Early Diagnosis of Pathogen Infection by Cell-Based Activation Immunoassay
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacteria and Viruses
2.1.1. Francisella Tularensis
2.1.2. Bacillus Anthracis
2.1.3. Yersinia Pestis
2.1.4. Influenza
2.2. Animals
2.3. ELISPOT Assays
- 1)
- NP366–374 ASNENMETM (Db-restricted)
- 2)
- PA224–233 SSLENFRAYV (Db-restricted)
- 3)
- NP311–325 QVYSLIRPNENPAHK (I-Ab-restricted)
- 4)
- NA161–175 SVAWSASACHDGMGW (I-Ab-restricted)
2.4. ELISA
2.5. RNA-Seq
2.6. Real-Time PCR
- IFNγ: TCAAGTGGCATAGATGTGGAAGAA, TGGCTCTGCAGGATTTTCATG
- Mmp9: GCCGACTTTTGTGGTCTTCC, AGCGGTACAAGTATGCCTCTG
- Hprt: TGAAGAGCTACTGTAATGATCAGTCAA, AGCAAGCTTGCAACCTTAACCA
2.7. Statistical Analysis
3. Results
3.1. Characterization of Early Immune Response Following F. Tularensis Infection
3.2. Early Response Following Bacillus Anthracis and Yersinia Pestis
3.3. Early Response to Peptide Antigens Following Influenza Infection
3.4. Early Response to FT is Detected in Peripheral Blood Cells
3.5. Early Response in the Blood of NHP Inoculated with BA Spores
3.6. Gene Expression Signature Can Serve for Detection of Early Immune Response
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Amanna, I.J.; Carlson, N.E.; Slifka, M.K. Duration of humoral immunity to common viral and vaccine antigens. N. Engl. J. Med. 2007, 357, 1903–1915. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seder, R.A.; Darrah, P.A.; Roederer, M. T-cell quality in memory and protection: Implications for vaccine design. Nat. Rev. Immunol. 2008, 8, 247–258. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hamann, D.; Baars, P.A.; Rep, M.H.; Hooibrink, B.; Kerkhof-Garde, S.R.; Klein, M.R.; van Lier, R.A. Phenotypic and functional separation of memory and effector human CD8+ T cells. J. Exp. Med. 1997, 186, 1407–1418. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sallusto, F.; Lenig, D.; Forster, R.; Lipp, M.; Lanzavecchia, A. Two subsets of memory T lymphocytes with distinct homing potentials and effector functions. Nature 1999, 401, 708–712. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Joe, G.; Hexner, E.; Zhu, J.; Emerson, S.G. Host-reactive CD8+ memory stem cells in graft-versus-host disease. Nat. Med. 2005, 11, 1299–1305. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chattopadhyay, P.K.; Gierahn, T.M.; Roederer, M.; Love, J.C. Single-cell technologies for monitoring immune systems. Nat. Immunol. 2014, 15, 128–135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McCutcheon, M.; Wehner, N.; Wensky, A.; Kushner, M.; Doan, S.; Hsiao, L.; Calabresi, P.; Ha, T.; Tran, T.V.; Tate, K.M.; et al. A sensitive ELISPOT assay to detect low-frequency human T lymphocytes. J. Immunol. Methods 1997, 210, 149–166. [Google Scholar] [CrossRef] [Scilit]
- Josko, D. Updates in immunoassays: Introduction. Clin. Lab. Sci. 2012, 25, 170–172. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thillai, M.; Pollock, K.; Pareek, M.; Lalvani, A. Interferon-gamma release assays for tuberculosis: Current and future applications. Expert Rev. Respir. Med. 2014, 8, 67–78. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lima-Junior, J.D.C.; Morgado, F.N.; Conceicao-Silva, F. How Can elispot add information to improve knowledge on tropical diseases? Cells 2017, 6, 31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Banas, B.; Boger, C.A.; Luckhoff, G.; Kruger, B.; Barabas, S.; Batzilla, J.; Schemmerer, M.; Kostler, J.; Bendfeldt, H.; Rascle, A.; et al. Validation of T-Track(R) CMV to assess the functionality of cytomegalovirus-reactive cell-mediated immunity in hemodialysis patients. BMC Immunol. 2017, 18, 15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chitlaru, T.; Israeli, M.; Rotem, S.; Elia, U.; Bar-Haim, E.; Ehrlich, S.; Cohen, O.; Shafferman, A. A novel live attenuated anthrax spore vaccine based on an acapsular Bacillus anthracis Sterne strain with mutations in the htrA, lef and cya genes. Vaccine 2017, 35, 6030–6040. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chitlaru, T.; Israeli, M.; Bar-Haim, E.; Elia, U.; Rotem, S.; Ehrlich, S.; Cohen, O.; Shafferman, A. Next-generation bacillus anthracis live attenuated spore vaccine based on the htra(-) (high temperature requirement a) sterne strain. Sci. Rep. 2016, 6, 18908. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Achdout, H.; Arnon, T.I.; Markel, G.; Gonen-Gross, T.; Katz, G.; Lieberman, N.; Gazit, R.; Joseph, A.; Kedar, E.; Mandelboim, O. Enhanced recognition of human NK receptors after influenza virus infection. J. Immunol. 2003, 171, 915–923. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ben-Ari Fuchs, S.; Lieder, I.; Stelzer, G.; Mazor, Y.; Buzhor, E.; Kaplan, S.; Bogoch, Y.; Plaschkes, I.; Shitrit, A.; Rappaport, N.; et al. GeneAnalytics: An integrative gene set analysis tool for next generation sequencing, rnaseq and microarray data. OMICS 2016, 20, 139–151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cowley, S.; Elkins, K. Immunity to francisella. Front. Microbiol. 2011, 2, 26. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Markel, G.; Bar-Haim, E.; Zahavy, E.; Cohen, H.; Cohen, O.; Shafferman, A.; Velan, B. The involvement of IL-17A in the murine response to sub-lethal inhalational infection with Francisella tularensis. PLoS ONE 2010, 5, e11176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chitlaru, T.; Ariel, N.; Zvi, A.; Lion, M.; Velan, B.; Shafferman, A.; Elhanany, E. Identification of chromosomally encoded membranal polypeptides of Bacillus anthracis by a proteomic analysis: Prevalence of proteins containing S-layer homology domains. Proteomics 2004, 4, 677–691. [Google Scholar] [CrossRef] [Scilit]
- Crowe, S.R.; Miller, S.C.; Brown, D.M.; Adams, P.S.; Dutton, R.W.; Harmsen, A.G.; Lund, F.E.; Randall, T.D.; Swain, S.L.; Woodland, D.L. Uneven distribution of MHC class II epitopes within the influenza virus. Vaccine 2006, 24, 457–467. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhong, W.; Reche, P.A.; Lai, C.C.; Reinhold, B.; Reinherz, E.L. Genome-wide characterization of a viral cytotoxic T lymphocyte epitope repertoire. J. Biol. Chem. 2003, 278, 45135–45144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nagaishi, T.; Iijima, H.; Nakajima, A.; Chen, D.; Blumberg, R.S. Role of CEACAM1 as a regulator of T cells. Ann. N. Y. Acad. Sci. 2006, 1072, 155–175. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gharagozloo, M.; Mahmoud, S.; Simard, C.; Mahvelati, T.M.; Amrani, A.; Gris, D. The dual immunoregulatory function of nlrp12 in t cell-mediated immune response: Lessons from experimental autoimmune encephalomyelitis. Cells 2018, 7, 119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lukens, J.R.; Gurung, P.; Shaw, P.J.; Barr, M.J.; Zaki, M.H.; Brown, S.A.; Vogel, P.; Chi, H.; Kanneganti, T.D. The NLRP12 Sensor Negatively Regulates Autoinflammatory Disease by Modulating Interleukin-4 Production in T Cells. Immunity 2015, 42, 654–664. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, S.; Du, X.; Huang, Y.; Fu, Y.; Yang, Y.; Zhan, X.; He, W.; Wen, Q.; Zhou, X.; Zhou, C.; et al. NLRC3 negatively regulates CD4+ T cells and impacts protective immunity during Mycobacterium tuberculosis infection. PLoS Pathog. 2018, 14, e1007266. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Foote, J.; Eisen, H.N. Kinetic and affinity limits on antibodies produced during immune responses. Proc. Natl. Acad. Sci. USA 1995, 92, 1254–1256. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schroder, K.; Hertzog, P.J.; Ravasi, T.; Hume, D.A. Interferon-γ: An overview of signals, mechanisms and functions. J. Leukoc. Biol. 2004, 75, 163–189. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bar-On, L.; Cohen, H.; Elia, U.; Rotem, S.; Bercovich-Kinori, A.; Bar-Haim, E.; Chitlaru, T.; Cohen, O. Protection of vaccinated mice against pneumonic tularemia is associated with an early memory sentinel-response in the lung. Vaccine 2017, 35, 7001–7009. [Google Scholar] [CrossRef] [Scilit]
- Herrera, B.B.; Tsai, W.Y.; Brites, C.; Luz, E.; Pedroso, C.; Drexler, J.F.; Wang, W.K.; Kanki, P.J. T Cell Responses to Nonstructural Protein 3 Distinguish Infections by Dengue and Zika Viruses. MBio 2018, 9. [Google Scholar] [CrossRef] [Scilit]
- Nordberg, M.; Forsberg, P.; Nyman, D.; Skogman, B.H.; Nyberg, C.; Ernerudh, J.; Eliasson, I.; Ekerfelt, C. Can ELISPOT Be Applied to A Clinical Setting as A Diagnostic Utility for Neuroborreliosis? Cells 2012, 1, 153–167. [Google Scholar] [CrossRef] [Scilit]
- van Gorkom, T.; Sankatsing, S.U.C.; Voet, W.; Ismail, D.M.; Muilwijk, R.H.; Salomons, M.; Vlaminckx, B.J.M.; Bossink, A.W.J.; Notermans, D.W.; Bouwman, J.J.M.; et al. An ELISpot assay, measuring Borrelia burgdorferi B31-specific interferon-gamma secreting T-cells, cannot discriminate active lyme neuroborreliosis from past lyme borreliosis; a prospective study in the Netherlands. J. Clin. Microbiol. 2018. [Google Scholar] [CrossRef] [Scilit]
- Xu, X.; Vaughan, K.; Weiskopf, D.; Grifoni, A.; Diamond, M.S.; Sette, A.; Peters, B. Identifying candidate targets of immune responses in zika virus based on homology to epitopes in other flavivirus species. PLoS Curr. 2016, 8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mueller, H.; Detjen, A.K.; Schuck, S.D.; Gutschmidt, A.; Wahn, U.; Magdorf, K.; Kaufmann, S.H.; Jacobsen, M. Mycobacterium tuberculosis-specific CD4+, IFNgamma+, and TNFalpha+ multifunctional memory T cells coexpress GM-CSF. Cytokine 2008, 43, 143–148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Darrah, P.A.; Patel, D.T.; De Luca, P.M.; Lindsay, R.W.B.; Davey, D.F.; Flynn, B.J.; Hoff, S.T.; Andersen, P.; Reed, S.G.; Morris, S.L.; et al. Multifunctional TH1 cells define a correlate of vaccine-mediated protection against Leishmania major. Nat. Med. 2007, 13, 843. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hagen, J.; Zimmerman, R.; Goetz, C.; Bonnevier, J.; Houchins, J.P.; Reagan, K.; Kalyuzhny, A.E. Comparative multi-donor study of IFNgamma secretion and expression by human PBMCs using ELISPOT side-by-side with ELISA and flow cytometry assays. Cells 2015, 4, 84–95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lehmann, P.V.; Zhang, W. Unique strengths of ELISPOT for T cell diagnostics. Methods Mol. Biol. 2012, 792, 3–23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dura, B.; Dougan, S.K.; Barisa, M.; Hoehl, M.M.; Lo, C.T.; Ploegh, H.L.; Voldman, J. Profiling lymphocyte interactions at the single-cell level by microfluidic cell pairing. Nat. Commun. 2015, 6, 5940. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feske, S. Calcium signalling in lymphocyte activation and disease. Nat. Rev. Immunol. 2007, 7, 690–702. [Google Scholar] [CrossRef] [Scilit]
- Reiss, S.; Baxter, A.E.; Cirelli, K.M.; Dan, J.M.; Morou, A.; Daigneault, A.; Brassard, N.; Silvestri, G.; Routy, J.P.; Havenar-Daughton, C.; et al. Comparative analysis of activation induced marker (AIM) assays for sensitive identification of antigen-specific CD4 T cells. PloS One 2017, 12, e0186998. [Google Scholar] [CrossRef] [Scilit]
- Havenar-Daughton, C.; Reiss, S.M.; Carnathan, D.G.; Wu, J.E.; Kendric, K.; Torrents de la Peña, A.; Kasturi, S.P.; Dan, J.M.; Bothwell, M.; Sanders, R.W.; et al. Cytokine-independent detection of antigen-specific germinal center t follicular helper cells in immunized nonhuman primates using a live cell activation-induced marker technique. J. Immunol. 2016, 197, 994–1002. [Google Scholar] [CrossRef] [Scilit]
- Bowyer, G.; Rampling, T.; Powlson, J.; Morter, R.; Wright, D.; Hill, A.V.S.; Ewer, K.J. Activation-induced markers detect vaccine-specific cd4+ t cell responses not measured by assays conventionally used in clinical trials. Vaccines 2018, 6, 50. [Google Scholar] [CrossRef] [Scilit]
- Guan, N.; Deng, J.; Li, T.; Xu, X.; Irelan, J.T.; Wang, M.W. Label-free monitoring of T cell activation by the impedance-based xCELLigence system. Mol. Biosyst. 2013, 9, 1035–1043. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fasbender, F.; Watzl, C. Impedance-based analysis of Natural Killer cell stimulation. Sci. Rep. 2018, 8, 4938. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rollo, E.; Tenaglia, E.; Genolet, R.; Bianchi, E.; Harari, A.; Coukos, G.; Guiducci, C. Label-free identification of activated T lymphocytes through tridimensional microsensors on chip. Biosens. Bioelectron. 2017, 94, 193–199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Polonsky, M.; Zaretsky, I.; Friedman, N. Dynamic single-cell measurements of gene expression in primary lymphocytes: Challenges, tools and prospects. Brief. Funct. Genomics 2013, 12, 99–108. [Google Scholar] [CrossRef] [Scilit] [PubMed]






© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bar-Haim, E.; Rotem, S.; Elia, U.; Bercovich-Kinori, A.; Israeli, M.; Cohen-Gihon, I.; Israeli, O.; Erez, N.; Achdout, H.; Zauberman, A.; et al. Early Diagnosis of Pathogen Infection by Cell-Based Activation Immunoassay. Cells 2019, 8, 952. https://doi.org/10.3390/cells8090952
Bar-Haim E, Rotem S, Elia U, Bercovich-Kinori A, Israeli M, Cohen-Gihon I, Israeli O, Erez N, Achdout H, Zauberman A, et al. Early Diagnosis of Pathogen Infection by Cell-Based Activation Immunoassay. Cells. 2019; 8(9):952. https://doi.org/10.3390/cells8090952
Chicago/Turabian StyleBar-Haim, Erez, Shahar Rotem, Uri Elia, Adi Bercovich-Kinori, Ma’ayan Israeli, Inbar Cohen-Gihon, Ofir Israeli, Noam Erez, Hagit Achdout, Ayelet Zauberman, and et al. 2019. "Early Diagnosis of Pathogen Infection by Cell-Based Activation Immunoassay" Cells 8, no. 9: 952. https://doi.org/10.3390/cells8090952
APA StyleBar-Haim, E., Rotem, S., Elia, U., Bercovich-Kinori, A., Israeli, M., Cohen-Gihon, I., Israeli, O., Erez, N., Achdout, H., Zauberman, A., Aftalion, M., Mamroud, E., Chitlaru, T., & Cohen, O. (2019). Early Diagnosis of Pathogen Infection by Cell-Based Activation Immunoassay. Cells, 8(9), 952. https://doi.org/10.3390/cells8090952

