Antioxidative and Anti-Inflammatory Protective Effects of Fucoxanthin against Paracetamol-Induced Hepatotoxicity in Rats
Abstract
1. Introduction
2. Results
2.1. Fucoxanthin Reduced Liver Serum Biomarkers in PILI
2.2. FUC Modulates the Inflammatory and Oxidative Stress-Related Markers in the Serum of PILI
2.3. FUC Modulates Inflammatory- and Oxidative Stress-Related Genes in PILI
2.4. FUC Modulates Inflammatory- and Oxidative Stress-Related Proteins in PILI
2.5. FUC Modulates the Inflammatory- and Oxidative Stress-Related Proteins in PILI Tissue
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. Study Design and Treatment Protocols
4.3. Collection of Samples
4.4. Biochemical Parameter Measurement
4.5. mRNA Isolation
4.6. cDNA Synthesis
4.7. Gene Expression Using RT-PCR
4.8. Gene Expression Calculation
4.9. Liver Tissue Protein Isolation and Quantification
4.10. Immunoblotting
4.11. Enhanced Chemiluminescence Detection
4.12. Enzyme-Linked Immunosorbent Assay
4.13. Immunohistochemistry
4.14. Statistical Analysis
4.15. Ethical Approval
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Ji, M.; Deng, Z.; Rong, X.; Li, R.; You, Z.; Guo, X.; Cai, C.; Zhao, Y.; Gao, P.; Cao, G.; et al. Naringenin Prevents Oxidative Stress and Inflammation in LPS-Induced Liver Injury through the Regulation of LncRNA-mRNA in Male Mice. Molecules 2022, 28, 198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bernal, W.; Auzinger, G.; Dhawan, A.; Wendon, J. Acute liver failure. Lancet 2013, 369, 2525–2534. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Osna, N.A.; Donohue, T.M., Jr.; Kharbanda, K.K. Alcoholic Liver Disease: Pathogenesis and Current Management. Alcohol Res. Curr. Rev. 2017, 38, 147–161. [Google Scholar]
- Bower, W.A.; Johns, M.; Margolis, H.S.; Williams, I.T.; Bell, B.P. Population-based surveillance for acute liver failure. Am. J. Gastroenterol. 2007, 102, 2459–2463. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reuben, A.; Koch, D.G.; Lee, W.M. Drug induced acute liver failure: Results of a US multicenter, prospective study. Hepatology 2010, 52, 2065–2076. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alempijevic, T.; Zec, S.; Milosavljevic, T. Drug-induced liver injury: Do we know everything? World J. Hepatol. 2017, 9, 491–502. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Watkins, P.B.; Kaplowitz, N.; Slattery, J.T.; Colonese, C.R.; Colucci, S.V.; Stewart, P.W.; Harris, S.C.J.J. Aminotransferase elevations in healthy adults receiving 4 g of acetaminophen daily: A randomized controlled trial. JAMA 2006, 296, 87–93. [Google Scholar] [CrossRef] [Scilit]
- Herndon, C.M.; Dankenbring, D.M. Patient perception and knowledge of acetaminophen in a large family medicine service. J. Pain Palliat. Care Pharmacother. 2014, 28, 109–116. [Google Scholar] [CrossRef] [Scilit]
- Bunchorntavakul, C.; Reddy, K.R. Acetaminophen-related hepatotoxicity. Clin. Liver Dis. 2013, 17, 587–607. [Google Scholar] [CrossRef] [Scilit]
- Agrawal, S.; Khazaeni, B. Acetaminophen Toxicity; StatPearls Publishing: St. Petersburg, FL, USA, 2022. [Google Scholar]
- Ostapowicz, G.; Fontana, R.J.; Schiødt, F.V.; Larson, A.; Davern, T.J.; Han, S.H.; McCashland, T.M.; Shakil, A.O.; Hay, J.E.; Hynan, L.; et al. Results of a prospective study of acute liver failure at 17 tertiary care centers in the United States. Ann. Intern. Med. 2002, 137, 947–954. [Google Scholar] [CrossRef] [Scilit]
- Wendel, A.; Feuerstein, S. Drug-induced lipid peroxidation in mice—I Modulation by monooxegenase activity, glutathione and selenium status. Biochem. Pharmacol. 1981, 30, 2513–2520. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jaeschke, H.; McGill, M.R.; Ramachandran, A. Oxidant stress, mitochondria, and cell death mechanisms in drug-induced liver injury: Lessons learned from acetaminophen hepatotoxicity. Drug Metab. Rev. 2012, 44, 88–106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Du, K.; Ramachandran, A.; Weemhoff, J.L.; Chavan, H.; Xie, Y.; Krishnamurthy, P.; Jaeschke, H. Editor’s highlight: Metformin protects against acetaminophen hepatotoxicity by attenuation of mitochondrial oxidant stress and dysfunction. Toxicol. Sci. 2016, 154, 214–226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mozaffarinia, A.; Gol, A.; Mohammadzadeh, A. Hepatoprotective properties of Cuminum cyminum seeds powder as post-treatment for acetaminophen-induced acute hepatic injury. J. Adv. Med. Biomed. Res. 2023, 31, 170–176. [Google Scholar]
- Chan, J.C.Y.; Soh, A.C.K.; Kioh, D.Y.Q.; Li, J.; Verma, C.; Koh, S.K.; Beuerman, R.W.; Zhou, L.; Chan, E.C.Y. Reactive Metabolite-induced Protein Glutathionylation: A Potentially Novel Mechanism Underlying Acetaminophen Hepatotoxicity. Mol. Cell. Proteom. 2018, 17, 2034–2050. [Google Scholar] [CrossRef] [Scilit]
- Du, K.; Ramachandran, A.; Jaeschke, H. Oxidative stress during acetaminophen hepatotoxicity: Sources, pathophysiological role and therapeutic potential. Redox Biol. 2016, 10, 148–156. [Google Scholar] [CrossRef] [Scilit]
- Liu, F.C.; Lee, H.C.; Liao, C.C.; Chou, A.H.; Yu, H.P. Role of NADPH Oxidase-Derived ROS-Mediated IL-6/STAT3 and MAPK/NF-kappaB Signaling Pathways in Protective Effect of Corilagin against Acetaminophen-Induced Liver Injury in Mice. Biology 2023, 12, 334. [Google Scholar] [CrossRef] [Scilit]
- Astaraki, P.; Mahmoudi, G.A.; Mohtashami, A.Z.; Ahadi, M. N-acetylcysteine overdose after acetaminophen poisoning. Int. Med Case Rep. J. 2015, 8, 65–69. [Google Scholar] [CrossRef] [Scilit]
- Nishino, A.; Maoka, T.; Yasui, H.J.A. Preventive effects of β-cryptoxanthin, a potent antioxidant and provitamin A carotenoid, on lifestyle-related diseases—A central focus on its effects on non-alcoholic fatty liver disease (NAFLD). Antioxidants 2022, 11, 43. [Google Scholar] [CrossRef] [Scilit]
- Abenavoli, L.; Procopio, A.C.; Paravati, M.R.; Costa, G.; Milić, N.; Alcaro, S.; Luzza, F. Mediterranean diet: The beneficial effects of lycopene in non-alcoholic fatty liver disease. J. Clin. Med. 2022, 11, 3477. [Google Scholar] [CrossRef] [Scilit]
- Eid, S.Y.; Althubiti, M.A.; Abdallah, M.E.; Wink, M.; El-Readi, M.Z. The carotenoid fucoxanthin can sensitize multidrug resistant cancer cells to doxorubicin via induction of apoptosis, inhibition of multidrug resistance proteins and metabolic enzymes. Phytomedicine 2020, 77, 153280. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, H.; Mu, T.; Liu, X.; Zhang, M.; Chen, J. Purple sweet potato (Ipomoea batatas L.) anthocyanins: Preventive effect on acute and subacute alcoholic liver damage and dealcoholic effect. J. Agric. Food Chem. 2014, 62, 2364–2373. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.; Jin, Q.; Zhang, Y.; Wu, Y.-L.; Jin, C.-M.; Cui, B.-W.; Li, Y.; Jin, M.-J.; Shang, Y.; Jiang, M.; et al. Inhibition of P2X7R–NLRP3 Inflammasome Activation by Pleurotus citrinopileatus: A Possible Protective Role in Alcoholic Hepatosteatosis. J. Agric. Food Chem. 2018, 66, 13183–13190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, J.H.; Ju, J.H.; Lee, Y.S.; Park, J.H.; Yeo, I.J.; Park, M.H.; Roh, Y.S.; Han, S.B.; Hong, J.T. Astaxanthin alleviated ethanol-induced liver injury by inhibition of oxidative stress and inflammatory responses via blocking of STAT3 activity. Sci. Rep. 2018, 8, 14090. [Google Scholar] [CrossRef] [Scilit]
- Zheng, J.; Tian, X.; Zhang, W.; Zheng, P.; Huang, F.; Ding, G.; Yang, Z. Protective effects of fucoxanthin against alcoholic liver injury by activation of Nrf2-mediated antioxidant defense and inhibition of TLR4-mediated inflammation. Mar. Drugs 2019, 17, 552. [Google Scholar] [CrossRef] [Scilit]
- Shih, P.-H.; Shiue, S.-J.; Chen, C.-N.; Cheng, S.-W.; Lin, H.-Y.; Wu, L.-W.; Wu, M.-S. Fucoidan and fucoxanthin attenuate hepatic steatosis and inflammation of NAFLD through modulation of leptin/adiponectin axis. Mar. Drugs 2021, 19, 148. [Google Scholar] [CrossRef] [Scilit]
- Cheng, I.C.; Weng, S.Y.; Wu, M.S.; Suk, F.M.; Lien, G.S.; Chen, C.N. Low-molecular-weight fucoidan and high-stability fucoxanthin decrease serum alanine transaminase in patients with nonalcoholic fatty liver disease—A double-blind, randomized controlled trial. Adv. Dig. Med. 2019, 6, 116–122. [Google Scholar] [CrossRef] [Scilit]
- Abidov, M.; Ramazanov, Z.; Seifulla, R.; Grachev, S.J.D. The effects of Xanthigen™ in the weight management of obese premenopausal women with non-alcoholic fatty liver disease and normal liver fat. Diabetes Obes. Metab. 2010, 12, 72–81. [Google Scholar] [CrossRef] [Scilit]
- Zou, Y.; Zhong, L.; Hu, C.; Sheng, G. Association between the alanine aminotransferase/aspartate aminotransferase ratio and new-onset non-alcoholic fatty liver disease in a nonobese Chinese population: A population-based longitudinal study. Lipids Heal. Dis. 2020, 19, 245. [Google Scholar] [CrossRef] [Scilit]
- Li, S.; Tan, H.Y.; Wang, N.; Zhang, Z.J.; Lao, L.; Wong, C.W.; Feng, Y. The Role of Oxidative Stress and Antioxidants in Liver Diseases. Int. J. Mol. Sci. 2015, 16, 26087–26124. [Google Scholar] [CrossRef] [Scilit]
- Mühl, H. STAT3, a key parameter of cytokine-driven tissue protection during sterile inflammation–the case of experimental acetaminophen (paracetamol)-induced liver damage. Front. Immunol. 2016, 7, 163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ding, R.-B.; Tian, K.; Cao, Y.-W.; Bao, J.-L.; Wang, M.; He, C.; Hu, Y.; Su, H.; Wan, J.-B. Protective effect of panax notoginseng saponins on acute ethanol-induced liver injury is associated with ameliorating hepatic lipid accumulation and reducing ethanol-mediated oxidative stress. J. Agric. Food Chem. 2015, 63, 2413–2422. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dinarello, C.A.J.C. Proinflammatory and anti-inflammatory cytokines as mediators in the pathogenesis of septic shock. Chest 1997, 112, 321S–329S. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, C.-C.; Huang, H.-P.; Lee, Y.-J.; Tang, Y.-H.; Wang, C.-J. Hepatoprotective effect of mulberry water extracts on ethanol-induced liver injury via anti-inflammation and inhibition of lipogenesis in C57BL/6J mice. Food Chem. Toxicol. 2013, 62, 786–796. [Google Scholar] [CrossRef] [Scilit]
- Liu, S.; Tian, L.; Chai, G.; Wen, B.; Wang, B.J.F. Function, Targeting heme oxygenase-1 by quercetin ameliorates alcohol-induced acute liver injury via inhibiting NLRP3 inflammasome activation. Food Funct. 2018, 9, 4184–4193. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.; Shen, G.; Xu, L.; Liu, X.; Brown, J.M.; Feng, D.; Ross, R.A.; Gao, B.; Liangpunsakul, S.; Ju, C. IL-1 receptor like 1 protects against alcoholic liver injury by limiting NF-κB activation in hepatic macrophages. J. Hepatol. 2018, 68, 109–117. [Google Scholar] [CrossRef] [Scilit]
- Neyrinck, A.M.; Etxeberria, U.; Taminiau, B.; Daube, G.; Van Hul, M.; Everard, A.; Cani, P.D.; Bindels, L.B.; Delzenne, N.M. Rhubarb extract prevents hepatic inflammation induced by acute alcohol intake, an effect related to the modulation of the gut microbiota. Mol. Nutr. Food Res. 2017, 61, 1500899. [Google Scholar] [CrossRef] [Scilit]
- Mohammed, H.A.; Eldeeb, H.M.; Khan, R.A.; Al-Omar, M.S.; Mohammed, S.A.A.; Sajid, M.S.M.; Aly, M.S.A.; Ahmad, A.M.; Abdellatif, A.A.H.; Eid, S.Y.; et al. Sage, Salvia officinalis L. Constituents, Hepatoprotective Activity, and Cytotoxicity Evaluations of the Essential Oils Obtained from Fresh and Differently Timed Dried Herbs: A Comparative Analysis. Molecules 2021, 26, 5757. [Google Scholar] [CrossRef] [Scilit]







| Gene | Sequences |
|---|---|
| GAPDH | F: AGGTCGGTGTGAACGGATTTG R: TGTAGACCATGTAGTTGAGGTCA |
| TNF-α | F: CTCTTCTGCCTGCTGCACTTTG R: ATGGGCTACAGGCTTGTCACTC |
| IL-1β | F: GCCCTTTTGCTTCAGGGTTT R: TCCAATGTCCAGCCCATGAT |
| IL-6 | F: TTGACAGCCACTGCCTTCCC R: CGGAACTCCAGAAGACCAGAGC |
| NF-кB | F: CCTCTACACATAGCGGCTGG R: GCACCTTGGGATGCGTTTTT |
| INF-γ | F: TGCAACCCTCCTAGACTCATTCT R: CCAGCAGGGCGTCTTCCT |
| COX | F: GGTTCACCCGAGGACTGGGC R: CGCAGGTGCTCAGGGACGTG |
| iNOS | F: GAAGCGGAGACCCAAGAGA R: TCGCAAAGAGGATGGTGACT |
| GSH | F: GAAATCCCAGCGCCCTA R: CACTCACCTTCGACTTCTCTTGCT |
| IL-10 | F: CCACATGCTCCGAGAGCTGA R: TCTTCACCTGCTCCACTGCC |
| IL-22 | F: GCAGGCTTGACAAGTCCAACT R: GCCTCCTTAGCCAGCATGAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Koshak, M.F.; El-Readi, M.Z.; Elzubier, M.E.; Refaat, B.; Almaimani, R.A.; Idris, S.; Althubiti, M.; Al-Amodi, H.S.; Eid, S.Y. Antioxidative and Anti-Inflammatory Protective Effects of Fucoxanthin against Paracetamol-Induced Hepatotoxicity in Rats. Mar. Drugs 2023, 21, 592. https://doi.org/10.3390/md21110592
Koshak MF, El-Readi MZ, Elzubier ME, Refaat B, Almaimani RA, Idris S, Althubiti M, Al-Amodi HS, Eid SY. Antioxidative and Anti-Inflammatory Protective Effects of Fucoxanthin against Paracetamol-Induced Hepatotoxicity in Rats. Marine Drugs. 2023; 21(11):592. https://doi.org/10.3390/md21110592
Chicago/Turabian StyleKoshak, Maimonah Fuad, Mahmoud Zaki El-Readi, Mohamed Elzubier Elzubier, Bassem Refaat, Riyad Adnan Almaimani, Shakir Idris, Mohammad Althubiti, Hiba Saeed Al-Amodi, and Safaa Yehia Eid. 2023. "Antioxidative and Anti-Inflammatory Protective Effects of Fucoxanthin against Paracetamol-Induced Hepatotoxicity in Rats" Marine Drugs 21, no. 11: 592. https://doi.org/10.3390/md21110592
APA StyleKoshak, M. F., El-Readi, M. Z., Elzubier, M. E., Refaat, B., Almaimani, R. A., Idris, S., Althubiti, M., Al-Amodi, H. S., & Eid, S. Y. (2023). Antioxidative and Anti-Inflammatory Protective Effects of Fucoxanthin against Paracetamol-Induced Hepatotoxicity in Rats. Marine Drugs, 21(11), 592. https://doi.org/10.3390/md21110592

