Next Article in Journal
Potential Role of Lauric Acid in Milk Fat Synthesis in Chinese Holstein Cows Based on Integrated Analysis of Ruminal Microbiome and Metabolome
Previous Article in Journal
Music and Emotions in Non-Human Animals from Biological and Comparative Perspectives
Previous Article in Special Issue
The Supplementation of Berberine in High-Carbohydrate Diets Improves Glucose Metabolism of Tilapia (Oreochromis niloticus) via Transcriptome, Bile Acid Synthesis Gene Expression and Intestinal Flora
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 14
Issue 10
10.3390/ani14101492
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Five Dietary Carbohydrate Sources on Growth, Glucose Metabolism, Antioxidant Capacity and Immunity of Largemouth Bass (Micropterus salmoides)

by
Pengcheng Qian
,
Yan Liu
*,
Hao Zhang
,
Penghui Zhang
,
Yuanyuan Xie
and
Chenglong Wu
*
National-Local Joint Engineering Laboratory of Aquatic Animal Genetic Breeding and Nutrition (Zhejiang), Huzhou University, 759 East 2nd Road, Huzhou 313000, China
*
Authors to whom correspondence should be addressed.
Animals 2024, 14(10), 1492; https://doi.org/10.3390/ani14101492
Submission received: 22 April 2024 / Revised: 15 May 2024 / Accepted: 16 May 2024 / Published: 17 May 2024
(This article belongs to the Special Issue Advances in Functional Diets and Culture Conditions in Fish: Applications in Aquaculture)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

Carbohydrate utilization is closely associated with level, chemical structure or processing method. Selecting an optimal carbohydrate source needs to take into consideration all these factors. This study investigated the effects of different carbohydrate sources, including monosaccharide and gelatinized or ungelatinized polysaccharide starch, on growth performance, hepatic glucose metabolism, antioxidant capacity, and immunity in juvenile largemouth bass. The results showed that dietary starch exhibited better growth performance independent of gelatinization. Ungelatinized potato starch was proved to be the more effective carbohydrate source for increasing hepatic glycolysis and ungelatinized tapioca starch better improved antioxidant and immune capacities. This study provides new information for selecting carbohydrate sources in artificial feed and helps improve fish health in farmed largemouth bass.

Abstract

This study investigated the effects of glucose (GLU), tapioca starch (TS), gelatinized tapioca starch (GTS), potato starch (PS) and gelatinized potato starch (GPS) on growth and physiological responses in juvenile largemouth bass Micropterus salmoides. After 8 weeks, fish fed with starch diets had better weight gain and growth rates. Counts of red blood cells and monocytes were increased in the PS and GPS groups, compared to GLU group. Contents of serum triglyceride and total cholesterol were markedly elevated in the TS, PS and GPS groups. There were lower levels of serum glucose, insulin and cholecystokinin, and higher agouti-related peptide contents in the PS group compared to GLU group. PS and GPS could enhance glycolysis and TCA cycle by increasing their enzyme activities and transcriptional levels. Additionally, starch sources markedly heightened mRNA levels of key genes involved in the respiratory electron transport chain. Additionally, elevated mRNA levels of key antioxidant genes were shown in the TS and GTS groups. Moreover, TS and PS could promote immunity by upregulating transcriptional levels of the complement system, lysozyme and hepcidin. Taken together, starch exhibited better growth via increasing glycolysis and TCA cycle compared with GLU, and PS could improve antioxidant and immune capacities in largemouth bass.

1. Introduction

Carbohydrate is one of the most important energy sources and has been widely applied in aquatic animal diets due to its low cost. Increasing its proportion appropriately could ultimately spare protein for growth in diets [1,2,3]. Additionally, carbohydrate is used as important binders to increase the physical quality of feed pellets and help to shape particles [4]. The existing research reveals that the appropriate amount of carbohydrate promotes growth, feed utilization, digestive and metabolic function, and immune responses in fish [1,3]. The recommended carbohydrate addition is generally lower for carnivorous fish than for herbivorous and omnivorous fish in order to achieve these beneficial effects [1,5]. Conversely, excessive carbohydrate causes a series of negative effects, such as reduced growth, energy metabolism disturbance and defense system imbalance [2,5]. Therefore, the optimal carbohydrate content for the growth, metabolism, and immunity in farmed animals has long attracted the attention of many researchers.
Besides the supplementary level, the effects of dietary carbohydrate on fish health largely depend on its structure and processing technology [4,6,7]. Dietary carbohydrate can be categorized in three types, monosaccharide, disaccharide and polysaccharide, according to their chemical structure. In fact, starch polysaccharide is naturally the most widely distributed and the most common form of carbohydrate in diets [6]. In aquatic feeds, starch is an abundant source of polysaccharide, including tapioca starch, corn starch, potato starch, etc. These starch sources have lower amylose content and higher amylopectin content, which are also used as a better mucoadhesive polymer for producing feeds due to a high swelling power [8,9]. These attractive characteristics make them applied extensively in the feed industry. Health and growth-improving effects of tapioca and potato starch have been demonstrated in Barramundi Lates calcarifer, and Olive flounder Paralichthys olivaceus [10,11,12]. More recent studies have found that the utilization of carbohydrate sources in farmed animals varies with processing methods [8,13]. Among these processing parameters, the gelatinization degree has the greatest influence on carbohydrate absorption and digestion in animals [8]. Generally, gelatinized starch sources have higher digestibility compared to raw starch, because native starch after gelatinization treatment exhibits the functional properties, especially increasing metabolic activities in animals [13]. However, most studies in fish focus on one aspect of carbohydrate and comparatively study the impact of its level or molecular structure or gelatinization on growth and physiological responses in fish [10,14,15,16]. In fact, all aspects, including hematological variations, serum biochemical parameters and hormones, glucose metabolism, antioxidant and immune capabilities, need to be comprehensively considered to find an appropriate carbohydrate source for improving growth and health in different animals. Therefore, a further systematic study of the selection of carbohydrate in feeds is needed.
Micropterus salmoides, commonly known as largemouth bass, has a great economic value in the Chinese market. In recent years, the production of largemouth bass has expanded rapidly due to its fast growth rate, strong adaptability, and high nutritional value [17]. More high-quality compound feeds will be needed to meet the rising production of largemouth bass. However, nutritional requirements are still incomplete for this species. Although a certain amount of carbohydrate is required for the formation of pellets, further investigation is still necessary to determine which kind of carbohydrate sources are beneficial for improving growth, glucose metabolism and hepatic health of largemouth bass. Thus, this study was conducted to comprehensively investigate the physiological and metabolic responses of largemouth bass fed with five kinds of carbohydrate sources: monosaccharide (glucose) and polysaccharide (tapioca starch, gelatinized tapioca starch, potato starch and gelatinized potato starch). The optimal carbohydrate source in diets was selected by evaluating growth performance, serum biochemical parameters, glucose metabolism, antioxidant capacity and immune function. The results provide new insights for the development of artificial composite feeds for largemouth bass.

2. Materials and Methods

2.1. Animals and Diets Preparation

Juvenile largemouth bass were purchased from Deqing Longshengli Breeding farm (Huzhou, China). Before the feeding experiment, all fish were first acclimated to indoor culture settings and given a commercial diet in glass tanks with a capacity of 1000 L for a period of 2 weeks. Five isoprotein and isolipidic experimental diets were made at the National-Local Joint Engineering Laboratory of Aquatic Animal Genetic Breeding and Nutrition (Huzhou, China). Tapioca starch (TS), gelatinized tapioca starch (GTS), potato starch (PS), and gelatinized potato starch (GPS) were selected as starch sources. Glucose (GLU) was used as a control energy source in this study. The composition and nutrient levels of the experimental diets are shown in Table 1. The raw materials in diets were passed through a 60-mesh sieve and subsequently transformed into hard pellet feed with a diameter of 1.5 mm. Finally, the experimental diets were stored in the freezer at −20 °C.
A total of 375 fish (initial body weight: 10.0 ± 0.02 g) were randomly assigned to 5 groups in a closed circulating water system with triplicate allocations, each tank with a volume of 500 L containing 25 fish. All fish were provided with the experimental diets described above, which were administered at 3–4% of fish body weight twice daily (08:00 and 17:30), for 8 weeks. The temperature of the culture water was kept within the range of 26.5–28.5 °C, with a pH level between 6.8 and 7.3, and a dissolved oxygen concentration above 5.2 mg/L.

2.2. Sample Collection

After the feeding trial, all fish were fasted for 24 h. The fish were initially anesthetized according to the information outlined in a previous study [17]. They were then weighted and measured for subsequent growth parameters [15,16,17]. Blood samples were first taken from the tail vein of 15 fish for next blood cell identification and counting. Then, the remaining blood samples were centrifugated at 4 g °C and 3000× g for 10 min to collect serum samples and detect serum biochemical indexes. Livers of the 15 fish in each glass tank were collected, sampled and quick frozen in liquid nitrogen and stored at −80 °C for further use. Another 3 fish from each glass tank were chosen for whole body composition analysis and stored at −20 °C.

2.3. Serum Cell Counting and Biochemical Indexes

Blood cell identification and counting were conducted using a TEK 8500 VET automatic blood analyzer (Tekang Technology, Nanchang, China) following methods described by Wu et al. [18]. Metabolite contents and enzyme activities in the serum samples were detected on C400n automated hematology analyzer (Shenzhen, China) according to the corresponding instructions described by Yang et al. [17]. The contents variation of hormones modulating glucose metabolism and appetite in the serum samples were also measured using the commercial detecting kits (Jiancheng Biotech Co., Nanjing, China) following their corresponding instructions.

2.4. Determination of Hepatic Enzyme Activities about Glucose Metabolism

The 10 mM PBS solution (pH 7.4) was added to the liver samples and then homogenated in ice. After the homogenates were centrifuged at 3000× g for 20 min at 4 °C, the liquid supernatant samples were collected and kept at a temperature of −80 °C until it was ready to be examined. The quantification of protein was conducted using the Bradford method [19]. The activities of key enzymes related to glycolysis, tricarboxylic acid cycle (TCA), and glycogen synthesis in the liver samples were determined using diagnostic kits from Jiancheng Biotech Co. (Nanjing, China). The activities of glycogen phosphorylase (GPase) and glycogen branching enzyme (GBE) were assessed using enzyme-linked immunosorbent assay (ELISA) kits from Jiancheng Biotech Co. (Nanjing, China) and Comin Biotech Co. (Suzhou, China), respectively.

2.5. RNA Extraction and Analysis of Gene Expression

The total RNA in liver was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA). Subsequently, cDNA samples were generated using the RT-PCR kit (Monad Biotech, Wuhan, China), following the protocol published previously [17]. Furthermore, all cDNA samples were kept at −80 °C for further real-time quantitative PCR detection and analysis. The primers used in the present study of genes involved in glucose metabolism, antioxidative response and immunity were listed in Table 2. β-actin and EF1α were both served as internal reference genes. Real-time PCR amplification was carried out in a volume of 25 μL with 12.5 μL of 2×SYBR Green Real-time PCR Master Mix (Takara, Dalian, China), 2 μL of cDNA mixture and 0.2 mmol each of primers. The real-time PCR temperature profile for the genes was 95 °C for 5 min followed by 35 cycles of 10 s at 95 °C, 15 s at TM (Table 2) and 40 s at 72 °C. After the amplification cycle of real-time PCR, the melting curves were systematically monitored (65 °C temperature gradient at 0.05 °C/10 s from 65 to 95 °C). Each sample was run in triplicate and the relative expression levels of the target genes were calculated using the 2−ΔΔCT method [20].

2.6. Statistical Processing

The results were presented as mean ± standard deviation (SD). All data were first checked for data normality and homoscedasticity, and then underwent one-way analysis of variance (ANOVA) using SPSS 26.0. Tukey’s multiple range test was selected for the multiple comparisons among all the groups.

3. Results

3.1. Growth and Body Composition

The growth performance of largemouth bass fed different carbohydrate sources is shown in Table 3. Dietary carbohydrate sources did not affect SR (p > 0.05), but significantly changed the growth parameters of largemouth bass (p < 0.05). Fish had higher WG and SGR fed TS, GTS, PS and GPS diets, compared to the GLU diet (p < 0.05). However, the lower FCR was only observed in fish fed the GPS diet (p < 0.05). The lower VSI level was shown in the PS group compared to the GTS group (p < 0.05). Although there were no significant differences in the values of HSI among the GLU, GTS, and GPS groups (p > 0.05), the three groups had higher HSI than the TS and PS groups (p < 0.05). The GLU diet significantly decreased the CF value, which was lower than the other four diets (p < 0.05). The contents of moisture, crude lipid and ash in the whole body were comparable among the five groups (Table 3). However, the crude protein contents of the whole body in fish fed the TS and PS diets were significantly higher compared to the GLU diet (p < 0.05).

3.2. Blood Cell Indexes and Serum Biochemical Indices

The counts of WBC and MON were lower in the GLU group than those in the PS and GPS groups (p < 0.05) (Table 4). The lowest and the highest RBC counts were shown in the GLU group and the TS group, respectively (p < 0.05). Although intermediate RBC counts were mainly shown in the GTS, PS, and GPS groups, no marked differences were observed among the starch groups (p > 0.05). In addition, there were higher values of HGB and PLT and lower levels of MCV and NEU in the TS group compared to the GLU group (p < 0.05). There were no differences in the values of HGB and MCV among the GLU, GTS, PS and GPS groups (p > 0.05). The significantly lowest count of PLT was shown in the PS group compared to the TS, GTS, and GPS groups (p < 0.05). The lowest NEU counts were presented in the TS and GTS groups compared to the GLU, PS and GPS groups (p < 0.05). Moreover, the lowest LYM count and the highest EOS count were both presented in the GPS group compared to the GLU, TS, and GTS groups (p < 0.05). The values of HCT were not influenced by dietary carbohydrate sources (p > 0.05).
The levels of HDL-C and TG were markedly decreased in the serum of the GLU group, whereas their levels were significantly increased in the serum of the TS, GTS, PS and GPS groups (p < 0.05) (Table 5). In addition, dietary TS, GTS and PS significantly reduced the LDL-C contents, compared to dietary GLU (p < 0.05). TC contents were markedly increased in the TS, PS, and GPS groups compared to the GLU group (p < 0.05), and there were no significant differences between the GLU and GTS groups (p > 0.05). Dietary GLU increased the AST activities, compared to GTS, PS and GPS diets. Fish fed the PS diet had the lowest glucose level in serum than the other four diets, accompanied by a significant decrease in INS content (p < 0.05). The lowest GC content was shown in the GLU group compared to the TS, GTS, PS, and GPS groups (p < 0.05), although there were no significant differences in the GC levels among the four starch groups (p > 0.05). Dietary carbohydrate sources significantly affected levels of serum hormones involved in metabolic and appetite indices (p < 0.05). In GLU-fed fish, the concentrations of CCK were observably elevated, compared to the other four groups (p < 0.05). Conversely, the level of AGRP was largely reduced by the GLU diet (p < 0.05) (Table 5).

3.3. Hepatic Enzyme Activities Related to Glucose Metabolism

PS diet significantly increased the HK, PK and MDH activities, and the acetyl CoA content (p < 0.05) (Table 6). The effects of the GPS diet on the parameters above are similar to those of the PS diet, except that the values of HK and MDH were lower than the PS diet (p < 0.05). In contrast, fish fed the GLU diet displayed lower activities and content of HK, PFK, IDH and MDH, and the acetyl CoA. Dietary carbohydrate sources also changed glycogen contents and related enzyme activities. Fish fed the GLU and GPS diets exhibited higher glycogen levels than the TS diet (p < 0.05). Meanwhile, the GPS group had the highest GCS and GBE activities, and an intermediate GCS value was shown in the GLU group (p < 0.05). Glycogenolytic enzyme activity (GPa) is independent of carbohydrate sources in diets and no significant difference was found in the GPa among the five groups (p > 0.05) (Table 6).

3.4. Relative Expression of Genes Involved in Glucose Metabolism

Dietary PS significantly upregulated the expressions of genes including HK, MPC2, CS and MDH, while the increased expressions of IDH and PFK were found in the GTS diet (p < 0.05) (Figure 1). Furthermore, fish fed the GPS diet showed dramatically higher transcriptional levels of GYG1, GCS and GBE (p < 0.05) (Figure 2). The GTS group had a similar gene expression pattern in glycogen synthesis as the GPS group, whose expression were comparable between the two groups. Notably, the abilities of GLU diet to activate glycolysis, tricarboxylic acid cycle and glycogen synthesis was less than that of the other diets, which had lower mRNA levels of HK, PFK, PK, MPC2, PDHx, IDH, MDH, GYG1, GYG2, UGPa and GBE (p < 0.05) (Figure 1 and Figure 2).

3.5. Relative Expression of Genes in the Respiratory Electron Transport Chain

Polysaccharide-starch sources significantly heightened the expression variations of NDUfa1, ND2, SDHb, SDHc, and ATP6 compared with dietary GLU (p < 0.05) (Figure 3). In addition, the expression levels of ND1 were notably increased in fish fed with TS and PS diets, although there were no marked differences among the fish fed with GLU, GTS and GPS diets (p > 0.05). Higher levels of COX1 and COX3 were shown in the TS, GTS and PS groups compared with the GLU group (p < 0.05), while there were no differences between the GLU and GPS groups (p > 0.05) (Figure 3).

3.6. Relative Expression of Genes Involved in Antioxidant and Immune Capability

The expressions of antioxidant enzyme genes including Cu/Zn-SOD, Mn-SOD, CAT, GPX1b, GPX7, and GR in the TS and GTS groups were markedly elevated, compared to the GLU group (p < 0.05) (Figure 4). There was a similar trend in the expressions of the genes, including Cu/Zn-SOD, Mn-SOD, CAT and GPX1b in the PS group. Higher mRNA levels of Nrf2 were found in the PS group compared to the GLU and GPS groups (p < 0.05), while there were higher mRNA levels of Keap1b in the GLU group compared to the GPS group (p < 0.05). Notably, dietary GTS and GPS remarkedly upregulated the expression of GSS (p < 0.05). Additionally, the significantly higher mRNA levels of C3, C4, C8a, C8b, C8g, LYZ and Hepc were observed in the TS and PS groups compared to the GLU group (p < 0.05) (Figure 5). Additionally, no significant differences were found in the C3, C8a, C8b, LZM, and Hepc mRNA levels between the GLU and GPS groups (p > 0.05). The transcriptional levels of all immune genes in the TS group were significantly increased compared with the GTS groups (p < 0.05). A similar result was also shown between the PS and the GPS groups (Figure 5).

4. Discussion

An appropriate level of carbohydrate in feed can promote fish growth and save protein by transferring amino acids from oxidative pathways [21,22]. Previous studies have found the impact of different carbohydrate sources on growth performance varies widely depending on their structure [14]. In this study, the WG, SGR, and CF of largemouth bass juveniles fed with GLU were lower compared to other groups, indicating a poorer utilization capability of glucose. That is likely because glucose can be rapidly absorbed by fish, leading to a prolonged spike in blood glucose levels, which, in turn, results in decreased growth [14,23,24,25]. In contrast, largemouth bass fed with polysaccharide-starch sources obtained better growth efficiency and higher crude protein levels compared to GLU group in this experiment, indicating a stronger carbohydrate utilization and protein-sparing capability [14,25]. Similar results to this experiment were found in studies involving species such as blunt snout bream Megalobrama amblycephala [26], Nile tilapia Oreochromis niloticus [25], golden pompano Trachinotus ovatus [27], and swamp eel Monopterus albus [28]. These previous findings and our results indicated that largemouth bass could exhibit better utilization of structurally complex carbohydrate sources [29].
Compared with the GLU group, the polysaccharide groups resulted in higher HDL-C and TG contents, and lower LDL-C contents, aligned with previous findings in white sturgeon Acipenser transmontanus [30] and large yellow croaker Pseudosciaena crocea R. [31], which were due to increased active endogenous lipid transport induced. Many studies have proven that higher serum AST activity relates with liver damage and poor liver health [32,33]. In this study, AST activities were heightened in the serum of the GLU group, indicating that dietary GLU could impair liver health in largemouth bass to some extent. Moreover, endogenous hormones always play crucially regulatory functions in glucose metabolic process in fish species [17,34,35]. Generally, serum glucose level can be reduced by INS via increasing glucose uptake, while increased by GC via elevating glucose production in response to various external nutrients [36,37,38]. Therefore, higher GC and lower INS contents were also shown in the PS and GPS groups, which might respond to variations of corresponding serum glucose contents [35,38]. In addition, many studies have reported higher levels of AGRP could increase the appetite in animals [17,35,39]. Considering the lower FCR in the GTS and GPS groups, it is suggested that gelatinized polysaccharide (GTS and GPS) could improve feed utilization and subsequently enhance growth by increasing AGRP contents in largemouth bass.
Various carbohydrate sources can exert different effects on glucose metabolic capabilities by regulating these crucial enzymes (HK, PK, PFK, IDH, and MDH) involved in glycolysis and the TCA cycle in animals. The current investigation revealed that polysaccharide-starch sources had notable impacts on the variations in enzyme activities and mRNA expression levels of HK, PK, PFK, IDH, and MDH in largemouth bass, which was consistent with previous studies in giant grouper Epinephelus lanceolatus larvae [24], Nile tilapia O. niloticus [25] and blunt snout bream M. amblycephala [40]. In general, MPC2 transports cytoplasmic pyruvate into mitochondria, and subsequently, PDH converts pyruvate to acetyl CoA for further metabolism through the TCA cycle. Our results showed that higher expression levels of MPC2 and PDH, as well as higher contents of pyruvate and acetyl CoA, were observed in the TS, GTS, PS, and GPS groups, compared with GLU group, which was in line with results in Nile tilapia O. niloticus [25]. It indicated that polysaccharide-starch sources could notably improve carbohydrate utilization via activating glycolysis and TCA cycle in largemouth bass. In addition, higher hepatic glycogen contents were shown in the GLU group compared with the TS group, consistent with findings in Amur sturgeon Acipenser schrenckii [41]. Meanwhile, slightly higher glycogen contents were also found in the GTS and GPS groups compared to the TS and PS groups, respectively, which was similar to results in European sea bass Dicentrarchus labrax juveniles [42], indicating gelatinized starch could induce glycogen synthesis in largemouth bass. Moreover, as key regulating molecules in the glycogen synthesizing system, the levels of GYG1, GCS, and GBE were also influenced by dietary carbohydrate sources, exhibiting similar variation trends to those of glycogen contents. Higher expression of GYG1, GCS, and GBE in the GTS and GPS groups also verified that gelatinized starch had more ability to synthesize glycogen that partly explained why they could be better utilized in the diet as energy sources. However, some reports also found glycogen contents were not changed, independently of the degree of starch gelatinization in blunt snout bream M. amblycephala [43]. These differences may be attributed to different species of fish. Given these findings and growth indices, the results suggested that gelatinized starch could improve carbohydrate utilization by activating glycogen synthesis in largemouth bass.
It is well-known that adenosine triphosphate (ATP) synthesis is primarily generated during the processes of mitochondrial oxidative phosphorylation (OXPHOS) in eukaryotic cells [44]. OXPHOS is carried out by mitochondrial respiratory electron transport chain (ETC) during nutritional metabolic processes of different nutrients, including carbohydrate sources [45]. Our study found that the expressions of key functional genes, such as NDUfa1, ND2, SDHb, SDHc, and ATP6 in ETC, were significantly increased in polysaccharide-starch (TS, GTS, PS, and GPS) groups compared to the GLU group. These findings suggested that polysaccharide sources could activate the respiratory chain complexes and enhance oxidative phosphorylation by increasing the expression levels of these key functional genes in the ETC through transcriptional modifications in largemouth bass [43,45]. Meanwhile, ROS is generated during the activation of respiratory chain complexes and oxidative phosphorylation [46]. In order to alleviate the potential oxidative stress and maintain redox homeostasis, aerobic organisms have evolved numerous antioxidant enzymes, including SOD, CAT, GSS, GPX, and GR, etc. [32,46]. In this study, we observed markedly elevated levels of Cu/Zn-SOD, Mn-SOD, and GPX1b in the four starch groups compared to the GLU group. This indicated that polysaccharide sources enhanced antioxidant capabilities in largemouth bass. Furthermore, the expression levels of Cu/Zn-SOD, Mn-SOD, GPX1b, and GR were higher in the TS and GTS groups than in the PS and GPS groups, suggesting that TS and GTS may be more effective at improving antioxidant status in largemouth bass. Moreover, our results also found higher Nrf2 levels and lower Keap1b levels were mainly shown in the PS group and the GPS group compared to the GLU group, respectively, consistent with previous findings in fish species with better antioxidant capability [32,47]. Given the pivotal roles of Nrf2/Keap1 in initiating the expression of antioxidant enzymes, it demonstrated that adequate polysaccharide sources could contribute to maintaining redox homeostasis and improve antioxidant capability in largemouth bass.
The complement system plays an essential role in both innate and adaptive immune responses, serving to alert the host of potential pathogens and assist in their removal [46]. Increasing studies on fish have verified that the response of the complement system is strongly correlated with dietary carbohydrate sources [48,49]. In the current study, we found that polysaccharide carbohydrate sources more effectively initiated immune function compared to monosaccharide, and that ungelatinized starch was superior to gelatinized starch in this respect. For instance, the TS diet significantly increased C3 and C4 mRNA levels, indicating that the complement pathway was activated, thus enabling a beneficial response to inflammation [49]. Additionally, activated C3 and/or C4 are known to assist in the recognition and phagocytosis of microbes by phagocytes such as neutrophils, macrophages and monocytes [50,51]. While the TS group in Table 4 showed a lower number of NEU and MON, the increased C3 and C4 levels likely facilitated the bactericidal effect of these phagocytes in the blood by enhancing their phagocytic capacity, rather than by increasing the number of blood cells. The higher value of RBC in Table 4 suggested that TS-fed fish had a very robust immune defense system, compared to those fed other starch sources, in line with a previous study in cobia (Rachycentron canadum Linnaeus.) [14]. Moreover, upregulation of C8a, C8b and C8g (downstream gene of C3 and C4) in TS-fed fish further promoted the formation of the membrane attack complex, which led to cytolysis of pathogens. The findings indicated that tapioca starch provided a higher level of immunity through accelerating complement-mediated bactericidal and lytic effects in fish. Lysozyme, another key factor of innate immunity, causes the lysis of bacterial walls and is often used to assess the immune status in aquatic animals [52]. Our results showed that fish fed with the TS diet had higher activities of LZM at the transcriptional level. This demonstrated again that the TS diet exhibited a greater ability to improve the innate immunity of largemouth bass. Data previously proved that ungelatinized starch had a significant effect on activating the immune function [12]. In this study, the mRNA levels of all the genes above described in the GTS group were lower than that of the TS group, in agreement with the results of previous research [10,11]. Antimicrobial peptides such as Hepc also participate in fish innate immunity, produced primarily in the liver [53,54]. A growing body of studies has reported that prior to infection and after challenged by pathogenic bacteria (Aeromonas hydrophila and Pseudomonas fluorescens), Hepc can down-regulate pro-inflammatory markers or directly kill bacteria to protect fish against inflammation and bacterial infection [55,56,57,58,59,60]. Our study found that Hepc expression was increased induced by dietary TS, followed by PS and GPS, indicating better immunomodulatory effects. In short, our results revealed that ungelatinized tapioca starch has a more positive effect on the immunity of largemouth bass.

5. Conclusions

In summary, compared with GLU, dietary starch sources (TS, GTS, PS and GPS) exhibited better growth performance and increased the crude protein content of the whole body in largemouth bass. Meanwhile, dietary starch sources (TS, GTS, PS and GPS) improved carbohydrate-utilizing capability via activating glycolysis, TCA cycle, mitochondrial oxidative phosphorylation and glycogen synthesis in largemouth bass. In addition, antioxidant abilities were significantly elevated in the TS and GTS groups, and immune responses were notably promoted in the TS and PS groups compared with the GLU group. This study provides new information for selecting carbohydrate sources in artificial feed and helps improve fish health in farmed largemouth bass.

Author Contributions

Conceptualization, C.W., Y.L. and P.Q.; methodology, P.Q., H.Z., P.Z. and Y.X.; software, P.Q., H.Z., P.Z. and Y.X.; validation, P.Q., H.Z., P.Z. and Y.X.; formal analysis, P.Q., H.Z., P.Z. and Y.X.; investigation, P.Q., H.Z., P.Z. and Y.X.; resources, C.W.; data curation, P.Q., C.W. and Y.L.; writing—original draft preparation, P.Q., Y.L. and C.W.; writing—review and editing, P.Q., Y.L. and C.W.; visualization, P.Q., H.Z., P.Z. and Y.X. supervision, H.Z., P.Z., Y.X., Y.L. and C.W.; project administration, C.W.; funding acquisition, C.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was financially supported by the Key Research and Development Program of Zhejiang Province (2019C02046).

Institutional Review Board Statement

The animal study protocol was approved by the Institutional Animal Care and Use Committee of Huzhou University, China (approval ID: HUZJ-DW-2021-063; approval date: 16 June 2021). Animal procedures were strictly performed in accordance with the guidelines provided by the Huzhou university Laboratory Animal Welfare and Ethics.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in the main article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Li, X.; Zheng, S.; Ma, X.; Cheng, K.; Wu, G. Effects of dietary starch and lipid levels on the protein retention and growth of largemouth bass (Micropterus salmoides). Amino Acids 2020, 52, 999–1016. [Google Scholar] [CrossRef]
  2. Limbu, S.M.; Zhang, H.; Luo, Y.; Chen, L.; Zhang, M.; Du, Z. High carbohydrate diet partially protects Nile tilapia (Oreochromis niloticus) from oxytetracycline-induced side effects. Environ. Pollut. 2020, 256, 113508. [Google Scholar] [CrossRef] [PubMed]
  3. Ding, X.; Yao, L.; Hou, Y.; Hou, Y.; Wang, G.; Fan, J.; Qian, L. Effects of different carbohydrate levels in puffed feed on digestive tract morphological function and liver tissue structure of snakeheads (Channa argus). Aquac. Res. 2020, 51, 557–568. [Google Scholar] [CrossRef]
  4. Sørensen, M.; Nguyen, G.; Storebakken, T.; Øverland, M. Starch source, screw configuration and injection of steam into the barrel affect the physical quality of extruded fish feed. Aquac. Res. 2010, 41, 419–432. [Google Scholar] [CrossRef]
  5. Zhao, L.; Liao, L.; Tang, X.; Liang, J.; Liu, Q.; Luo, W.; Adam, A.A.; Luo, J.; Li, Z.; Yang, S. High-carbohydrate diet altered conversion of metabolites, and deteriorated health in juvenile largemouth bass. Aquaculture 2022, 549, 737816. [Google Scholar] [CrossRef]
  6. Kamalam, B.S.; Medale, F.; Panserat, S. Utilisation of dietary carbohydrates in farmed fishes: New insights on influencing factors, biological limitations and future strategies. Aquaculture 2017, 467, 3–27. [Google Scholar] [CrossRef]
  7. Hemre, G.; Mommsen, T.; Krogdahl, Å. Carbohydrates in fish nutrition: Effects on growth, glucose metabolism and hepatic enzymes. Aquac. Nutr. 2002, 8, 175–194. [Google Scholar] [CrossRef]
  8. Rakhshi, E.; Cambert, M.; Diascorn, Y.; Lucas, T.; Rondeau-Mouro, C. An insight into tapioca and wheat starch gelatinization mechanisms using TD-NMR and complementary techniques. Magn. Reson. Chem. 2022, 60, 702–718. [Google Scholar] [CrossRef] [PubMed]
  9. Qi, Q.; Hong, Y.; Zhang, Y.; Gu, Z.; Cheng, L.; Li, Z.; Li, C. Combinatorial effect of fermentation and drying on the relationship between the structure and expansion properties of tapioca starch and potato starch. Int. J. Biol. Macromol. 2020, 145, 965–973. [Google Scholar] [CrossRef]
  10. Glencross, B.; Blyth, D.; Tabrett, S.; Bourne, N.; Irvin, S.; Anderson, M.; Fox-Smith, T.; Smullen, R. An assessment of cereal grains and other starch sources in diets for barramundi (Lates calcarifer)—Implications for nutritional and functional qualities of extruded feeds. Aquac. Nutr. 2012, 18, 388–399. [Google Scholar] [CrossRef]
  11. Nafees, M.S.M.; Kamarudin, M.S.; Karim, M.; Hassan, M.Z.; de Cruz, C.R. Effects of dietary starch sources on growth, nutrient utilization and liver histology of juvenile tinfoil barb (Barbonymus schwanenfeldii, Bleeker 1853). Aquac. Rep. 2022, 23, 101069. [Google Scholar] [CrossRef]
  12. Jeong, S.; Khosravi, S.; Lee, S.Y.; Kim, K.; Lee, B.; Lee, S. Evaluation of the three different sources of dietary starch in an extruded feed for juvenile olive flounder, Paralichthys olivaceus. Aquaculture 2021, 533, 736242. [Google Scholar] [CrossRef]
  13. Perry, E.B.; Valach, A.A.; Fenton, J.M.; Moore, G.E. An assessment of starch content and gelatinization in traditional and non-traditional dog food formulations. Animals 2022, 12, 3357. [Google Scholar] [CrossRef] [PubMed]
  14. Cui, X.; Zhou, Q.; Liang, H.; Yang, J.; Zhao, L. Effects of dietary carbohydrate sources on the growth performance and hepatic carbohydrate metabolic enzyme activities of juvenile cobia (Rachycentron canadum Linnaeus.). Aquac. Res. 2010, 42, 99–107. [Google Scholar] [CrossRef]
  15. Gatesoupe, F.J.; Huelvan, C.; Le Bayon, N.; Sévère, A.; Aasen, I.M.; Degnes, K.F.; Mazurais, D.; Panserat, S.; Zambonino-Infante, J.L.; Kaushik, S.J. The effects of dietary carbohydrate sources and forms on metabolic response and intestinal microbiota in sea bass juveniles, Dicentrarchus labrax. Aquaculture 2014, 422, 47–53. [Google Scholar] [CrossRef]
  16. Wang, B.K.; Liu, W.B.; Xu, C.; Cao, X.F.; Zhong, X.Q.; Shi, H.J.; Li, X.F. Dietary carbohydrate levels and lipid sources modulate the growth performance, fatty acid profiles and intermediary metabolism of blunt snout bream Megalobrama amblycephala in an interactive pattern. Aquaculture 2017, 481, 140–153. [Google Scholar] [CrossRef]
  17. Yang, W.; Wu, J.; Song, R.; Li, Z.; Jia, X.; Qian, P.; Zhang, H.; Zhang, P.; Xue, X.; Li, S.; et al. Effects of dietary soybean lecithin on growth performances, body composition, serum biochemical parameters, digestive and metabolic abilities in largemouth bass Micropterus salmoides. Aquacult. Rep. 2023, 29, 101528. [Google Scholar] [CrossRef]
  18. Wu, J.; Yang, W.; Song, R.; Li, Z.; Jia, X.; Zhang, H.; Zhang, P.; Xue, X.; Li, S.; Xie, Y.; et al. Dietary soybean lecithin improves growth, immunity, antioxidant capability and intestinal barrier functions in largemouth bass Micropterus salmoides juveniles. Metabolites 2023, 13, 512. [Google Scholar] [CrossRef]
  19. Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
  20. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  21. Krogdahl, Å.; Hemre, G.I.; Mommsen, T. Carbohydrates in fish nutrition: Digestion and absorption in postlarval stages. Aquac. Nutr. 2005, 11, 103–122. [Google Scholar] [CrossRef]
  22. Vielma, J.; Koskela, J.; Ruohonen, K.; Jokinen, I.; Kettunen, J. Optimal diet composition for European whitefish (Coregonus lavaretus): Carbohydrate stress and immune parameter responses. Aquaculture 2003, 225, 3–16. [Google Scholar] [CrossRef]
  23. Lee, S.; Kim, K.; Lall, S.P. Utilization of glucose, maltose, dextrin and cellulose by juvenile flounder (Paralichthys olivaceus). Aquaculture 2003, 221, 427–438. [Google Scholar] [CrossRef]
  24. Lu, S.; Wu, X.; Gao, Y.; Gatlin III, D.M.; Wu, M.; Yao, W.; Jin, Z.; Li, X.; Dong, Y. Effects of dietary carbohydrate sources on growth, digestive enzyme activity, gene expression of hepatic GLUTs and key enzymes involved in glycolysis-gluconeogenesis of giant grouper Epinephelus lanceolatus larvae. Aquaculture 2018, 484, 343–350. [Google Scholar] [CrossRef]
  25. Zhou, W.; Wu, C.; Limbu, S.M.; Li, R.; Chen, L.; Qiao, F.; Luo, Y.; Zhang, M.; Han, T.; Du, Z. More simple more worse: Simple carbohydrate diets cause alterations in glucose and lipid metabolism in Nile tilapia (Oreochromis niloticus). Aquaculture 2022, 550, 737857. [Google Scholar] [CrossRef]
  26. Zhou, C.; Ge, X.; Liu, B.; Xie, J.; Miao, L. Effect of high dietary carbohydrate on the growth performance and physiological responses of juvenile Wuchang bream, Megalobrama amblycephala. Asian-Australas. J. Anim. Sci. 2013, 26, 1598. [Google Scholar] [CrossRef] [PubMed]
  27. Zhang, Y.; Xie, S.; Wei, H.; Zheng, L.; Liu, Z.; Fang, H.; Xie, J.; Liao, S.; Tian, L.; Liu, Y. High dietary starch impaired growth performance, liver histology and hepatic glucose metabolism of juvenile largemouth bass, Micropterus salmoides. Aquac. Nutr. 2020, 26, 1083–1095. [Google Scholar]
  28. Yu, C.; Wang, L.; Cai, W.; Zhang, W.; Hu, Z.; Wang, Z.; Yang, Z.; Peng, M.; Huo, H.; Zhang, Y. Dietary macroalgae Saccharina japonica ameliorates liver injury induced by a high-carbohydrate diet in swamp eel (Monopterus albus). Front. Vet. Sci. 2022, 9, 869369. [Google Scholar] [CrossRef] [PubMed]
  29. Li, S.; Sang, C.; Wang, A.; Zhang, J.; Chen, N. Effects of dietary carbohydrate sources on growth performance, glycogen accumulation, insulin signaling pathway and hepatic glucose metabolism in largemouth bass, Micropterus salmoides. Aquaculture 2019, 513, 734391. [Google Scholar] [CrossRef]
  30. Deng, D.F.; Hemre, G.I.; Storebakken, T.; Shiau, S.Y.; Hung, S.S. Utilization of diets with hydrolyzed potato starch, or glucose by juvenile white sturgeon (Acipenser transmontanus), as affected by Maillard reaction during feed processing. Aquaculture 2005, 248, 103–109. [Google Scholar] [CrossRef]
  31. Wang, X.; Li, Y.; Hou, C.; Gao, Y.; Wang, Y. Physiological and molecular changes in large yellow croaker (P. seudosciaena crocea R.) with high-fat diet-induced fatty liver disease. Aquac. Res. 2015, 46, 272–282. [Google Scholar] [CrossRef]
  32. Zhang, H.; Zhao, L.; Zhang, P.; Xie, Y.; Yao, X.; Pan, X.; Fu, Y.; Wei, J.; Bai, H.; Shao, X. Effects of selenoprotein extracts from Cardamine hupingshanensis on growth, selenium metabolism, antioxidant capacity, immunity and intestinal health in largemouth bass Micropterus salmoides. Front. Immunol. 2024, 15, 1342210. [Google Scholar] [CrossRef] [PubMed]
  33. Wu, C.; Ye, J.; Chen, L.; Lu, Z. The effects of dietary carbohydrate on the growth, antioxidant capacities, innate immune responses and pathogen resistance of juvenile Black carp Mylopharyngodon piceus. Fish. Shellfish. Immunol. 2016, 49, 132–142. [Google Scholar] [CrossRef] [PubMed]
  34. Xie, Y.; Shao, X.; Zhang, P.; Zhang, H.; Yu, J.; Yao, X.; Fu, Y.; Wei, J.; Wu, C. High tarch induces hematological variations, metabolic changes, oxidative stress, inflammatory responses, and histopathological lesions in largemouth bass (Micropterus salmoides). Metabolites 2024, 14, 236. [Google Scholar] [CrossRef]
  35. Soengas, J.L. Integration of nutrient sensing in fish hypothalamus. Front. Neurosci. 2021, 15, 653928. [Google Scholar] [CrossRef] [PubMed]
  36. Shi, H.; Liu, W.; Xu, C.; Zhang, D.; Wang, B.; Zhang, L.; Li, X. Molecular characterization of the RNA-binding protein quaking-a in Megalobrama amblycephala: Response to high-carbohydrate feeding and glucose/insulin/glucagon treatment. Front. Physiol. 2018, 9, 434. [Google Scholar] [CrossRef] [PubMed]
  37. Forbes, J.L.; Kostyniuk, D.J.; Mennigen, J.A.; Weber, J.M. Glucagon regulation of carbohydrate metabolism in rainbow trout: In vivo glucose fluxes and gene expression. J. Exp. Biol. 2019, 222, jeb211730. [Google Scholar] [CrossRef]
  38. Albeloushi, S.; Hasan, A.; Arefanian, H.; Sindhu, S.; Al-Rashed, F.; Kochumon, S.; Abukhalaf, N.; Jacob, T.; Shenouda, S.; Al Madhoun, A. Differential effects of fish-oil and cocoa-butter based high-fat/high-sucrose diets on endocrine pancreas morphology and function in mice. Front. Endocrinol. 2024, 15, 1265799. [Google Scholar] [CrossRef] [PubMed]
  39. Han, J.; Liang, X.; Guo, Y.; Wu, X.; Li, Z.; Hong, T. Agouti-related protein as the glucose signaling sensor in the central melanocortin circuits in regulating fish food intake. Front. Endocrinol. 2022, 13, 1010472. [Google Scholar] [CrossRef]
  40. Ren, M.; Habte-Tsion, H.M.; Xie, J.; Liu, B.; Zhou, Q.; Ge, X.; Pan, L.; Chen, R. Effects of dietary carbohydrate source on growth performance, diet digestibility and liver glucose enzyme activity in blunt snout bream, Megalobrama amblycephala. Aquaculture 2015, 438, 75–81. [Google Scholar] [CrossRef]
  41. Jiang, M.; Liu, W.; Wen, H.; Huang, F.; Wu, F.; Tian, J.; Yang, C.; Wang, W.; Wei, Q. Effect of dietary carbohydrate sources on the growth performance, feed utilization, muscle composition, postprandial glycemic and glycogen response of Amur sturgeon, A cipenser schrenckii Brandt, 1869. J. Appl. Ichthyol. 2014, 30, 1613–1619. [Google Scholar] [CrossRef]
  42. Peres, H.; Oliva-Teles, A. Utilization of raw and gelatinized starch by European sea bass (Dicentrarchus labrax) juveniles. Aquaculture 2002, 205, 287–299. [Google Scholar] [CrossRef]
  43. Zhang, L.; Liu, W.B.; Brown, P.B.; Xu, C.; Shi, H.J.; Zheng, X.C.; Zhang, L.; He, C.; Huang, Y.Y.; Li, X.F. Utilization of raw and gelatinized starch by blunt snout bream Megalobrama amblycephala as evidenced by the glycolipid metabolism, glucose tolerance and mitochondrial function. Aquaculture 2020, 529, 735603. [Google Scholar] [CrossRef]
  44. Cheng, Z.; Ristow, M. Mitochondria and Metabolic Homeostasis; Mary Ann Liebert, Inc.: New Rochelle, NY, USA, 2013; Volume 19, pp. 240–242. [Google Scholar]
  45. Softic, S.; Meyer, J.G.; Wang, G.X.; Gupta, M.K.; Batista, T.M.; Lauritzen, H.P.; Fujisaka, S.; Serra, D.; Herrero, L.; Willoughby, J. Dietary sugars alter hepatic fatty acid oxidation via transcriptional and post-translational modifications of mitochondrial proteins. Cell Metab. 2019, 30, 735–753.e4. [Google Scholar] [CrossRef] [PubMed]
  46. Larosa, V.; Remacle, C. Insights into the respiratory chain and oxidative stress. Biosci. Rep. 2018, 38, BSR20171492. [Google Scholar] [CrossRef] [PubMed]
  47. Zhang, P.; Zhang, C.; Yao, X.; Xie, Y.; Zhang, H.; Shao, X.; Yang, X.; Nie, Q.; Ye, J.; Wu, C. Selenium yeast improve growth, serum biochemical indices, metabolic ability, antioxidant capacity and immunity in black carp Mylopharyngodn piceus. Fish. Shellfish. Immunol. 2024, 146, 109414. [Google Scholar] [CrossRef]
  48. Ballanti, E.; Perricone, C.; Greco, E.; Ballanti, M.; Di Muzio, G.; Chimenti, M.S.; Perricone, R. Complement and autoimmunity. Immunol. Res. 2013, 56, 477–491. [Google Scholar] [CrossRef] [PubMed]
  49. Li, M.; Zhang, H. An overview of complement systems in teleosts. Dev. Comp. Immunol. 2022, 137, 104520. [Google Scholar] [CrossRef] [PubMed]
  50. Leiro, J.; Ortega, M.; Estevez, J.; Ubeira, F.; Sanmartin, M. The role of opsonization by antibody and complement in in vitro phagocytosis of microsporidian parasites by turbot spleen cells. Vet. Immunol. Immunopathol. 1996, 51, 201–210. [Google Scholar] [CrossRef]
  51. Uribe-Querol, E.; Rosales, C. Phagocytosis: Our Current Understanding of a Universal Biological Process. Front. Immunol. 2020, 11, 1066. [Google Scholar] [CrossRef]
  52. Ragland, S.A.; Criss, A.K. From bacterial killing to immune modulation: Recent insights into the functions of lysozyme. PLoS Pathog. 2017, 13, e1006512. [Google Scholar] [CrossRef] [PubMed]
  53. Agarwal, A.K.; Yee, J. Hepcidin. Adv. Chronic Kidney Dis. 2019, 26, 298–305. [Google Scholar] [CrossRef] [PubMed]
  54. Park, C.H.; Valore, E.V.; Waring, A.J.; Ganz, T. Hepcidin, a urinary antimicrobial peptide synthesized in the liver. J. Biol. Chem. 2001, 276, 7806–7810. [Google Scholar] [CrossRef]
  55. Cervera, L.; Arizcun, M.; Mercado, L.; Chaves-Pozo, E.; Cuesta, A. Hepcidin and dicentracin peptides show preventive antiviral applications against NNV infection in European sea bass through immunomodulatory roles. Aquaculture 2024, 583, 740592. [Google Scholar] [CrossRef]
  56. Yin, X.; Chen, N.; Mu, L.; Bai, H.; Wu, H.; Qi, W.; Huang, Y.; Jian, J.; Wang, A.; Ye, J. Identification and characterization of hepcidin from Nile Tilapia (Oreochromis niloticus) in response to bacterial infection and iron overload. Aquaculture 2022, 546, 737317. [Google Scholar] [CrossRef]
  57. Mohapatra, A.; Dixit, A.; Garg, L.C.; Sahoo, P.K. Hepcidin gene of Indian major carp, Labeo rohita: Molecular, structural and functional characterization, and antibacterial activity of recombinant hepcidin. Aquaculture 2019, 511, 734218. [Google Scholar] [CrossRef]
  58. Wang, Z.; Li, X.; Lu, K.; Wang, L.; Ma, X.; Song, K.; Zhang, C. Effects of dietary iron levels on growth performance, iron metabolism and antioxidant status in spotted seabass (Lateolabrax maculatus) reared at two temperatures. Aquaculture 2023, 562, 738717. [Google Scholar] [CrossRef]
  59. Hal, A.M.; El-Barbary, M.I. Gene expression and histopathological changes of Nile tilapia (Oreochromis niloticus) infected with Aeromonas hydrophila and Pseudomonas fluorescens. Aquaculture 2020, 526, 735392. [Google Scholar] [CrossRef]
  60. Hal, A.M.; El-Barbary, M.I. Effect of Nigella sativa oil and ciprofloxacin against bacterial infection on gene expression in Nile tilapia (Oreochromis niloticus) blood. Aquaculture 2021, 532, 736071. [Google Scholar] [CrossRef]
Animals 14 01492 g001
Figure 1. Effect of dietary carbohydrate sources on mRNA expression levels of genes involved in the glycolysis and citric acid cycle in largemouth bass (n = 3). Bars with different superscripts are significantly different (p < 0.05). HK, hexokinase-1; PFK, phosphofructokinase; PK, pyruvate kinase; MPC2, mitochondrial pyruvate carrier 2; PDHx, pyruvate dehydrogenase complex component X; CS, citrate synthase; IDH, isocitrate dehydrogenase; MDH, malate dehydrogenase.
Figure 1. Effect of dietary carbohydrate sources on mRNA expression levels of genes involved in the glycolysis and citric acid cycle in largemouth bass (n = 3). Bars with different superscripts are significantly different (p < 0.05). HK, hexokinase-1; PFK, phosphofructokinase; PK, pyruvate kinase; MPC2, mitochondrial pyruvate carrier 2; PDHx, pyruvate dehydrogenase complex component X; CS, citrate synthase; IDH, isocitrate dehydrogenase; MDH, malate dehydrogenase.
Animals 14 01492 g001
Animals 14 01492 g002
Figure 2. Effect of dietary carbohydrate sources on mRNA expression levels of genes involved in the glycogen synthesis in largemouth bass (n = 3). Bars with different superscripts are significantly different (p < 0.05). GYG1, glycogenin-1; GYG2, glycogenin-2; UGPα, UTP–glucose-1-phosphate uridylyltransferase; GCS, glycogen synthase; GBE, glycogen branching enzyme.
Figure 2. Effect of dietary carbohydrate sources on mRNA expression levels of genes involved in the glycogen synthesis in largemouth bass (n = 3). Bars with different superscripts are significantly different (p < 0.05). GYG1, glycogenin-1; GYG2, glycogenin-2; UGPα, UTP–glucose-1-phosphate uridylyltransferase; GCS, glycogen synthase; GBE, glycogen branching enzyme.
Animals 14 01492 g002
Animals 14 01492 g003
Figure 3. Effect of dietary carbohydrate sources on mRNA expression levels of mitochondrial respiratory electron transport chain genes in largemouth bass (n = 3). Bars with different superscripts are significantly different (p < 0.05). NDUfa1, NADH:ubiquinone oxidoreductase subunit A1; ND1, NADH dehydrogenase subunit 1; ND2, NADH dehydrogenase subunit 2; SDHb, succinate dehydrogenase complex iron sulfur subunit B; SDHc, succinate dehydrogenase complex iron sulfur subunit C; COX1, cytochrome c oxidase I; COX3, cytochrome c oxidase III; ATP6, ATP synthase 6.
Figure 3. Effect of dietary carbohydrate sources on mRNA expression levels of mitochondrial respiratory electron transport chain genes in largemouth bass (n = 3). Bars with different superscripts are significantly different (p < 0.05). NDUfa1, NADH:ubiquinone oxidoreductase subunit A1; ND1, NADH dehydrogenase subunit 1; ND2, NADH dehydrogenase subunit 2; SDHb, succinate dehydrogenase complex iron sulfur subunit B; SDHc, succinate dehydrogenase complex iron sulfur subunit C; COX1, cytochrome c oxidase I; COX3, cytochrome c oxidase III; ATP6, ATP synthase 6.
Animals 14 01492 g003
Animals 14 01492 g004
Figure 4. Effect of dietary carbohydrate sources on mRNA expression levels of antioxidant-relative genes in largemouth bass (n = 3). Bars with different superscripts are significantly different (p < 0.05). Cu/Zn-SOD, Cu/Zn-Superoxide dismutase; Mn-SOD, Mn-Superoxide dismutase; CAT, catalase; GSS, glutathione synthase; GR, glutathione reductase; GPX1b, glutathione peroxidase 1b; GPX7, glutathione peroxidase 7; Nrf2, nuclear factor E2-related factor 2; keap1b, Kelch-like ECH associated protein 1b.
Figure 4. Effect of dietary carbohydrate sources on mRNA expression levels of antioxidant-relative genes in largemouth bass (n = 3). Bars with different superscripts are significantly different (p < 0.05). Cu/Zn-SOD, Cu/Zn-Superoxide dismutase; Mn-SOD, Mn-Superoxide dismutase; CAT, catalase; GSS, glutathione synthase; GR, glutathione reductase; GPX1b, glutathione peroxidase 1b; GPX7, glutathione peroxidase 7; Nrf2, nuclear factor E2-related factor 2; keap1b, Kelch-like ECH associated protein 1b.
Animals 14 01492 g004
Animals 14 01492 g005
Figure 5. Effect of dietary carbohydrate sources on mRNA expression levels of immune genes in largemouth bass (n = 3). Bars with different superscripts are significantly different (p < 0.05). C3, complement component 3; C4, complement component 4; C8a, complement component 8a; C8b, complement component 8b; C8g, complement component 8g; C9, complement component 9; LZM, lysozyme; Hepc, hepcidin; β-actin, actin beta.
Figure 5. Effect of dietary carbohydrate sources on mRNA expression levels of immune genes in largemouth bass (n = 3). Bars with different superscripts are significantly different (p < 0.05). C3, complement component 3; C4, complement component 4; C8a, complement component 8a; C8b, complement component 8b; C8g, complement component 8g; C9, complement component 9; LZM, lysozyme; Hepc, hepcidin; β-actin, actin beta.
Animals 14 01492 g005
Table 1. Composition and nutrient levels of experimental diets (% dry matter).
Table 1. Composition and nutrient levels of experimental diets (% dry matter).
IngredientsGLUTSGTSPSGPS
Casein a27.027.027.027.027.0
Fish meal b37.037.037.037.037.0
Soybean oil c7.07.07.07.07.0
Lecithin b2.02.02.02.02.0
Mineral premix d2.52.52.52.52.5
Vitamin premix e1.21.21.21.21.2
Choline chloride a0.40.40.40.40.4
Microcrystalline cellulose f12.912.912.912.912.9
Glucose (GLU) a10.0
Tapioca starch (TS) g 10.0
Gelatinized tapioca starch (GTS) g 10.0
Potato starch (PS) g 10.0
Gelatinized potato starch (GPS) g 10.0
Total100.0100.0100.0100.0100.0
Proximate composition
Crude protein (%)48.9848.6848.7248.8148.85
Crude lipid (%)12.0712.1512.2112.1912.12
Ash (%)4.914.914.934.924.92
a Obtained from Sinopharm Chemical Reagent Co., Ltd., Shanghai, China; Casein crude protein 80.56%. b Obtained from Zhejiang Dongyu Biotechnology Co., Ltd., Huzhou, China; Fish meal crude protein 67.6%. c Soybean oil, obtained from COFCO Group Co., Ltd., Beijing, China. d Mineral premix (mg/kg): KI, 0.4 mg; CoCl2·6H2O, 52 mg; CuSO4·5H2O, 16 mg; FeSO4·7H2O, 200 mg; ZnSO4·H2O, 280 mg; MnSO4·H2O, 45 mg; MgSO4·7H2O, 1200 mg; Ca(H2PO4)2, 12,000 mg; NaCl, 60 mg. e Vitamin premix (mg/kg): vitamin A, 20 mg; vitamin D3, 3 mg; vitamin C, 300 mg; vitamin E, 300 mg; thiamin, 20 mg; riboflavin, 10 mg; pyridoxine HCl, 20 mg; vitamin B12, 0.2 mg; vitamin K3, 5 mg; inositol, 1000 mg; pantothenic acid, 30 mg; folic acid, 3 mg; niacin acid, 50 mg; biotin, 1 mg. f Obtained from Linghu Chemical Co., Ltd., Huzhou, China. g Obtained from Jiaxing Xinxin Food Technology Co., Ltd., Jiaxing, China.
Table 2. Primers for real-time qPCR used in this study.
Table 2. Primers for real-time qPCR used in this study.
GeneForward Primer (5′-3′)Reverse Primer (5′-3′)Gene IDTM
(°C)		E-Values (%)
HKGGCTTCACCTTCTCATTTCC CCTCAACAGTCCCACCACA11988999457.5101.6
PFKCTGTATAATCCCTGCCACCATCACCACAAACACTCGCCTC11990400358.099.8
PKCACCAACCCATTCATTTGCA AGTGTCATCACCTCAGAGTAGCG11989754259.5102.7
MPC2ACTGGCCTGATCTGGTCCTGCCTTCATATCCTGCTTG11990426257.598.6
PDHxAAGATGCGTTGAGTCTGTTGAATTGGGTCTGCTGCCTGTG11989381858.5101.5
CSACTCAAGTCGGGAAGGGTTCAGGTGCTTCAGGGCAAA11990519357.599.7
IDHACCAATCCCATAGCCTCCATCTCCAGTGCCTCAGCGAACA11990457560.0104.8
MDHGCTTCACCTTCTCCGTCCTGGGTTCTTCTCAATGCCGTTC11989793059.5104.2
GYG1GGAAACTGGTCGCACTCGGGGACGCTTCATCAGGGA11991084558.5101.6
GYG2TCCGTTCTAAGATGCTTCATTCTCAACTCCTCTGCTCCAAAA11990558757.598.8
UGPαGAGGAGTCGATCCAGCCCTATCCAGACCGCCGTTCAGTT11991530559.5102.3
GCSTGTCATCGGTCATTTCCACGCAGCACAGAGGTATCGTCCC11991825259.5103.5
GBEACGACTGGGTTCACTGGGTGTATGAGGCGACCTTTCC11988347757.0101.4
NDUfa1ATGTGGTATGAAATTCTGCCTAGCTCACCTTCCCTCCGTTG11988875157.598.6
ND1CTCCCACATTCCCACGATGCATGAGCTGGTCATAGCG410003557.099.4
ND2AAATACCCTAGCCATCATCCCCCTGTGAGCCCAGCGTTA410002658.0102.7
SDHbGCCGCTGTGGTGTTGTGTCTCCTGGAGTGTCTGGGTC11988622057.5103.5
SDHcGGCATCGCCTTTCCGTTATCGGTGCGGTAGAGTTCTGG11990174760.0101.8
COX1CCGAAACCTCAACACCACCTGAAATCATCCCGAACCCT410002759.099.7
COX3CATTATCGGCTCAACTTTCCTTCAATATCATGCTGCTGCTTC410003157.5102.4
ATP6CACCCTCCTAATCCCTGTTCGAGATGTCCGGCTGTCAAA410003056.5100.8
Cu/Zn-SODTGAGCAGGAGGGCGATTCGCACTGATGCACCCATTTGTA11989567859.5102.7
Mn-SODCAGGGATCTACAGGTCTCATTACGCTCGCTCACATTCTC11990903055.098.5
CATACCTATTGCTGTCCGCTTCTCTCCCAGTTGCCCTCCTCA11989304859.5104.8
GSSACAGGAGCAAAGCAAGCATTCCACCAAGAACATGACG11990573456.0100.7
GRACGCCATCACGAGCAGGCATCTCATCACAGCCCAAGC11988941759.0103.2
GPX1bCAACCAGTTCGGGCATCAGGCATCCTTCCCATTCACA11988692559.5101.8
GPX7ACCAAGTCTCCTTCCCTCTGCCAATCAGGCTCCTTTCC11990023956.099.7
Nrf2CAAAGACAAGCGTAAGAAGCCAGGCAGATTGATAATCATAGA11990411955.098.6
keap1bCCTTACTCCAGGCTGTCCGGAAATTACTTTGGTGGGTTTGT11989919258.5103.1
C3CGAGACCTGCTCCATCCTATCTGGGTGAGTCGGTGCTT11989947859.5101.7
C4TGCTCGCACCCGAAACACAGCCTCAAATCCACTCAGAAG11989776360.0102.9
C8aTGGTGGCACAGAGTGTATTGGTTTCTTTGCAGGTGAAGCT11990240356.098.4
C8bAGGCAGGAGGTGGAAGAGTAAGCAGCCGCCAGCGTAAT11990240560.599.3
C8gCAGTGGTTGCGTTGATGTGGTCTATGTTCTGTGCGGGTG11990861257.0100.3
LZMTGTCCAAGTGGGAGTCAGGGTTGCATCCATTCGCAGA11991405756.5102.6
HepcCTCTGCCGTCCCATTCACGCATCATCCACGATTCCATT11989723758.0101.9
β-actinTCCTGCGTCTTGACTTGG GATTTCCCTTTCGGCTGT11988514758.7103.8
EF1αCGTCAAGGAAATCCGTCGTGGCGTAACCTGCGTTGATCTGG11990715059.5102.3
HK, hexokinase-1; PFK, phosphofructokinase; PK, pyruvate kinase; MPC2, mitochondrial pyruvate carrier 2; PDHx, pyruvate dehydrogenase complex component X; CS, citrate synthase; IDH, isocitrate dehydrogenase; MDH, malate dehydrogenase; GYG1, glycogenin-1; GYG2, glycogenin-2; UGPα, UTP-glucose-1-phosphate uridylyl-transferase; GCS, glycogen synthase; GBE, glycogen branching enzyme; NDUfa1, NADH:ubiquinone oxidoreductase subunit A1; ND1, NADH dehydrogenase subunit 1; ND2, NADH dehydrogenase subunit 2; SDHb, succinate dehydrogenase complex iron sulfur subunit B; SDHc, succinate dehydrogenase complex iron sulfur subunit C; COX1, cytochrome c oxidase I; COX3, cytochrome c oxidase III; ATP6, ATP synthase 6; Cu/Zn-SOD, Cu/Zn-Superoxide dismutase; Mn-SOD, Mn-Superoxide dismutase; CAT, catalase; GSS, glutathione synthase; GR, glutathione reductase; GPX1b, glutathione peroxidase 1b; GPX7, glutathione peroxidase 7; Nrf2, nuclear factor E2-related factor 2; keap1b, Kelch-like ECH associated protein 1b; C3, complement component 3; C4, complement component 4; C8a, complement component 8a; C8b, complement component 8b; C8g, complement component 8g; LZM, lysozyme; Hepc, hepcidin; β-actin, actin beta; EF1α, elongation factor-1α.
Table 3. Effects of dietary carbohydrate sources on growth performance and whole body composition of largemouth bass (n = 3). Means in each row with different superscripts show significant differences (p < 0.05).
Table 3. Effects of dietary carbohydrate sources on growth performance and whole body composition of largemouth bass (n = 3). Means in each row with different superscripts show significant differences (p < 0.05).
ItemsGLUTSGTSPSGPS
IBW/(g)9.99 ± 0.0110.00 ± 0.009.98 ± 0.0210.02 ± 0.019.99 ± 0.01
FBW/(g)59.83 ± 0.54 b64.45 ± 0.21 a67.36 ± 0.62 a66.19 ± 1.51 a67.39 ± 0.88 a
WG/(%)498.78 ± 4.70 b544.84 ± 5.43 a574.84 ± 6.90 a560.62 ± 14.56 a574.60 ± 9.15 a
SGR/(%/d)6.74 ± 0.02 b6.89 ± 0.05 a6.98 ± 0.02 a6.94 ± 0.05 a6.98 ± 0.03 a
FCR1.00 ± 0.02 a0.98 ± 0.00 a0.92 ± 0.01 ab0.97 ± 0.01 a0.86 ± 0.02 b
VSI/(%)9.15 ± 0.23 ab9.15 ± 0.25 ab9.67 ± 0.18 a8.64 ± 0.10 b9.22 ± 0.09 ab
HSI/(%)1.93 ± 0.06 a1.31 ± 0.12 b1.92 ± 0.01 a1.12 ± 0.03 b1.80 ± 0.09 a
CF/(g/cm3)2.00 ± 0.01 b2.21 ± 0.03 a2.24 ± 0.05 a2.29 ± 0.05 a2.33 ± 0.05 a
SR/(%)94.67 ± 1.3396.00 ± 4.6296.33 ± 3.5396.00 ± 3.2596.00 ± 4.00
Body composition (%)
Moisture72.19 ± 0.1772.52 ± 0.1772.60 ± 0.2172.36 ± 0.1872.41 ± 0.22
Crude protein16.02 ± 0.04 b16.96 ± 0.06 a16.63 ± 0.14 ab16.82 ± 0.15 a16.50 ± 0.31 ab
Crude lipid7.58 ± 0.097.34 ± 0.077.55 ± 0.177.20 ± 0.037.26 ± 0.05
Ash3.65 ± 0.033.79 ± 0.053.75 ± 0.063.68 ± 0.043.67 ± 0.02
IBW, initial body weight; FBW, final body weight; WG, weight gain; SGR, specific growth rate; FCR, feed conversion ratio; VSI, viscerosomatic index; HSI, hepatosomatic index; CF, condition factor; SR, survival ratio.
Table 4. Effects of dietary carbohydrate sources on blood cell indexes of largemouth bass (n = 12). Means in each row with different superscripts show significant differences (p < 0.05).
Table 4. Effects of dietary carbohydrate sources on blood cell indexes of largemouth bass (n = 12). Means in each row with different superscripts show significant differences (p < 0.05).
ItemsGLUTSGTSPSGPS
WBC/(109/L)175.97 ± 2.03 c180.00 ± 0.62 bc175.42 ± 0.60 c183.05 ± 1.17 b189.28 ± 0.76 a
RBC/(1012/L)2.13 ± 0.03 c2.53 ± 0.01 a2.28 ± 0.01 b2.32 ± 0.01 b2.31 ± 0.02 b
HGB/(g/L)75.33 ± 1.33 b82.00 ± 0.58 a74.67 ± 0.67 b78.33 ± 0.33 ab76.33 ± 0.67 b
MCV/(fL)152.07 ± 0.87 a144.53 ± 0.68 b149.30 ± 0.56 a152.07 ± 0.37 a151.33 ± 0.78 a
PLT/(109/L)56.67 ± 0.88 bc63.33 ± 1.45 a60.00 ± 1.53 ab53.67 ± 1.45 c59.67 ± 0.88 ab
NEU/(109/L)12.00 ± 0.10 ab9.50 ± 0.15 c9.63 ± 0.13 c11.30 ± 0.15 b12.17 ± 0.23 a
LYM/(109/L)78.33 ± 1.07 a77.33 ± 0.23 ab77.67 ± 0.88 ab74.97 ± 0.13 bc72.73 ± 0.43 c
MON/(109/L)11.53 ± 0.12 c12.63 ± 0.12 bc12.47 ± 0.32 bc13.47 ± 0.32 ab13.97 ± 0.33 a
EOS/(109/L)0.10 ± 0.00 b0.10 ± 0.00 b0.10 ± 0.00 b0.10 ± 0.00 b0.33 ± 0.37 a
HCT/(%)32.67 ± 0.4934.63 ± 0.6233.70 ± 0.2933.77 ± 0.8634.97 ± 0.35
WBC, white blood cell; RBC, red blood cell; HGB, hemoglobin; MCV, mean corpuscular volume; PLT, platelet; NEU, neutrophil; LYM, lymphocyte; MON, monocyte; EOS, eosinophils; HCT, hematocrit.
Table 5. Effects of dietary carbohydrate sources on serum biochemical indices and hormones of largemouth bass (n = 6). Means in each row with different superscripts show significant differences (p < 0.05).
Table 5. Effects of dietary carbohydrate sources on serum biochemical indices and hormones of largemouth bass (n = 6). Means in each row with different superscripts show significant differences (p < 0.05).
ItemsGLUTSGTSPSGPS
HDL-C/(mmol/L) 1.33 ± 0.01 d1.68 ± 0.02 a1.47 ± 0.02 c1.54 ± 0.04 bc1.62 ± 0.04 ab
LDL-C/(mmol/L) 1.53 ± 0.04 a1.27 ± 0.02 c1.37 ± 0.01 bc1.33 ± 0.03 bc1.47 ± 0.05 ab
TG/(mmol/L) 5.71 ± 0.25 b9.90 ± 1.85 a9.87 ± 0.24 a10.70 ± 0.20 a10.53 ± 0.41 a
TC/(mmol/L) 4.88 ± 0.01 c5.87 ± 0.27 ab5.42 ± 0.22 bc6.41 ± 0.08 a6.31 ± 0.03 a
AST/(U/L) 44.42 ± 2.98 a39.07 ± 3.09 ab21.90 ± 0.40 c21.73 ± 0.65 c30.37 ± 1.53 bc
GLU/(mmol/L) 6.36 ± 0.01 b6.62 ± 0.03 b7.66 ± 0.26 a4.42 ± 0.06 d5.49 ± 0.24 c
GC/(ng/L) 248.02 ± 10.40 b359.17 ± 10.16 a361.74 ± 19.16 a324.90 ± 17.64 a363.22 ± 9.85 a
INS/(mIU/L) 8.69 ± 0.15 a7.56 ± 0.16 ab8.01 ± 0.42 a5.73 ± 0.55 c6.23 ± 0.23 bc
CCK/(pg/mL) 230.76 ± 9.94 a117.44 ± 1.30 b123.60 ± 6.42 b104.85 ± 1.70 b109.07 ± 11.33 b
AGRP/(mg/L) 10.94 ± 2.22 c36.18 ± 1.88 ab38.24 ± 0.78 a28.33 ± 0.75 b36.46 ± 2.50 ab
HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol; TG, triglycerides; TC, total cholesterol; AST, aspartate aminotransferase; GLU, glucose; GC, glucagon; INS, insulin; CCK, cholecystokinin; AGRP, agouti-related peptide.
Table 6. Effects of dietary carbohydrate sources on glucose metabolic parameters in the liver of largemouth bass (n = 3). Means in each row with different superscripts show significant differences (p < 0.05).
Table 6. Effects of dietary carbohydrate sources on glucose metabolic parameters in the liver of largemouth bass (n = 3). Means in each row with different superscripts show significant differences (p < 0.05).
ItemsGLUTSGTSPSGPS
HK/(nmol/min/mg prot) 0.27 ± 0.02 c0.36 ± 0.01 b0.34 ± 0.01 b0.46 ± 0.00 a0.33 ± 0.01 b
PFK/(U/mg prot) 3.22 ± 0.07 b3.59 ± 0.10 ab3.83 ± 0.08 a3.33 ± 0.08 b3.30 ± 0.17 b
PK/(U/mg prot) 124.24 ± 3.70 b137.47 ± 2.26 b154.55 ± 4.52 b344.11 ± 26.30 a350.09 ± 19.30 a
pyruvate/(U/mg prot) 2.91 ± 0.133.45 ± 0.193.11 ± 0.253.46 ± 0.143.35 ± 0.08
Acetyl CoA/(U/g prot) 1171.28 ± 23.21 b1232.30 ± 26.05 ab1178.46 ± 22.51 b1277.18 ± 10.29 a1290.00 ± 14.56 a
LDH/(U/g prot) 23.44 ± 0.5826.30 ± 4.3317.69 ± 0.5421.26 ± 0.2322.92 ± 0.28
IDH/(nmol/min/mg prot) 113.38 ± 2.51 c125.03 ± 2.97 bc153.50 ± 7.41 a127.16 ± 2.35 bc138.35 ± 5.17 ab
MDH/(U/mg prot) 8.25 ± 0.11 c12.07 ± 0.60 b10.90 ± 0.16 b13.59 ± 0.35 a11.43 ± 0.10 b
GPa/(nmol/min/mg prot) 14.12 ± 0.9913.35 ± 0.2014.45 ± 0.1114.01 ± 0.2214.98 ± 0.48
GCS/(U/mg prot) 9.79 ± 0.07 b7.89 ± 0.20 c11.33 ± 0.11 ab7.84 ± 0.61 c12.85 ± 0.58 a
GBE/(IU/g prot) 214.54 ± 8.73 ab212.41 ± 7.83 ab230.73 ± 4.74 ab205.32 ± 4.30 b239.01 ± 7.38 a
LG/(mg/g) 154.54 ± 5.57 a124.27 ± 6.14 b149.86 ± 6.79 ab133.61 ± 5.28 ab159.92 ± 6.26 a
HK, hexokinase; PFK, phosphofructokinase; PK, pyruvate kinase; CoA, acetyl-CoA; LDH, lactic dehydrogenase; IDH, isocitrate dehydrogenase; MDH, malate dehydrogenase; GPa, glycogen phosphorylase-a; GCS, glycogen synthase; GBE, glycogen branching enzyme; LG, liver glycogen.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Qian, P.; Liu, Y.; Zhang, H.; Zhang, P.; Xie, Y.; Wu, C. Effects of Five Dietary Carbohydrate Sources on Growth, Glucose Metabolism, Antioxidant Capacity and Immunity of Largemouth Bass (Micropterus salmoides). Animals 2024, 14, 1492. https://doi.org/10.3390/ani14101492

AMA Style

Qian P, Liu Y, Zhang H, Zhang P, Xie Y, Wu C. Effects of Five Dietary Carbohydrate Sources on Growth, Glucose Metabolism, Antioxidant Capacity and Immunity of Largemouth Bass (Micropterus salmoides). Animals. 2024; 14(10):1492. https://doi.org/10.3390/ani14101492

Chicago/Turabian Style

Qian, Pengcheng, Yan Liu, Hao Zhang, Penghui Zhang, Yuanyuan Xie, and Chenglong Wu. 2024. "Effects of Five Dietary Carbohydrate Sources on Growth, Glucose Metabolism, Antioxidant Capacity and Immunity of Largemouth Bass (Micropterus salmoides)" Animals 14, no. 10: 1492. https://doi.org/10.3390/ani14101492

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop