expression and Purification
2.9. SDS-PAGE and Coomassie Blue Gel Staining
2.10. SDD-AGE (Semi-Denaturing Detergent Agarose Gel Electrophoresis)
2.11. Combined SDD-AGE and Fractionation Assay
2.12. Statistical Analysis
3. Results
3.1. Analysis of Nrf2
3.1.1. Nrf2 Is Intrinsically Disordered and Keap1′s High Cysteine Content Is Evolutionarily Conserved
3.1.2. Oxidative Stress and Nrf2 and Keap1 Expression in Yeast
3.1.3. Nrf2 Forms Protein Inclusions under High Oxidative Stress Conditions in HeLa Cells
3.1.4. Nrf2 Protein Inclusions Are Not Artifacts, Are Preventable by Certain Antioxidants, and May Remain Functional
3.2. Analysis of Keap1
3.2.1. Keap1 Forms Protein Inclusions under High Oxidative Stress Conditions in HeLa Cells
3.2.2. Keap1 Protein Inclusions Are Not Artifacts and Are Not Preventable by Pretreatment with Certain Antioxidants
3.2.3. Keap1 Forms Oxidative Stress-Induced Protein Inclusions in Breast Cancer Cell Lines
3.3. Analysis of Nrf2 and Keap1 Purified Protein
Purified Proteins for Nrf2 and Keap1 Aggregate upon Exposure to Oxidative Stress
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Moi, P.; Chan, K.; Asunis, I.; Cao, A.; Kan, Y.W. Isolation of NF-E2-related factor 2 (Nrf2), a NF-E2-like basic leucine zipper transcriptional activator that binds to the tandem NF-E2/AP1 repeat of the beta-globin locus control region. Proc. Natl. Acad. Sci. USA 1994, 91, 9926–9930. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Itoh, K.; Wakabayashi, N.; Katoh, Y.; Ishii, T.; Igarashi, K.; Engel, J.D.; Yamamoto, M. Keap1 represses nuclear activation of antioxidant responsive elements by Nrf2 through binding to the amino-terminal Neh2 domain. Genes Dev. 1999, 13, 76–86. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McMahon, M.; Itoh, K.; Yamamoto, M.; Hayes, J.D. Keap1-dependent proteasomal degradation of transcription factor Nrf2 contributes to the negative regulation of antioxidant response element-driven gene expression. J. Biol. Chem. 2003, 278, 21592–21600. [Google Scholar] [CrossRef] [Scilit]
- Itoh, K.; Wakabayashi, N.; Katoh, Y.; Ishii, T.; O’Connor, T.; Yamamoto, M. Keap1 regulates both cytoplasmic-nuclear shuttling and degradation of Nrf2 in response to electrophiles. Genes Cells 2003, 8, 379–391. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nguyen, T.; Sherratt, P.J.; Huang, H.C.; Yang, C.S.; Pickett, C.B. Increased protein stability as a mechanism that enhances Nrf2-mediated transcriptional activation of the antioxidant response element. Degradation of Nrf2 by the 26 S proteasome. J. Biol. Chem. 2003, 278, 4536–4541. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kobayashi, A.; Kang, M.I.; Watai, Y.; Tong, K.I.; Shibata, T.; Uchida, K.; Yamamoto, M. Oxidative and electrophilic stresses activate Nrf2 through inhibition of ubiquitination activity of Keap1. Mol. Cell Biol. 2006, 26, 221–229. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, D.D.; Hannink, M. Distinct cysteine residues in Keap1 are required for Keap1-dependent ubiquitination of Nrf2 and for stabilization of Nrf2 by chemopreventive agents and oxidative stress. Mol. Cell Biol. 2003, 23, 8137–8151. [Google Scholar] [CrossRef] [Scilit]
- Dinkova-Kostova, A.T.; Holtzclaw, W.D.; Cole, R.N.; Itoh, K.; Wakabayashi, N.; Katoh, Y.; Yamamoto, M.; Talalay, P. Direct evidence that sulfhydryl groups of Keap1 are the sensors regulating induction of phase 2 enzymes that protect against carcinogens and oxidants. Proc. Natl. Acad. Sci. USA 2002, 99, 11908. [Google Scholar] [CrossRef] [Scilit]
- Wakabayashi, N.; Dinkova-Kostova, A.T.; Holtzclaw, W.D.; Kang, M.I.; Kobayashi, A.; Yamamoto, M.; Kensler, T.W.; Talalay, P. Protection against electrophile and oxidant stress by induction of the phase 2 response: Fate of cysteines of the Keap1 sensor modified by inducers. Proc. Natl. Acad. Sci. USA 2004, 101, 2040–2045. [Google Scholar] [CrossRef] [Scilit]
- Yamamoto, M.; Kensler, T.W.; Motohashi, H. The KEAP1-NRF2 System: A Thiol-Based Sensor-Effector Apparatus for Maintaining Redox Homeostasis. Physiol. Rev. 2018, 98, 1169–1203. [Google Scholar] [CrossRef] [Scilit]
- Baird, L.; Yamamoto, M. The Molecular Mechanisms Regulating the KEAP1-NRF2 Pathway. Mol. Cell Biol. 2020, 40, e00099-20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Padmanabhan, B.; Tong, K.I.; Ohta, T.; Nakamura, Y.; Scharlock, M.; Ohtsuji, M.; Kang, M.I.; Kobayashi, A.; Yokoyama, S.; Yamamoto, M. Structural basis for defects of Keap1 activity provoked by its point mutations in lung cancer. Mol. Cell 2006, 21, 689–700. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shibata, T.; Ohta, T.; Tong, K.I.; Kokubu, A.; Odogawa, R.; Tsuta, K.; Asamura, H.; Yamamoto, M.; Hirohashi, S. Cancer related mutations in NRF2 impair its recognition by Keap1-Cul3 E3 ligase and promote malignancy. Proc. Natl. Acad. Sci. USA 2008, 105, 13568–13573. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tong, K.I.; Katoh, Y.; Kusunoki, H.; Itoh, K.; Tanaka, T.; Yamamoto, M. Keap1 Recruits Neh2 through Binding to ETGE and DLG Motifs: Characterization of the Two-Site Molecular Recognition Model. Mol. Cell. Biol. 2006, 26, 2887–2900. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tong, K.I.; Padmanabhan, B.; Kobayashi, A.; Shang, C.; Hirotsu, Y.; Yokoyama, S.; Yamamoto, M. Different electrostatic potentials define ETGE and DLG motifs as hinge and latch in oxidative stress response. Mol. Cell Biol. 2007, 27, 7511–7521. [Google Scholar] [CrossRef] [Scilit]
- Dhakshinamoorthy, S.; Jain, A.K.; Bloom, D.A.; Jaiswal, A.K. Bach1 competes with Nrf2 leading to negative regulation of the antioxidant response element (ARE)-mediated NAD(P)H:quinone oxidoreductase 1 gene expression and induction in response to antioxidants. J. Biol. Chem. 2005, 280, 16891–16900. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, H.C.; Nguyen, T.; Pickett, C.B. Phosphorylation of Nrf2 at Ser-40 by protein kinase C regulates antioxidant response element-mediated transcription. J. Biol. Chem. 2002, 277, 42769–42774. [Google Scholar] [CrossRef] [Scilit]
- Rada, P.; Rojo, A.I.; Chowdhry, S.; McMahon, M.; Hayes, J.D.; Cuadrado, A. SCF/β-TrCP promotes glycogen synthase kinase 3-dependent degradation of the Nrf2 transcription factor in a Keap1-independent manner. Mol. Cell Biol. 2011, 31, 1121–1133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chowdhry, S.; Zhang, Y.; McMahon, M.; Sutherland, C.; Cuadrado, A.; Hayes, J.D. Nrf2 is controlled by two distinct β-TrCP recognition motifs in its Neh6 domain, one of which can be modulated by GSK-3 activity. Oncogene 2013, 32, 3765–3781. [Google Scholar] [CrossRef] [Scilit]
- Lo, S.-C.; Hannink, M. PGAM5 tethers a ternary complex containing Keap1 and Nrf2 to mitochondria. Exp. Cell Res. 2008, 314, 1789–1803. [Google Scholar] [CrossRef] [Scilit]
- Karunatilleke, N.C.; Fast, C.S.; Ngo, V.; Brickenden, A.; Duennwald, M.L.; Konermann, L.; Choy, W.-Y. Nrf2, the Major Regulator of the Cellular Oxidative Stress Response, is Partially Disordered. Int. J. Mol. Sci. 2021, 22, 7434. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dunker, A.K.; Lawson, J.D.; Brown, C.J.; Williams, R.M.; Romero, P.; Oh, J.S.; Oldfield, C.J.; Campen, A.M.; Ratliff, C.M.; Hipps, K.W.; et al. Intrinsically disordered protein. J. Mol. Graph. Model. 2001, 19, 26–59. [Google Scholar] [CrossRef] [Scilit]
- Dyson, H.J.; Wright, P.E. Intrinsically unstructured proteins and their functions. Nat. Rev. Mol. Cell Biol. 2005, 6, 197–208. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Uversky, V.N. Intrinsically Disordered Proteins and Their “Mysterious” (Meta)Physics. Front. Phys. 2019, 7, 10. [Google Scholar] [CrossRef] [Scilit]
- Dobson, C.M. Protein folding and misfolding. Nature 2003, 426, 884–890. [Google Scholar] [CrossRef] [Scilit]
- Wise-Scira, O.; Dunn, A.; Aloglu, A.K.; Sakallioglu, I.T.; Coskuner, O. Structures of the E46K mutant-type α-synuclein protein and impact of E46K mutation on the structures of the wild-type α-synuclein protein. ACS Chem. Neurosci. 2013, 4, 498–508. [Google Scholar] [CrossRef] [Scilit]
- Xue, B.; Brown, C.J.; Dunker, A.K.; Uversky, V.N. Intrinsically disordered regions of p53 family are highly diversified in evolution. Biochim. Biophys. Acta 2013, 1834, 725–738. [Google Scholar] [CrossRef] [Scilit]
- Stadtman, E.R. Oxidation of free amino acids and amino acid residues in proteins by radiolysis and by metal-catalyzed reactions. Annu. Rev. Biochem. 1993, 62, 797–821. [Google Scholar] [CrossRef]
- Dean, R.T.; Roberts, C.R.; Jessup, W. Fragmentation of extracellular and intracellular polypeptides by free radicals. Prog. Clin. Biol. Res. 1985, 180, 341–350. [Google Scholar]
- Davies, K.J. Protein damage and degradation by oxygen radicals. I. general aspects. J. Biol. Chem. 1987, 262, 9895–9901. [Google Scholar]
- Davies, K.J.; Delsignore, M.E.; Lin, S.W. Protein damage and degradation by oxygen radicals. II. Modification of amino acids. J. Biol. Chem. 1987, 262, 9902–9907. [Google Scholar]
- Di Simplicio, P.; Franconi, F.; Frosalí, S.; Di Giuseppe, D. Thiolation and nitrosation of cysteines in biological fluids and cells. Amino. Acids 2003, 25, 323–339. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ishida, T.; Kinoshita, K. PrDOS: Prediction of disordered protein regions from amino acid sequence. Nucleic Acids Res. 2007, 35, W460–W464. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xue, B.; Dunbrack, R.L.; Williams, R.W.; Dunker, A.K.; Uversky, V.N. PONDR-FIT: A meta-predictor of intrinsically disordered amino acids. Biochim. Biophys. Acta 2010, 1804, 996–1010. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mészáros, B.; Erdős, G.; Dosztányi, Z. IUPred2A: Context-dependent prediction of protein disorder as a function of redox state and protein binding. Nucleic Acids Res. 2018, 46, W329–W337. [Google Scholar] [CrossRef] [Scilit]
- The UniProt Consortium. UniProt: The universal protein knowledgebase in 2021. Nucleic Acids Res. 2021, 49, D480–D489. [Google Scholar]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [Scilit]
- Thomas, B.J.; Rothstein, R. Elevated recombination rates in transcriptionally active DNA. Cell 1989, 56, 619–630. [Google Scholar] [CrossRef] [Scilit]
- Gietz, R.D.; Schiestl, R.H. High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nat. Protoc. 2007, 2, 31. [Google Scholar] [CrossRef] [Scilit]
- Petropavlovskiy, A.A.; Tauro, M.G.; Lajoie, P.; Duennwald, M.L. A Quantitative Imaging-Based Protocol for Yeast Growth and Survival on Agar Plates. STAR Protoc. 2020, 1, 100182. [Google Scholar] [CrossRef] [Scilit]
- Song, Z. Role Heat Shock Protein 90 Keap1/Nrf2 Mediated Oxidative-Stress Response. Master’s Thesis, University of Western Ontario, London, ON, Canada, 2020. [Google Scholar]
- Sambrook, J.; Russell, D.W. Preparation and Transformation of Competent E. coli Using Calcium Chloride. CSH Protoc. 2006, 2006, pdb-prot3932. [Google Scholar] [PubMed]
- McMahon, M.; Lamont, D.J.; Beattie, K.A.; Hayes, J.D. Keap1 perceives stress via three sensors for the endogenous signaling molecules nitric oxide, zinc, and alkenals. Proc. Natl. Acad. Sci. USA 2010, 107, 18838–18843. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.; Zhang, D.; Hannink, M.; Beamer, L.J. Crystal structure of the Kelch domain of human Keap1. J. Biol. Chem. 2004, 279, 54750–54758. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miseta, A.; Csutora, P. Relationship between the occurrence of cysteine in proteins and the complexity of organisms. Mol. Biol. Evol. 2000, 17, 1232–1239. [Google Scholar] [CrossRef] [Scilit]
- Ngo, V.; Brickenden, A.; Liu, H.; Yeung, C.; Choy, W.Y.; Duennwald, M.L. A novel yeast model detects Nrf2 and Keap1 interactions with Hsp90. Dis Models Mech. 2022; in press.
- Crouch, S.P.; Kozlowski, R.; Slater, K.J.; Fletcher, J. The use of ATP bioluminescence as a measure of cell proliferation and cytotoxicity. J. Immunol. Methods 1993, 160, 81–88. [Google Scholar] [CrossRef] [Scilit]
- Sies, H. Hydrogen peroxide as a central redox signaling molecule in physiological oxidative stress: Oxidative eustress. Redox Biol. 2017, 11, 613–619. [Google Scholar] [CrossRef] [Scilit]
- Kumari, S.; Badana, A.K.; Murali Mohan, G.; Shailender, G.; Malla, R. Reactive Oxygen Species: A Key Constituent in Cancer Survival. Biomark. Insights 2018, 13, 1177271918755391. [Google Scholar] [CrossRef] [Scilit]
- Halliwell, B.; Gutteridge, J.M.C. Free Radicals in Biology and Medicine, 5th ed.; Oxford University Press: Oxford, UK, 2015. [Google Scholar]
- Xu, L.L.; Zhao, B.; Sun, S.L.; Yu, S.F.; Wang, Y.M.; Ji, R.; Yang, Z.T.; Ma, L.; Yao, Y.; Chen, Y.; et al. High-dose vitamin C alleviates pancreatic injury via the NRF2/NQO1/HO-1 pathway in a rat model of severe acute pancreatitis. Ann. Transl. Med. 2020, 8, 852. [Google Scholar] [CrossRef] [Scilit]
- Mostafavi-Pour, Z.; Ramezani, F.; Keshavarzi, F.; Samadi, N. The role of quercetin and vitamin C in Nrf2-dependent oxidative stress production in breast cancer cells. Oncol. Lett. 2017, 13, 1965–1973. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.R.; Ha, Y.M.; Kim, Y.M.; Park, E.J.; Kim, J.W.; Park, S.W.; Kim, H.J.; Chung, H.T.; Chang, K.C. Ascorbic acid reduces HMGB1 secretion in lipopolysaccharide-activated RAW 264.7 cells and improves survival rate in septic mice by activation of Nrf2/HO-1 signals. Biochem. Pharmacol. 2015, 95, 279–289. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Samuni, Y.; Goldstein, S.; Dean, O.M.; Berk, M. The chemistry and biological activities of N-acetylcysteine. Biochim. Biophys. Acta 2013, 1830, 4117–4129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, X.; Wang, L.; Cai, J.; Liu, K.; Liu, M.; Wang, H.; Zhang, H. N-acetylcysteine alleviates H2O2-induced damage via regulating the redox status of intracellular antioxidants in H9c2 cells. Int. J. Mol. Med. 2019, 43, 199–208. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xie, W.; Tan, B.; Yang, Z.; Yu, X.; Chen, L.; Ran, D.; Xu, Q.; Zhou, X. Nrf2/ARE pathway activation is involved in negatively regulating heat-induced apoptosis in non-small cell lung cancer cells. Acta Biochim. Biophys. Sin. 2020, 52, 439–445. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Y.; Wang, H.D.; Zhou, X.M.; Fang, J.; Zhu, L.; Ding, K. N-acetylcysteine amide provides neuroprotection via Nrf2-ARE pathway in a mouse model of traumatic brain injury. Drug Des. Devel. 2018, 12, 4117–4127. [Google Scholar] [CrossRef] [Scilit]
- Wolfram, T.; Schwarz, M.; Reuß, M.; Lossow, K.; Ost, M.; Klaus, S.; Schwerdtle, T.; Kipp, A.P. N-Acetylcysteine as Modulator of the Essential Trace Elements Copper and Zinc. Antioxidants 2020, 9, 1117. [Google Scholar] [CrossRef] [Scilit]
- Jannatifar, R.; Parivar, K.; Hayati Roodbari, N.; Nasr-Esfahani, M.H. The Effect of N-Acetyl-Cysteine on NRF2 Antioxidant Gene Expression in Asthenoteratozoospermia Men: A Clinical Trial Study. Int. J. Fertil. Steril. 2020, 14, 171–175. [Google Scholar]
- Romanque, P.; Cornejo, P.; Valdés, S.; Videla, L.A. Thyroid Hormone Administration Induces Rat Liver Nrf2 Activation: Suppression by N-Acetylcysteine Pretreatment. Thyroid 2011, 21, 655–662. [Google Scholar] [CrossRef] [Scilit]
- Amara, I.E.; El-Kadi, A.O. Transcriptional modulation of the NAD(P)H:quinone oxidoreductase 1 by mercury in human hepatoma HepG2 cells. Free Radic. Biol. Med. 2011, 51, 1675–1685. [Google Scholar] [CrossRef] [Scilit]
- Kushnirov, V.V.; Alexandrov, I.M.; Mitkevich, O.V.; Shkundina, I.S.; Ter-Avanesyan, M.D. Purification and analysis of prion and amyloid aggregates. Methods 2006, 39, 50–55. [Google Scholar] [CrossRef] [Scilit]
- Nam, L.B.; Keum, Y.-S. Binding partners of NRF2: Functions and regulatory mechanisms. Arch. Biochem. Biophys. 2019, 678, 108184. [Google Scholar] [CrossRef] [Scilit]
- Uversky, V.N. Intrinsically disordered proteins may escape unwanted interactions via functional misfolding. Biochim. Biophys. Acta Proteins Proteom. 2011, 1814, 693–712. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Praslicka, B.J.; Kerins, M.J.; Ooi, A. The complex role of NRF2 in cancer: A genomic view. Curr. Opin. Toxicol. 2016, 1, 37–45. [Google Scholar] [CrossRef] [Scilit]
- Reuter, S.; Gupta, S.C.; Chaturvedi, M.M.; Aggarwal, B.B. Oxidative stress, inflammation, and cancer: How are they linked? Free Radic. Biol. Med. 2010, 49, 1603–1616. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liguori, I.; Russo, G.; Curcio, F.; Bulli, G.; Aran, L.; Della-Morte, D.; Gargiulo, G.; Testa, G.; Cacciatore, F.; Bonaduce, D.; et al. Oxidative stress, aging, and diseases. Clin. Interv. Aging 2018, 13, 757–772. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marino, S.M.; Gladyshev, V.N. Cysteine function governs its conservation and degeneration and restricts its utilization on protein surfaces. J. Mol. Biol. 2010, 404, 902–916. [Google Scholar] [CrossRef] [Scilit]
- He, X.; Ma, Q. NRF2 cysteine residues are critical for oxidant/electrophile-sensing, Kelch-like ECH-associated protein-1-dependent ubiquitination-proteasomal degradation, and transcription activation. Mol. Pharm. 2009, 76, 1265–1278. [Google Scholar] [CrossRef] [Scilit]
- Fourquet, S.; Guerois, R.; Biard, D.; Toledano, M.B. Activation of NRF2 by nitrosative agents and H2O2 involves KEAP1 disulfide formation. J. Biol. Chem. 2010, 285, 8463–8471. [Google Scholar] [CrossRef] [Scilit]
- Jansens, A.; van Duijn, E.; Braakman, I. Coordinated nonvectorial folding in a newly synthesized multidomain protein. Science 2002, 298, 2401–2403. [Google Scholar] [CrossRef] [Scilit]
- Collet, J.-F.; Messens, J. Structure, Function, and Mechanism of Thioredoxin Proteins. Antioxid. Redox Signal. 2010, 13, 1205–1216. [Google Scholar] [CrossRef] [Scilit]
- Soto, C. Unfolding the role of protein misfolding in neurodegenerative diseases. Nat. Rev. Neurosci. 2003, 4, 49–60. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Glover, J.R.; Lindquist, S. Hsp104, Hsp70, and Hsp40: A novel chaperone system that rescues previously aggregated proteins. Cell 1998, 94, 73–82. [Google Scholar] [CrossRef] [Scilit]
- Goloubinoff, P.; Mogk, A.; Zvi, A.P.; Tomoyasu, T.; Bukau, B. Sequential mechanism of solubilization and refolding of stable protein aggregates by a bichaperone network. Proc. Natl. Acad. Sci. USA 1999, 96, 13732–13737. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shorter, J. Hsp104: A weapon to combat diverse neurodegenerative disorders. Neurosignals 2008, 16, 63–74. [Google Scholar] [CrossRef] [Scilit]
- Sun, Z.; Wu, T.; Zhao, F.; Lau, A.; Birch, C.M.; Zhang, D.D. KPNA6 (Importin α7)-Mediated Nuclear Import of Keap1 Represses the Nrf2-Dependent Antioxidant Response. Mol. Cell. Biol. 2011, 31, 1800–1811. [Google Scholar] [CrossRef] [Scilit]
- Taguchi, K.; Fujikawa, N.; Komatsu, M.; Ishii, T.; Unno, M.; Akaike, T.; Motohashi, H.; Yamamoto, M. Keap1 degradation by autophagy for the maintenance of redox homeostasis. Proc. Natl. Acad. Sci. USA 2012, 109, 13561. [Google Scholar] [CrossRef] [Scilit]








| mRNA Probe | NCBI Gene Accession Number | Primer Sequences (Forward and Reverse, 5′ to 3′) |
|---|---|---|
| NFE2L2 | AC079305 | F: GCCCAATGTGAGAACACACC R: TGTGAGATGAGCCTCCAAGC |
| HMOX1 | AY460337 | F: CCCCAACGAAAAGCACATCC R: AGACAGCTGCCACATTAGGG |
| NQO1 | AH005427 | F: TGGAAGAAACGCCTGGAGAAT R: CTGGTTGTCAGTTGGGATGG |
| TXN | AF548001 | F: ATTGTGACCAGCACCTACGG R: CATGGTGGAGTTGTCCCGAA |
| RPLP0 | AC004263 | F: CCTCATATCCGGGGGAATGTG R: GCAGCAGCTGGCACCTTATTG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ngo, V.; Karunatilleke, N.C.; Brickenden, A.; Choy, W.-Y.; Duennwald, M.L. Oxidative Stress-Induced Misfolding and Inclusion Formation of Nrf2 and Keap1. Antioxidants 2022, 11, 243. https://doi.org/10.3390/antiox11020243
Ngo V, Karunatilleke NC, Brickenden A, Choy W-Y, Duennwald ML. Oxidative Stress-Induced Misfolding and Inclusion Formation of Nrf2 and Keap1. Antioxidants. 2022; 11(2):243. https://doi.org/10.3390/antiox11020243
Chicago/Turabian StyleNgo, Vy, Nadun C. Karunatilleke, Anne Brickenden, Wing-Yiu Choy, and Martin L. Duennwald. 2022. "Oxidative Stress-Induced Misfolding and Inclusion Formation of Nrf2 and Keap1" Antioxidants 11, no. 2: 243. https://doi.org/10.3390/antiox11020243
APA StyleNgo, V., Karunatilleke, N. C., Brickenden, A., Choy, W.-Y., & Duennwald, M. L. (2022). Oxidative Stress-Induced Misfolding and Inclusion Formation of Nrf2 and Keap1. Antioxidants, 11(2), 243. https://doi.org/10.3390/antiox11020243

