Lasso Peptide Microcin J25 Effectively Enhances Gut Barrier Function and Modulates Inflammatory Response in an Enterotoxigenic Escherichia coli-Challenged Mouse Model
Abstract
1. Introduction
2. Results
2.1. Clinical Symptoms and Intestinal Inflammation
2.2. Pretreated with MccJ25 Inhibited ETEC Colonization
2.3. Pretreated with MccJ25 Improved Tissue Morphology and Decreased Permeability
2.4. Pretreated with MccJ25 Inhibited ETEC Second Infection
2.5. Pretreated with MccJ25 Improved Intestinal Epithelial Barrier Function
2.6. Pretreated with MccJ25 Activated Mitogen-Activated Protein Kinase (MAPK) and Nuclear Factor κB (NF-κB) Signaling Pathways to Regulate Inflammation
3. Discussion
4. Materials and Methods
4.1. Production of MccJ25
4.2. Preparation of ETEC Strain
4.3. Experimental Animals
4.4. Experimental Design
4.5. Clinical Symptoms and Samples Collection
4.6. Bacterial Transfer during Second Infection of ETEC
4.7. Fecal Microbiota Count
4.8. Proinflammatory Cytokines Detection and Intestinal Permeability Analysis
4.9. Pathologic Score and Tissue Morphology
4.10. qRT-PCR
4.11. Western Blotting
4.12. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
Abbreviations
| MccJ25 | microcin J25 |
| AMPs | Antimicrobial peptides |
| E. coli | Escherichia coli |
| ETEC | Enterotoxigenic E. coli |
| TNF-α | Tumor necrosis factor-α |
| IL | Interleukin |
| TJP | Tight junction protein |
| DAO | Diamine oxidase |
| DLA | D-lactate |
| CFU | Colony forming unit |
| HRP | Horse radish peroxidase |
| V | Villous height |
| C | Crypt depth |
| MAPK | Mitogen-activated protein kinase |
| NF-κB | Nuclear factor κB |
| qRT-PCR | Quantitative real-time PCR |
| BW | Body weight |
| SEM | Standard error of the mean |
| PBS | Phosphate buffer saline |
| ELISA | Enzyme-linked immunosorbent assay |
| LB | Luria–Bertani |
| IPEC-J2 | Porcine epithelial cell J2 |
| IBD | Inflammatory bowel disease |
References
- Kotlo, K.L.; Nataro, J.P.; Blackwelder, W.C.; Nasrin, D.; Farag, T.H.; Panchalingam, S.; Wu, Y.K.; Sow, S.O.; Sur, D. Burden and aetiology of diarrhoeal disease in infants and young children in developing countries (the Global Enteric Multicenter Study, GEMS): A prospective, case-control study. Lancet 2013, 382, 209–222. [Google Scholar] [CrossRef] [Scilit]
- Fairbrother, J.M.; Nadeau, É.; Gyles, C.L. Escherichia coli in postweaning diarrhea in pigs: An update on bacterial types, pathogenesis, and prevention strategies. Anim. Health Res. Rev. 2007, 6, 17–39. [Google Scholar] [CrossRef] [Scilit]
- Black, R.E. Epidemiology of travelers’ diarrhea and relative importance of various pathogens. Rev. Infect. Dis. 1990, 12, 73–79. [Google Scholar] [CrossRef] [Scilit]
- González-Pasayo, R.A.; Sanz, M.E.; Padola, N.L.; Moreira, A.R. Phenotypic and genotypic characterization of enterotoxigenic Escherichia coli isolated from diarrheic calves in Argentina. Open Vet. J. 2019, 9, 65–73. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, M.A.; Deepak, S.D.; Kumarsen, G.; Ashok, K.; Akriti, D.; Nitika, S.; Geetika, G.; Shalini, Y. Molecular characterization of diarrhoegenic Escherichia coli isolated from neonatal goat-kids. J. Anim. Res. 2019, 9, 51–59. [Google Scholar]
- Kaper, J.B.; Nataro, J.P.; Mobley, H.L. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2004, 2, 123–140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mondal, D.; Haque, R.; Sack, R.B.; Kirkpatrick, B.D.; Petri, W.A., Jr. Attribution of malnutrition to cause-specific diarrheal illness: Evidence from a prospective study of preschool children in Mirpur, Dhaka, Bangladesh. Am. J. Trop. Med. Hyg. 2009, 80, 824–826. [Google Scholar] [CrossRef] [Scilit]
- Qadri, F.; Svennerholm, A.M.; Faruque, A.S.; Sack, R.B. Enterotoxigenic Escherichia coli in developing countries: Epidemiology, microbiology, clinical features, treatment, and prevention. Clin. Microbiol. Rev. 2005, 18, 465–483. [Google Scholar] [CrossRef] [Scilit]
- Checkley, W.; Buckley, G.; Gilman, R.H.; Assis, A.M.; Guerrant, R.L.; Morris, S.S.; Mølbak, K.; Valentiner-Branth, P.; Claudio, F.; Lanata, C.F.; et al. Childhood Malnutrition and Infection Network. Multi-country analysis of the effects of diarrhoea on childhood stunting. Int. J. Epidemiol. 2008, 37, 816–830. [Google Scholar] [CrossRef] [Scilit]
- Falagas, M.W.E.; Tansarli, G.S.; Rafailidis, P.I.; Kapaskelis, A.; Vardakas, K.Z. Impact of antibiotic MIC on infection outcome in patients with susceptible gram-negative bacteria: A systematic review and meta-analysis. Antimicrob. Agents Chemother. 2012, 56, 4214–4222. [Google Scholar] [CrossRef] [Scilit]
- Cho, I.; Yamanishi, S.; Cox, L.; Methé, B.; Zavadil, J.; Li, K.; Gao, Z.; Mahana, D.; Raju, K.; Teitler, I.; et al. Antibiotics in early life alter the murine colonic microbiome and adiposity. Nature 2012, 488, 621–626. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wlodarska, M.; Willing, B.; Keeney, K.M.; Menendez, A.; Bergstrom, K.S.; Gill, N.; Russell, S.L.; Vallance, B.A.; Finlay, B.B. Antibiotic treatment alters the colonic mucus layer and predisposes the host to exacerbated Citrobacter rodentium-induced colitis. Infect. Immun. 2011, 79, 1536–1545. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yi, H.B.; Hu, W.Y.; Chen, S.; Lu, Z.Q.; Wang, Y.Z. Cathelicidin-WA improves intestinal epithelial barrier function and enhances host defense against enterohemorrhagic Escherichia coli O157:H7 infection. J. Immunol. 2017, 198, 1696–1705. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Levy, S. Antibacterial resistance worldwide: Causes, challenges and responses. Nat. Med. 2004, 10, 122–129. [Google Scholar] [CrossRef] [Scilit]
- Zasloff, M. Antimicrobial peptides of multicellular organisms. Nature 2002, 415, 389–395. [Google Scholar] [CrossRef] [Scilit]
- Hancock, R.E.W.; Sahl, H. Antimicrobial and host-defense peptides as new anti-infective therapeutic strategies. Nat. Biotechnol. 2006, 24, 1551–1557. [Google Scholar] [CrossRef] [Scilit]
- Spellberg, B.; Powers, J.H.; Brass, E.P. Trends in antimicrobial drug development: Implications for the future. Clin. Infect. Dis. 2004, 38, 1279–1286. [Google Scholar] [CrossRef] [Scilit]
- Mukherjee, S.; Hooper, L.V. Antimicrobial defense of the intestine. Immunity 2015, 42, 28–39. [Google Scholar] [CrossRef] [Scilit]
- Forkus, B.; Ritter, S.; Vlysidis, M.; Geldart, K.; Kaznessis, Y. Antimicrobial probiotics reduce Salmonella enterica in turkey gastrointestinal tracts. Sci. Rep. 2017, 7, 40695. [Google Scholar] [CrossRef] [Scilit]
- Sassone-Corsi, M.; Nuccio, S.; Liu, H.; Hernandez, D.; Vu, C.; Takahashi, A.; Edwards, R.; Raffatellu, M. Microcins mediate competition among Enterobacteriaceae in the inflamed gut. Nature 2016, 540, 280–283. [Google Scholar] [CrossRef] [Scilit]
- Rebuffat, S. Microcins in action: Amazing defence strategies of enterobacteria. Biochem. Soc. Trans. 2012, 40, 1456–1462. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Salomon, R.A.; Farias, R. Microcin-25, a novel antimicrobial peptide produced by Escherichia coli. J. Bacteriol. 1992, 174, 7428–7435. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rebuffat, S.; Blond, A.; Destoumieux-Garzon, D.; Goulard, C.; Peduzzi, J. Microcin J25, from the macrocyclic to the lasso structure: Implications for biosynthetic, evolutionary and biotechnological perspectives. Curr. Protein Pept. Sci. 2004, 5, 383–391. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Blond, A.; Peduzzi, J.; Goulard, C.; Chiuchiolo, M.; Barthelemy, M.; Prigent, Y.; Salomon, R.; Farias, R.; Moreno, F.; Rebuffat, S. The cyclic structure of microcin J25, a 21-residue peptide antibiotic from Escherichia coli. Eur. J. Biochem. 1999, 259, 747–755. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ferguson, A.L.; Zhang, S.Y.; Dikiy, I.; Panagiotopoulos, A.Z.; Debenedetti, P.G.; Link, A.J. An experimental and computational investigation of spontaneous lasso formation in microcin J25. Biophys. J. 2010, 99, 3056–3065. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bellomio, A.; Vincent, P.A.; de Arcuri, B.; Farías, R.N.; Morero, R.D. Microcin J25 has dual and independent mechanisms of action in Escherichia coli: RNA polymerase inhibition and increased superoxide production. J. Bacteriol. 2007, 189, 4180–4186. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lopez, F.E.; Vincent, P.; Zenoff, A.; Salomon, R.; Farias, R. Efficacy of microcin J25 in biomatrices and in a mouse model of salmonella infection. J. Antimicrob. Chemother. 2007, 59, 676–680. [Google Scholar] [CrossRef] [Scilit]
- Pan, S.J.; Cheung, W.L.; Link, A.J. Engineered gene clusters for production of antimicrobial peptide microcin J25. Protein Expr. Purif. 2010, 71, 200–206. [Google Scholar] [CrossRef] [Scilit]
- Cao, J.C.; Fuente-Nunez, C.D.L.; Ou, R.W.; Torossian, T.M.D.; Santosh, G.; Pande, S.G.; Sinskey, A.J.; Lu, T.K. Yeast-based synthetic biology platform for antimicrobial peptide production. ACS Synth. Biol. 2018, 7, 896–902. [Google Scholar] [CrossRef] [Scilit]
- Chen, X.; Zhu, F.M.; Cao, Y.H.; Qiao, S.Y. Novel expression vector for secretion of Ceropin AD in Bacillus subtilis with enhanced antimicrobial activity. Antimicrob. Agents Chemother. 2009, 53, 3683–3689. [Google Scholar] [CrossRef] [Scilit]
- Herbel, V.; Schäfer, H.; Wink, M. Recombinant production of Snakin-2 (an antimicrobial peptide from tomato) in E. coli and analysis of its bioactivity. Molecules 2015, 20, 14889–14901. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wei, X.B.; Wu, R.J.; Zhang, L.L.; Ahmad, B.; Si, D.Y.; Zhang, R.J. Expression, purification, and characterization of a novel hybrid peptide with potent antibacterial activity. Molecules 2018, 23, 1491. [Google Scholar] [CrossRef] [Scilit]
- Yu, H.T.; Shang, L.J.; Zeng, X.F.; Li, N.; Liu, H.B.; Cai, S.; Huang, S.; Wang, G.; Wang, Y.M.; Song, Q.L.; et al. Risks related to high-dosage recombinant antimicrobial peptide microcin J25 in mice Model: Intestinal microbiota, intestinal barrier function and immune regulation. J. Agric. Food Chem. 2018, 66, 11301–11310. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, H.T.; Ding, X.L.; Shang, L.J.; Zeng, X.F.; Liu, H.B.; Li, N.; Huang, S.; Wang, Y.M.; Wang, G.; Cai, S.; et al. Protective ability of biogenic antimicrobial peptide microcin J25 against enterotoxigenic Escherichia coli-induced intestinal epithelial dysfunction and inflammatory responses IPEC-J2 cells. Front. Cell. Infect. Microbiol. 2018, 8, 242. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wilson, J.C.; Furlano, R.; Jick, S.; Meier, C. Inflammatory bowel disease and the risk of autoimmune diseases. J. Crohns Colitis 2016, 10, 186–193. [Google Scholar] [CrossRef] [Scilit]
- Kaser, A.; Zeissig, S.; Blumberg, R. Inflammatory bowel disease. Annu. Rev. Immunol. 2010, 28, 573–621. [Google Scholar] [CrossRef] [Scilit]
- Cosnes, J.; Gower-Rousseau, C.; Seksik, P.; Cortot, A. Epidemiology and natural history of inflammatory bowel diseases. Gastroenterology 2011, 140, 1785–1794. [Google Scholar] [CrossRef] [Scilit]
- Koboziev, I.; Reinoso, W.; Furr, K.; Grisham, M. Role of the enteric microbiota in intestinal homeostasis and inflammation. Free Radic. Biol. Med. 2014, 68, 122–133. [Google Scholar] [CrossRef] [Scilit]
- Sekirov, I.; Russell, S.; Antunes, L.; Finlay, B. Gut microbiota in health and disease. Physiol. Rev. 2010, 90, 859–904. [Google Scholar] [CrossRef] [Scilit]
- Shah, N.; DuPont, H.L.; Ramsey, D.J. Global etiology of traveler’s diarrhea: Systemic review from 1973 to the present. Am. J. Trop. Med. Hyg. 2009, 80, 609–614. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, I.; Roy, B.; Khan, S.; Septer, S.; Umar, S. Microbiome, metabolome and inflammatory bowel disease. Microorganisms 2016, 4, 20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, S.; Wang, Q.W.; Zeng, X.F.; Ye, Q.H.; Huang, S.; Yu, H.T.; Yang, T.R.; Qiao, S.Y. Use of the antimicrobial peptide Sublancin with combined antibacterial and immunomodulatory activities to protect against methicillin-resistant Staphylococcus aureus infection in mice. J. Agric. Food Chem. 2017, 65, 8595–8605. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, Y.H.; Han, F.F.; Huang, X.; Rong, Y.L.; Yi, H.B.; Wang, Y.Z. Changes in gut microbial populations, intestinal morphology, expression of tight junction proteins, and cytokine production between two pig breeds after challenge with Escherichia coli K88: A comparative study. J. Anim. Sci. 2013, 91, 5614–5625. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xia, X.; Zhang, L.; Wang, Y.Z. The antimicrobial peptide cathelicidin-BF could be a potential therapeutic for Salmonella typhimurium infection. Microbiol. Res. 2015, 171, 45–51. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, G.Y.; Yu, J.; Su, J.H.; Jiao, L.G.; Liu, X.; Zhu, Y.H. Oral Administration of Lactobacillus rhamnosus GG ameliorates Salmonella infantis-induced inflammation in a pig model via activation of the IL-22BP/IL-22/STAT3 pathway. Front. Cell. Infect. Microbiol. 2017, 7, 323. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ursell, L.K.; Clemente, J.C.; Rideout, J.R.; Gevers, D.; Caporaso, J.G.; Knight, R. The interpersonal and intrapersonal diversity of human-associated microbiota in key body sites. J. Allergy. Clin. Immunol. 2012, 129, 1204–1208. [Google Scholar] [CrossRef] [Scilit]
- Clemente, J.C.; Ursell, L.K.; Parfrey, L.W.; Knight, R. The impact of the gut microbiota on human health: An integrative view. Cell 2012, 148, 1258–1270. [Google Scholar] [CrossRef] [Scilit]
- Sansonetti, P.J. Host-bacteria homeostasis in the healthy and inflamed gut. Curr. Opin. Gastroenterol. 2008, 24, 435–439. [Google Scholar] [CrossRef] [Scilit]
- Cario, E. Innate immune signalling at intestinal mucosal surfaces: A fine line between host protection and destruction. Curr. Opin. Gastroenterol. 2008, 24, 725–732. [Google Scholar] [CrossRef] [Scilit]
- Feng, T.; Elson, C.O. Adaptive immunity in the host-microbiota dialog. Mucosal. Immunol. 2011, 4, 15–21. [Google Scholar] [CrossRef] [Scilit]
- Gensollen, T.; Iyer, S.S.; Kasper, D.L.; Blumberg, R.S. How colonization by microbiota in early life shapes the immune system. Science 2016, 352, 539–544. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heazlewood, C.K.; Cook, M.C.; Eri, R.; Price, G.R.; Tauro, S.B.; Taupin, D.; Thornton, D.J.; Png, C.W.; Ceockford, T.L.; Cornall, R.J.; et al. Aberrant mucin assembly in mice causes endoplasmic reticulum stress and spontaneous infammation resembling ulcerative colitis. PLoS Med. 2008, 5, e54. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, M.; Zhang, B.; Yu, C.; Li, J.; Zhang, L.; Sun, H.; Gao, F.; Zhou, G. L-Glutamate supplementation improves small intestinal architecture and enhances the expressions of jejunal mucosa amino acid receptors and transporters in weaning piglets. PLoS ONE 2014, 9, E111950. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, Y.Y.; Liu, M.L.; He, X.D.; Jiang, C.Q.; Liu, R.L. Functional changes of intestinal mucosal barrier in surgically critical patients. World J. Emerg. Med. 2010, 1, 205–208. [Google Scholar] [PubMed]
- Rong, Y.L.; Lu, Z.Q.; Zhang, H.W.; Zhang, L.; Song, D.G.; Wang, Y.Z. Effects of casein glycomacropeptide supplementation on growth performance, intestinal morphology, intestinal barrier permeability and inflammatory responses in Escherichia coli K88 challenged pigs. Anim. Nutr. 2015, 1, 54–59. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, L.; Luo, L.; Jia, W.K.; Xiao, J.; Huang, G.; Tian, G.; Li, J.W.; Xiao, Y.B. Serum diamine oxidase as a hemorrhagic shock biomarker in a rabbit model. PLoS ONE 2014, 9, E10228. [Google Scholar] [CrossRef] [Scilit]
- Hayden, M.S.; Ghosh, S. Signaling to NF-kappa B. Genes Dev. 2004, 18, 2195–2224. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.L.; Wei, X.B.; Zhang, R.J.; Petitte, J.N.; Si, D.Y.; Li, Z.X.; Cheng, J.H.; Du, M.S. Design and development of a novel peptide for treating intestinal inflammation. J. Immunol. 2019, 10, 1841. [Google Scholar] [CrossRef] [Scilit]
- Yi, H.B.; Yu, C.H.; Zhang, H.W.; Song, D.G.; Jiang, D.H.; Du, H.H.; Wang, Y.Z. Cathelicidin-BF suppresses intestinal inflammation by inhibiting the nuclear factor-κB signaling pathway and enhancing the phagocytosis of immune cells via STAT-1 in weanling piglets. Int. Immunopharmacol. 2015, 28, 61–69. [Google Scholar] [CrossRef] [Scilit]
- Zhang, D.; Cheng, L.; Huang, X.; Shi, W.; Xiang, J.; Gan, H. Tetrandrine ameliorates dextran-sulfate-sodium-induced colitis in mice through inhibition of nuclear factor-kappa B activation. Int. J. Colorectal. Dis. 2009, 24, 5–12. [Google Scholar] [CrossRef] [Scilit]
- Wang, Q.; Guo, X.L.; Wells-Byrum, D.; Noel, G.; Pritts, T.A.; Ogle, C.K. Cytokine-induced epithelial permeability changes are regulated by the activation of the p38 mitogen-activated protein kinase pathway in cultured Caco-2 cells. Shock 2008, 29, 531–537. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nijnik, A.; Hancock, R.E.W. The roles of cathelicidin LL-37 in immune defences and novel clinical applications. Curr. Opin. Hematol. 2009, 16, 41–47. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ling, K.H.; Wan, M.L.Y.; El-Nezami, H.N.; Wang, M.F. Protective capacity of resveratrol, a natural polyphenolic compound, against deoxynivalenol-induced intestinal barrier dysfunction and bacterial translocation. Chem. Res. Toxicol. 2016, 29, 823–833. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Y.P.; Zhu, C.; Chen, Z.; Chen, Z.J.; Zhang, W.N.; Ma, X.Y.; Wang, L.; Yang, X.F.; Jiang, Z.Y. Protective effects of Lactobacillus plantarum on epithelial barrier disruption caused by enterotoxigenic Escherichia coli in intestinal porcine epithelial cells. Vet. Immunol. Immunopathol. 2016, 172, 55–63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, L.Y.; Li, N.; Caicedo, R.; Neu, J. Alive and dead Lactobacillus rhamnosus GG decrease tumor necrosis factor-α induced interleukin-8 production in caco-2 cells. J. Nutr. 2005, 135, 1752–1756. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pizarro-Guajardo, M.; Díaz-González, F.; Álvarez-Lobos, M.; Paredes-Sabja, D. Characterization of chicken IgY specific to Clostridium difficile R20291 spores and the effect of oral administration in mouse models of initiation and recurrent disease. Front. Cell. Infect. Microbiol. 2017, 7, 365. [Google Scholar] [CrossRef] [Scilit]











| Genes | Orientation | Sequence (5′-3′) | Size (bp) | NCBI Gene ID |
|---|---|---|---|---|
| GAPDH | Forward | GAGAAACCTGCCAAGTATGATGAC | 212 | NM_017008.3 |
| Reverse | TAGCCGTATTCATTGTCATACCAG | |||
| TNF-α | Forward | CCACGCTCTTCTGTCTACTG | 169 | NM_010851.2 |
| Reverse | ACTTGGTGGTTTGCTACGAC | |||
| IL-6 | Forward | GAGTCACAGAAGGAGTGGCTAAGGA | 106 | NM_031168.1 |
| Reverse | CGCACTAGGTTTGCCGAGTAGATCT | |||
| IL-1β | Forward | GGACAGCCTGTTACTACCTGACACATT | 239 | NM_031512 |
| Reverse | CCTAGGAAACAGCAATGGTCGGGAC | |||
| IL-22 | Forward | GACAGGTTCCAGCCCTACAT | 166 | NM_016971.1 |
| Reverse | TCGCCTTGATCTCTCCACTC | |||
| TLR4 | Forward | GTTTGCTCAGGATTCGAGGC | 160 | AF185285.1 |
| Reverse | CCGTCGTGTAGTCTGTCTCGTA | |||
| NF-κB | Forward | CCTTCCGCAAACTCAGCTTT | 173 | NM_008689.2 |
| Reverse | GGACGATGCAATGGACTGTC | |||
| Claudin-1 | Forward | GCTGGGTTTCATCCTGGCTTCT | 110 | NM_016674.4 |
| Reverse | CCTGAGCGGTCACGATGTTGTC | |||
| Occludin | Forward | GTGGTAACTTGGAGGCGTCTTC | 102 | NM_001163647.2 |
| Reverse | CCGTCGTGTAGTCTGTCTCGTA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ding, X.; Yu, H.; Qiao, S. Lasso Peptide Microcin J25 Effectively Enhances Gut Barrier Function and Modulates Inflammatory Response in an Enterotoxigenic Escherichia coli-Challenged Mouse Model. Int. J. Mol. Sci. 2020, 21, 6500. https://doi.org/10.3390/ijms21186500
Ding X, Yu H, Qiao S. Lasso Peptide Microcin J25 Effectively Enhances Gut Barrier Function and Modulates Inflammatory Response in an Enterotoxigenic Escherichia coli-Challenged Mouse Model. International Journal of Molecular Sciences. 2020; 21(18):6500. https://doi.org/10.3390/ijms21186500
Chicago/Turabian StyleDing, Xiuliang, Haitao Yu, and Shiyan Qiao. 2020. "Lasso Peptide Microcin J25 Effectively Enhances Gut Barrier Function and Modulates Inflammatory Response in an Enterotoxigenic Escherichia coli-Challenged Mouse Model" International Journal of Molecular Sciences 21, no. 18: 6500. https://doi.org/10.3390/ijms21186500
APA StyleDing, X., Yu, H., & Qiao, S. (2020). Lasso Peptide Microcin J25 Effectively Enhances Gut Barrier Function and Modulates Inflammatory Response in an Enterotoxigenic Escherichia coli-Challenged Mouse Model. International Journal of Molecular Sciences, 21(18), 6500. https://doi.org/10.3390/ijms21186500
