Anti-Neuroinflammatory Effect of the Ethanolic Extract of Black Ginseng through TLR4-MyD88-Regulated Inhibition of NF-κB and MAPK Signaling Pathways in LPS-Induced BV2 Microglial Cells
Abstract
:1. Introduction
2. Results
2.1. The Effect of BGE on the Viability of BV2 Microglial Cells
2.2. The Inhibitory Effect of BGE on the Production of NO and PGE2 in LPS-induced BV2 Microglial Cells
2.3. The Inhibitory effect of BGE on the Expression of iNOS and COX-2 Proteins in LPS-induced BV2 Microglial Cells
2.4. The Inhibitory Effect of BGE on the Production of Pro-Inflammatory Cytokines and the Expression of Those mRNA in LPS-Induced BV2 Microglial Cells
2.5. The Inhibitory Effect of BGE on the Activation of NF-κB Signaling Pathway in LPS-induced BV2 Microglial Cells
2.6. The Inhibitory Effect of BGE on the Activation of MAPK Signaling Pathway in LPS-induced BV2 Microglial Cells
2.7. The Inhibitory Effect of BGE on the Activation of TLR4/MyD88 Signaling Pathway in LPS-Induced BV2 Microglial Cells
2.8. Quantitative Analysis of Black Ginseng Extract by HPLC
2.9. The Inhibitory Effect of Ginsenosides in BGE on the Production of NO, IL-6, and TNF-α in LPS-Induced BV2 Microglial Cells
3. Discussion
4. Materials and Methods
4.1. The Preparation of Ethanolic Extract of Black Ginseng
4.2. Chemicals and Reagents
4.3. Cell Culture and Sample Preparation
4.4. MTT Assay for Cell Viability
4.5. Determination of Nitrite (NO Production)
4.6. Western Blot Analysis
4.7. Assays for PGE2, IL-6, and TNF-α
4.8. Preparation of Cytosolic and Nucelar Fractions
4.9. Quantitative Real-Time Reverse Transcription PCR (qRT-PCR)
4.10. HPLC Analytical Conditions
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lawson, L.J.; Perry, V.H.; Gordon, S. Turnover of resident microglia in the normal adult mouse brain. Neuroscience 1992, 48, 405–415. [Google Scholar] [CrossRef] [PubMed]
- Gehrmann, J.; Matsumoto, Y.; Kreutzberg, G.W. Microglia: Intrinsic immuneffector cell of the brain. Brain Res. Rev. 1995, 20, 269–287. [Google Scholar] [CrossRef] [PubMed]
- More, S.V.; Kumar, H.; Kim, I.S.; Koppulla, S.; Kim, B.W.; Choi, D.K. Strategic selection of neuroinflammatory models in Parkinson’s disease: Evidence from experimental studies. CNS Neurol Disord. Drug Targets 2013, 12, 680–697. [Google Scholar] [CrossRef] [PubMed]
- Aquilano, K.; Baldelli, S.; Rotilio, G.; Ciriolo, M.R. Role of nitric oxide synthases in Parkinson’s disease: A review on the antioxidant and anti-inflammatory activity of polyphenols. Neurochem. Res. 2008, 33, 2416–2426. [Google Scholar] [CrossRef] [PubMed]
- Dheen, S.T.; Kaur, C.; Ling, E.A. Microglial activation and its implications in the brain diseases. Curr. Med. Chem. 2007, 14, 1189–1197. [Google Scholar] [CrossRef] [PubMed]
- Alyaa, M. Panax ginseng—A review. Univ. Thi-Qar. J. Sci. 2019, 7, 96–102. [Google Scholar]
- Sun, B.S.; Gu, L.J.; Fang, Z.M.; Wang, C.Y.; Wang, Z.; Lee, M.R.; Li, Z.; Li, J.J.; Sung, C.K. Simultaneous quantification of 19 ginsenosides in black ginseng developed from Panax ginseng by HPLC–ELSD. J. Pharm. Biomed. Anal. 2009, 50, 15–22. [Google Scholar] [CrossRef]
- Lee, M.R.; Ma, J.Y.; Sung, C.K. Chronic dietary ginseng extract administration ameliorates antioxidant and cholinergic systems in the brains of aged mice. J. Ginseng Res. 2017, 41, 615–619. [Google Scholar] [CrossRef]
- Lee, Y.Y.; Saba, E.; Irfan, M.; Kim, M.; Chan, J.Y.L.; Jeon, B.S.; Choi, S.K.; Rhee, M.H. The anti-inflammatory and anti-nociceptive effects of Korean black ginseng. Phytomedicine 2019, 54, 169–181. [Google Scholar] [CrossRef]
- Lee, Y.S.; Kim, K.W.; Yoon, D.; Kim, G.S.; Kwon, D.Y.; Kang, O.H.; Lee, D.Y. Comparison of Antivirulence Activities of Black Ginseng against Methicillin-Resistant Staphylococcus aureus According to the Number of Repeated Steaming and Drying Cycles. Antibiotics 2021, 10, 617. [Google Scholar] [CrossRef]
- Saba, E.; Jeong, D.H.; Roh, S.S.; Kim, S.H.; Kim, S.D.; Kim, H.K.; Rhee, M.H. Black ginseng-enriched Chong-Myung-Tang extracts improve spatial learning behavior in rats and elicit anti-inflammatory effects in vitro. J. Ginseng Res. 2017, 41, 151–158. [Google Scholar] [CrossRef]
- Sharma, J.N.; Al-Omran, A.; Parvathy, S.S. Role of nitric oxide in inflammatory diseases. Inflammopharmacology 2007, 15, 252–259. [Google Scholar] [CrossRef]
- Kamalian, A.; Asl, M.S.; Dolatshahi, M.; Afshari, K.; Shamshiri, S.; Roudsari, N.M.; Momtaz, S.; Rahimi, R.; Abdollahi, M.; Abdolghaffari, A.H. Interventions of natural and synthetic agents in inflammatory bowel disease, modulation of nitric oxide pathways. World J. Gastroenterol. 2020, 26, 3365–3400. [Google Scholar] [CrossRef]
- Guix, F.X.; Uribesalgo, I.; Coma, M.; Muñoz, F.J. The physiology and pathophysiology of nitric oxide in the brain. Prog. Neurobiol. 2005, 76, 126–152. [Google Scholar] [CrossRef] [PubMed]
- Choudhari, S.K.; Chaudhary, M.; Bagde, S.; Gadbail, A.R.; Joshi, V. Nitric oxide and cancer: A review. World J. Surg. Oncol. 2013, 11, 118. [Google Scholar] [CrossRef] [PubMed]
- Hämäläinen, M.; Lilja, R.; Kankaanranta, H.; Moilanen, E. Inhibition of iNOS expression and NO production by anti-inflammatory steroids: Reversal by histone deacetylase inhibitors. Pulm. Pharmacol. Ther. 2008, 21, 331–339. [Google Scholar] [CrossRef]
- Kawahara, K.; Hohjoh, H.; Inazumi, T.; Tsuchiya, S.; Sugimoto, Y. Prostaglandin E2-induced inflammation: Relevance of prostaglandin E receptors. Biochim. Biophys. Acta. 2015, 1851, 414–421. [Google Scholar] [CrossRef] [PubMed]
- Tsuge, K.; Inazumi, T.; Shimamoto, A.; Sugimoto, Y. Molecular mechanisms underlying prostaglandin E2-exacerbated inflammation and immune diseases. Int. Immunol. 2019, 31, 597–606. [Google Scholar] [CrossRef]
- Gandhi, J.; Khera, L.; Gaur, N.; Paul, C.; Kaul, R. Role of Modulator of Inflammation Cyclooxygenase-2 in Gammaherpesvirus Mediated Tumorigenesis. Front. Microbiol. 2017, 8, 538. [Google Scholar] [CrossRef]
- Zhang, J.M.; An, J. Cytokines, inflammation, and pain. Int. Anesthesiol. Clin. Spring 2007, 45, 27–37. [Google Scholar] [CrossRef]
- Liu, M.; Saredy, J.; Zhang, R.; Shao, Y.; Sun, Y.; Yang, W.Y.; Wang, J.; Liu, L.; Drummer, C.; Johnson, C.; et al. Approaching Inflammation Paradoxes-Proinflammatory Cytokine Blockages Induce Inflammatory Regulators. Front. Immunol. 2020, 11, 554301. [Google Scholar] [CrossRef]
- Galic, M.A.; Riazi, K.; Pittman, Q.J. Cytokines and brain excitability. Front. Neuroendocrinol. 2012, 33, 116–125. [Google Scholar] [CrossRef]
- Lawrence, T. The nuclear factor NF-kappaB pathway in inflammation. Cold Spring Harb. Perspect. Biol. 2009, 1, a001651. [Google Scholar] [CrossRef] [PubMed]
- Im, E.J.; Kim, S.J.; Hong, S.B.; Park, J.K.; Rhee, M.H. Anti-Inflammatory Activity of Bee Venom in BV2 Microglial Cells: Mediation of MyD88-Dependent NF-κB Signaling Pathway. Evid. Based Complement. Alternat. Med. 2016, 2016, 3704764. [Google Scholar] [CrossRef] [PubMed]
- Cui, Y.; Wu, J.; Jung, S.C.; Kim, G.O.; Ko, R.K.; Lee, H.J.; Yoo, E.S.; Kang, H.K.; Suk, K.; Eun, S.Y. Neuroprotective effect of methyl lucidone against microglia-mediated neurotoxicity. Eur. J. Pharmacol. 2012, 690, 4–12. [Google Scholar] [CrossRef] [PubMed]
- Kaminska, B. MAPK signaling pathways as molecular targets for anti-inflammatory therapy—From molecular mechanisms to therapeutic benefits. Biochim. Biophys. Acta-Proteins Proteomics 2005, 1754, 253–262. [Google Scholar] [CrossRef]
- Thalhamer, T.; McGrath, M.; Harnett, M. MAPKs and their relevance to arthritis and inflammation. Rheumatology 2008, 47, 409–414. [Google Scholar] [CrossRef]
- Cargnello, M.; Roux, P.P. Activation and function of the MAPKs and their substrates, the MAPK-activated protein kinases. Microbiol. Mol. Biol. Rev. 2011, 75, 50–83. [Google Scholar] [CrossRef]
- Kaminska, B.; Gozdz, A.; Zawadzka, M.; Ellert-Miklaszewska, A.; Lipko, M. MAPK signal transduction underlying brain inflammation and gliosis as therapeutic target. Anat. Rec. 2009, 292, 1902–1913. [Google Scholar] [CrossRef]
- Kim, H.N.; Park, G.H.; Park, S.B.; Kim, J.D.; Eo, H.J.; Son, H.J.; Song, J.H.; Jeong, J.B. Sageretia thea Inhibits Inflammation through Suppression of NF-κB and MAPK and Activation of Nrf2/HO-1 Signaling Pathways in RAW264.7 Cells. Am. J. Chin. Med. 2019, 47, 385–403. [Google Scholar] [CrossRef]
- Li, C.; Chen, T.; Zhou, H.; Zhang, C.; Feng, Y.; Tang, F.; Hoi, M.P.M.; He, C.; Zheng, Y.; Lee, S.M.Y. Schisantherin A Attenuates Neuroinflammation in Activated Microglia: Role of Nrf2 Activation Through ERK Phosphorylation. Cell Physiol. Biochem. 2018, 47, 1769–1784. [Google Scholar] [CrossRef] [PubMed]
- Lin, S.; Yin, Q.; Zhong, Q.; Lv, F.L.; Zhou, Y.; Li, J.Q.; Wang, J.Z.; Su, B.Y.; Yang, Q.W. Heme activates TLR4-mediated inflammatory injury via MyD88/TRIF signaling pathway in intracerebral hemorrhage. J. Neuroinflamm. 2012, 9, 46. [Google Scholar] [CrossRef] [PubMed]
- Zhou, K.; Wu, J.; Chen, J.; Zhou, Y.; Chen, X.; Wu, Q.; Xu, Y.; Tu, W.; Lou, X.; Yang, G.; et al. Schaftoside ameliorates oxygen glucose deprivation-induced inflammation associated with the TLR4/Myd88/Drp1-related mitochondrial fission in BV2 microglia cells. J. Pharmacol. Sci. 2019, 139, 15–22. [Google Scholar] [CrossRef]
- Parajuli, B.; Sonobe, Y.; Kawanokuchi, J.; Doi, Y.; Noda, M.; Takeuchi, H.; Mizuno, T.; Suzumura, A. GM-CSF increase LPS-induced production of proinflammatory mediators via upregulation of TLR4 and CD14 in murine microglia. J. Neuroinflamm. 2012, 9, 268. [Google Scholar] [CrossRef]
- Lu, L.C.; Yeh, W.C.; Ohashi, P.S. LPS/TLR4 signal transduction pathway. Cytokine 2008, 42, 145–151. [Google Scholar] [CrossRef]
- Li, P.; Chang, M. Roles of PRR-Mediated Signaling Pathways in the Regulation of Oxidative Stress and Inflammatory Diseases. Int. J. Mol. Sci. 2021, 22, 7688. [Google Scholar] [CrossRef] [PubMed]
- Kawai, T.; Akira, S. The role of pattern-recognition receptors in innate immunity: Update on Toll-like receptors. Nat. Immunol. 2010, 11, 373–384. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.W.; Ji, S.H.; Choi, B.R.; Choi, D.J.; Lee, Y.G.; Kim, H.G.; Kim, G.S.; Kim, K.; Lee, Y.H.; Baek, N.I.; et al. UPLC-QTOF/MS-Based Metabolomics Applied for the Quality Evaluation of Four Processed Panax ginseng Products. Molecules 2018, 23, 2062. [Google Scholar] [CrossRef]
- Lin, W.M.; Zhang, Y.M.; Moldzio, R.; Rausch, W.D. Ginsenoside Rd attenuates neuroinflammation of dopaminergic cells in culture. J. Neural. Transm. Suppl. 2007, 72, 105–112. [Google Scholar]
- Li, Z.; Zhao, L.; Chen, J.; Liu, C.; Li, S.; Hua, M.; Qu, D.; Shao, Z.; Sun, Y. Ginsenoside Rk1 alleviates LPS-induced depression-like behavior in mice by promoting BDNF and suppressing the neuroinflammatory response. Biochem. Biophys. Res. Commun. 2020, 530, 658–664. [Google Scholar] [CrossRef]
- Lee, Y.Y.; Park, J.S.; Jung, J.S.; Kim, D.H.; Kim, H.S. Anti-inflammatory effect of ginsenoside Rg5 in lipopolysaccharide-stimulated BV2 microglial cells. Int. J. Mol. Sci. 2013, 14, 9820–9833. [Google Scholar] [CrossRef] [PubMed]
- Park, S.M.; Choi, M.S.; Sohn, N.W.; Shin, J.W. Ginsenoside Rg3 attenuates microglia activation following systemic lipopolysaccharide treatment in mice. Biol. Pharm. Bull. 2012, 35, 1546–1552. [Google Scholar] [CrossRef] [PubMed]
- Song, Y.N.; Lee, J.-W.; Ryu, H.W.; Lee, J.K.; Oh, E.S.; Kim, D.-Y.; Ro, H.; Yoon, D.; Park, J.-Y.; Hong, S.-T.; et al. Black Ginseng Extract Exerts Potentially Anti-Asthmatic Activity by Inhibiting the Protein Kinase Cθ-Mediated IL-4/STAT6 Signaling Pathway. Int. J. Mol. Sci. 2023, 24, 11970. [Google Scholar] [CrossRef]
- Kim, K.W.; Kim, H.J.; Sohn, J.H.; Yim, J.H.; Kim, Y.C.; Oh, H. Antineuroinflammatory effect of 6,8,1′-tri-O-methylaverantin, a metabolite from a marine-derived fungal strain Aspergillus sp., via upregulation of heme oxygenase-1 in lipopolysaccharide-activated microglia. Neurochem. Int. 2017, 113, 8–22. [Google Scholar] [CrossRef] [PubMed]
Compounds | Retention Time (min) | Calibration Equation a | Correlation Coefficient (r2) | Linear Range (μg/mL) |
---|---|---|---|---|
Ginsenoside Rd | 46.567 | = 1.8886+ 1.0527 | 0.9991 | 1.56~200 |
Ginsenoside Rg3 | 53.452 | = 2.2189+ 1.8239 | 0.9958 | 1.56~200 |
Ginsenoside Rk1 | 58.347 | = 2.4681+ 0.5814 | 0.9983 | 1.56~200 |
Ginsenoside Rg5 | 58.845 | = 3.2204+ 2.9636 | 0.9979 | 1.56~200 |
Compounds | Contents (mg/g) | RSD * (%) |
---|---|---|
Ginsenoside Rd | 0.190 ± 0.011 | 5.768 |
Ginsenoside Rg3 | 2.060 ± 0.090 | 4.373 |
Ginsenoside Rk1 | 2.332 ± 0.085 | 3.631 |
Ginsenoside Rg5 | 2.294 ± 0.079 | 3.448 |
Gene Name | Forward Primers (5′-3′) | Reverse Primers (5′-3′) |
---|---|---|
IL-6 | ACTTCACAAGTCGGAGGCTT | TGTTGCTACTATCGTGAACGT |
TNF-α | CCAGACCCTCACACTCACAA | CGGCTACCCAACATGGAACA |
TLR4 | GGCAACTTGGACCTGAGGAG | CCATGT GTCCATGGGCTCT |
MyD88 | ACTGAAGGAGCTGAAGTCGC | CGAAAAGTTCCGGCGTTTGT |
GAPDH | TTCACCACCATGGAGAAGGC | AGTACTGGTGTCAGGTACGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, K.-W.; Lee, Y.-S.; Choi, B.-R.; Yoon, D.; Lee, D.Y. Anti-Neuroinflammatory Effect of the Ethanolic Extract of Black Ginseng through TLR4-MyD88-Regulated Inhibition of NF-κB and MAPK Signaling Pathways in LPS-Induced BV2 Microglial Cells. Int. J. Mol. Sci. 2023, 24, 15320. https://doi.org/10.3390/ijms242015320
Kim K-W, Lee Y-S, Choi B-R, Yoon D, Lee DY. Anti-Neuroinflammatory Effect of the Ethanolic Extract of Black Ginseng through TLR4-MyD88-Regulated Inhibition of NF-κB and MAPK Signaling Pathways in LPS-Induced BV2 Microglial Cells. International Journal of Molecular Sciences. 2023; 24(20):15320. https://doi.org/10.3390/ijms242015320
Chicago/Turabian StyleKim, Kwan-Woo, Young-Seob Lee, Bo-Ram Choi, Dahye Yoon, and Dae Young Lee. 2023. "Anti-Neuroinflammatory Effect of the Ethanolic Extract of Black Ginseng through TLR4-MyD88-Regulated Inhibition of NF-κB and MAPK Signaling Pathways in LPS-Induced BV2 Microglial Cells" International Journal of Molecular Sciences 24, no. 20: 15320. https://doi.org/10.3390/ijms242015320