Development of SynBio Tools for Pseudomonas chlororaphis: A Versatile Non-Pathogenic Bacterium Host
Abstract
1. Introduction
2. Results
2.1. Generation of Inducible Expression Plasmids for P. chlororaphis
2.2. Characterization of Induction Response of SAY Plasmids
2.3. Quorum-Sensing Mechanisms Generate Auto-Induction in the LuxR-AHL System
2.4. Expression of the Violacein Heterologous Pathway in P. chlororaphis
2.5. Violacein Production in a 3 L Fermenter
2.6. Simulation of Violacein Production with a Modified iMA1267 Model
3. Discussion
4. Materials and Methods
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hutchison, C.A.; Chuang, R.Y.; Noskov, V.N.; Assad-Garcia, N.; Deerinck, T.J.; Ellisman, M.H.; Gill, J.; Kannan, K.; Karas, B.J.; Ma, L.; et al. Design and Synthesis of a Minimal Bacterial Genome. Science 2016, 351, aad6253. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.; Wang, J.; Meldrum, D.R. Application of Synthetic Biology in Cyanobacteria and Algae. Front. Microbiol. 2012, 3, 1–15. [Google Scholar] [CrossRef] [PubMed]
- de Lorenzo, V.; Krasnogor, N.; Schmidt, M. For the Sake of the Bioeconomy: Define What a Synthetic Biology Chassis Is! N. Biotechnol. 2021, 60, 44–51. [Google Scholar] [CrossRef] [PubMed]
- Sridhar, S.; Ajo-Franklin, C.M.; Masiello, C.A. A Framework for the Systematic Selection of Biosensor Chassis for Environmental Synthetic Biology. ACS Synth. Biol. 2022, 11, 2909–2916. [Google Scholar] [CrossRef] [PubMed]
- Nikel, P.I.; Martínez-García, E.; De Lorenzo, V. Biotechnological Domestication of Pseudomonads Using Synthetic Biology. Nat. Rev. Microbiol. 2014, 12, 368–379. [Google Scholar] [CrossRef] [PubMed]
- Nikel, P.I.; Chavarría, M.; Danchin, A.; de Lorenzo, V. From Dirt to Industrial Applications: Pseudomonas Putida as a Synthetic Biology Chassis for Hosting Harsh Biochemical Reactions. Curr. Opin. Chem. Biol. 2016, 34, 20–29. [Google Scholar] [CrossRef]
- Peng, H.; Ouyang, Y.; Bilal, M.; Wang, W.; Hu, H.; Zhang, X. Identification, Synthesis and Regulatory Function of the N-Acylated Homoserine Lactone Signals Produced by Pseudomonas Chlororaphis HT66. Microb. Cell Fact. 2018, 17, 9. [Google Scholar] [CrossRef] [PubMed]
- Elbehiry, A.; Marzouk, E.; Aldubaib, M.; Moussa, I.; Abalkhail, A.; Ibrahem, M.; Hamada, M.; Sindi, W.; Alzaben, F.; Almuzaini, A.M.; et al. Pseudomonas Species Prevalence, Protein Analysis, and Antibiotic Resistance: An Evolving Public Health Challenge. AMB Express 2022, 12, 53. [Google Scholar] [CrossRef]
- Rabiço, F.; Pedrino, M.; Narcizo, J.P.; de Andrade, A.R.; Reginatto, V.; Guazzaroni, M.E. Synthetic Biology Toolkit for a New Species of Pseudomonas Promissory for Electricity Generation in Microbial Fuel Cells. Microorganisms 2023, 11, 2044. [Google Scholar] [CrossRef]
- Tienda, S.; Vida, C.; Lagendijk, E.; de Weert, S.; Linares, I.; González-Fernández, J.; Guirado, E.; de Vicente, A.; Cazorla, F.M. Soil Application of a Formulated Biocontrol Rhizobacterium, Pseudomonas Chlororaphis PCL1606, Induces Soil Suppressiveness by Impacting Specific Microbial Communities. Front. Microbiol. 2020, 11, 548323. [Google Scholar] [CrossRef]
- Raio, A.; Puopolo, G. Pseudomonas Chlororaphis Metabolites as Biocontrol Promoters of Plant Health and Improved Crop Yield. World J. Microbiol. Biotechnol. 2021, 37, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Liu, K.; Hu, H.; Wang, W.; Zhang, X. Genetic Engineering of Pseudomonas Chlororaphis GP72 for the Enhanced Production of 2-Hydroxyphenazine. Microb. Cell Fact. 2016, 15, 131. [Google Scholar] [CrossRef] [PubMed]
- Anderson, A.J.; Kim, Y.C. Biopesticides Produced by Plant-Probiotic Pseudomonas Chlororaphis Isolates. Crop Prot. 2018, 105, 62–69. [Google Scholar] [CrossRef]
- Shen, X.; Wang, Z.; Huang, X.; Hu, H.; Wang, W.; Zhang, X. Developing Genome-Reduced Pseudomonas Chlororaphis Strains for the Production of Secondary Metabolites. BMC Genom. 2017, 18, 715. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Fu, C.; Liu, K.; Cui, J.; Hu, H.; Wang, W.; Zhang, X. Engineering a Synthetic Pathway for Gentisate in Pseudomonas Chlororaphis P3. Front. Bioeng. Biotechnol. 2021, 8, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Guo, S.; Hu, H.; Wang, W.; Bilal, M.; Zhang, X. Production of Antibacterial Questiomycin A in Metabolically Engineered Pseudomonas Chlororaphis HT66. J. Agric. Food Chem. 2022, 70, 7742–7750. [Google Scholar] [CrossRef] [PubMed]
- Anderson, J.A.; Staley, J.; Challender, M.; Heuton, J. Safety of Pseudomonas Chlororaphis as a Gene Source for Genetically Modified Crops. Transgenic. Res. 2018, 27, 103–113. [Google Scholar] [CrossRef] [PubMed]
- Moreno-Avitia, F.; Utrilla, J.; Bolívar, F.; Nogales, J.; Escalante, A. Metabolic Reconstruction of Pseudomonas Chlororaphis ATCC 9446 to Understand Its Metabolic Potential as a Phenazine-1-Carboxamide-Producing Strain. Appl. Microbiol. Biotechnol. 2020, 104, 10119–10132. [Google Scholar] [CrossRef]
- Winsor, G.L.; Griffiths, E.J.; Lo, R.; Dhillon, B.K.; Shay, J.A.; Brinkman, F.S.L. Enhanced Annotations and Features for Comparing Thousands of Pseudomonasgenomes in the Pseudomonas Genome Database. Nucleic Acids Res. 2016, 44, D646–D653. [Google Scholar] [CrossRef]
- Yue, S.J.; Song, C.; Li, S.; Huang, P.; Guo, S.Q.; Hu, H.B.; Wang, W.; Zhang, X.H. Synthesis of Cinnabarinic Acid by Metabolically Engineered Pseudomonas Chlororaphis GP72. Biotechnol. Bioeng. 2019, 116, 3072–3083. [Google Scholar] [CrossRef]
- Wan, Y.; Liu, H.; Xian, M.; Huang, W. Biosynthesis and Metabolic Engineering of 1-Hydroxyphenazine in Pseudomonas Chlororaphis H18. Microb. Cell Fact. 2021, 20, 235. [Google Scholar] [CrossRef] [PubMed]
- Meyer, A.J.; Segall-Shapiro, T.H.; Glassey, E.; Zhang, J.; Voigt, C.A. Escherichia Coli “Marionette” Strains with 12 Highly Optimized Small-Molecule Sensors. Nat. Chem. Biol. 2019, 15, 196–204. [Google Scholar] [CrossRef] [PubMed]
- Engler, C.; Kandzia, R.; Marillonnet, S. A One Pot, One Step, Precision Cloning Method with High Throughput Capability. PLoS ONE 2008, 3, e3647. [Google Scholar] [CrossRef] [PubMed]
- Morohoshi, T.; Yabe, N.; Yaguchi, N.; Xie, X.; Someya, N. Regulation of Phenazine-1-Carboxamide Production by Quorum Sensing in Type Strains of Pseudomonas Chlororaphis Subsp. Chlororaphis and Pseudomonas Chlororaphis Subsp. Piscium. J. Biosci. Bioeng. 2022, 133, 541–546. [Google Scholar] [CrossRef] [PubMed]
- González-Valdez, A.; Escalante, A.; Soberón-Chávez, G. Heterologous Production of Rhamnolipids in Pseudomonas Chlororaphis Subsp ChlororaphisATCC 9446 Based on the Endogenous Production of N.-acyl-homoserine Lactones. Microb. Biotechnol. 2023, 17, e14377. [Google Scholar] [CrossRef] [PubMed]
- Fang, M.Y.; Zhang, C.; Yang, S.; Cui, J.Y.; Jiang, P.X.; Lou, K.; Wachi, M.; Xing, X.H. High Crude Violacein Production from Glucose by Escherichia Coli Engineered with Interactive Control of Tryptophan Pathway and Violacein Biosynthetic Pathway. Microb. Cell Fact. 2015, 14, 8. [Google Scholar] [CrossRef] [PubMed]
- Schwanemann, T.; Otto, M.; Wierckx, N.; Wynands, B. Pseudomonas as Versatile Aromatics Cell Factory. Biotechnol. J. 2020, 15, 1900569. [Google Scholar] [CrossRef]
- Dixon, T.A.; Freemont, P.S.; Johnson, R.A.; Pretorius, I.S. A Global Forum on Synthetic Biology: The Need for International Engagement. Nat. Commun. 2022, 13, 3516. [Google Scholar] [CrossRef]
- Rodrigues, A.L.; Trachtmann, N.; Becker, J.; Lohanatha, A.F.; Blotenberg, J.; Bolten, C.J.; Korneli, C.; de Souza Lima, A.O.; Porto, L.M.; Sprenger, G.A.; et al. Systems Metabolic Engineering of Escherichia Coli for Production of the Antitumor Drugs Violacein and Deoxyviolacein. Metab. Eng. 2013, 20, 29–41. [Google Scholar] [CrossRef]
- Franzino, T.; Boubakri, H.; Cernava, T.; Abrouk, D.; Achouak, W.; Reverchon, S.; Nasser, W.; el Zahar Haichar, F. Implications of Carbon Catabolite Repression for Plant–Microbe Interactions. Plant Commun. 2022, 3, 100272. [Google Scholar] [CrossRef]
- Löwe, H.; Sinner, P.; Kremling, A.; Pflüger-Grau, K. Engineering Sucrose Metabolism in Pseudomonas Putida Highlights the Importance of Porins. Microb. Biotechnol. 2020, 13, 97–106. [Google Scholar] [CrossRef] [PubMed]
- Patricia Bedoya-Pérez, L.; Aguilar-Vera, A.; Sánchez-Pérez, M.; Sohlenkamp, C. Enhancing Escherichia Coli Abiotic Stress Resistance through Ornithine Lipid Formation. bioRxiv 2023. [Google Scholar] [CrossRef]
- Swain, P.S.; Stevenson, K.; Leary, A.; Montano-Gutierrez, L.F.; Clark, I.B.N.; Vogel, J.; Pilizota, T. Inferring Time Derivatives Including Cell Growth Rates Using Gaussian Processes. Nat. Commun. 2016, 7, 13766. [Google Scholar] [CrossRef] [PubMed]
- Ebrahim, A.; Lerman, J.A.; Palsson, B.O.; Hyduke, D.R. COBRApy: COnstraints-Based Reconstruction and Analysis for Python. BMC Syst. Biol. 2013, 7, 74. [Google Scholar] [CrossRef] [PubMed]





| Vector | Regulatory Element | ORF |
|---|---|---|
| SAY-AHL-YFP | LuxI/LuxR system (AHL) | Yellow fluorescent protein |
| SAY-IPTG-YFP | LacI repressor (IPTG) | Yellow fluorescent protein |
| SAY-AHL-sfGFP | LuxI/LuxR system (AHL) | Green fluorescent protein |
| SAY-IPTG-sfGFP | LacI repressor (IPTG) | Green fluorescent protein |
| SAY-AHL-Vio | LuxI/LuxR system (AHL) | Violacein synthesis pathway |
| SAY-IPTG-Vio | LacI repressor (IPTG) | Violacein synthesis pathway |
| SAY-AHL-SapI | LuxI/LuxR system (AHL) | Empty |
| SAY-IPTG-SapI | LacI repressor (IPTG) | Empty |
| Primers | Use | Sequence |
|---|---|---|
| SEVA 631_fwd | SEVA 631 amplification for Gibson Assembly | ggtccccaataattacgatttaaatttga |
| SEVA 631_rev | SEVA 631 amplification for Gibson Assembly | tcctgtgtgaaattgttatccgct |
| AJM(AHL)_fwd | Universal primer for amplification of Marionette plasmid´s for Gibson Assembly | gataacaatttcacacaggaatggctcataacaccccttg |
| AJM(AHL)_rev | Universal primer for amplification of Marionette plasmid´s for Gibson Assembly | aatcgtaattattggggaccggtgatgtcggcgatatag |
| Screening YFP FWD | Screening SEVA-AJM assembly | agggcgaggagctgttca |
| Screening YFP REV | Screening SEVA-AJM assembly | cttgtacagctcgtccatgc |
| Assembly Vio on AJM-SEVA FWD | SAY amplification for Gibson Assembly with Vio Operon | ctcggtaccaaattccagaaaagag |
| Assembly Vio on AJM-SEVA REV | SAY amplification for Gibson Assembly with Vio Operon | ctagtatttcccctctttctctagtattaaac |
| VioCDE _rev | pAJM.336Vio amplification for Gibson Assembly with Vio Operon | tggtaccgagtaggcgtatcacgaggcag |
| VioCDE _fwd | pAJM.336Vio amplification for Gibson Assembly with Vio Operon | ctaaggatcctaaggatcctactagagaaagagg |
| VioAB_fwd | pAJM.336Vio amplification for Gibson Assembly with Vio Operon | aggatccttaggatccttaggcctctctag |
| VioAB_rev | pAJM.336Vio amplification for Gibson Assembly with Vio Operon | gaaatactagatgaagcattcttccgatatc |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bello-González, M.A.; Bedoya-Perez, L.P.; Pantoja-Zepeda, M.A.; Utrilla, J. Development of SynBio Tools for Pseudomonas chlororaphis: A Versatile Non-Pathogenic Bacterium Host. SynBio 2024, 2, 112-124. https://doi.org/10.3390/synbio2020007
Bello-González MA, Bedoya-Perez LP, Pantoja-Zepeda MA, Utrilla J. Development of SynBio Tools for Pseudomonas chlororaphis: A Versatile Non-Pathogenic Bacterium Host. SynBio. 2024; 2(2):112-124. https://doi.org/10.3390/synbio2020007
Chicago/Turabian StyleBello-González, Miguel Angel, Leidy Patricia Bedoya-Perez, Miguel Alberto Pantoja-Zepeda, and Jose Utrilla. 2024. "Development of SynBio Tools for Pseudomonas chlororaphis: A Versatile Non-Pathogenic Bacterium Host" SynBio 2, no. 2: 112-124. https://doi.org/10.3390/synbio2020007
APA StyleBello-González, M. A., Bedoya-Perez, L. P., Pantoja-Zepeda, M. A., & Utrilla, J. (2024). Development of SynBio Tools for Pseudomonas chlororaphis: A Versatile Non-Pathogenic Bacterium Host. SynBio, 2(2), 112-124. https://doi.org/10.3390/synbio2020007

