Previous Article in Journal
Pedicularis dieshanensis (Orobanchaceae), a New Species from the Die Mountains, China
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Taxonomy
Volume 6
Issue 2
10.3390/taxonomy6020033
taxonomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Taxonomy and Phylogeny Reveal a Cryptic New Species of Opuntia (Cactaceae) from Tamaulipas, Mexico †

by
César Ramiro Martínez-González
1,
Tania Raymundo
2,
Fortunato Garza-Ocañas
3,
Leccinum J. García-Morales
1,
Jaime Jiménez-Ramírez
4 and
Jesús García Jimenéz
1,*
1
Instituto Tecnológico de Ciudad Victoria, Tecnológico Nacional de México, Ciudad Victoria 87010, Tamaulipas, Mexico
2
Escuela Nacional de Ciencias Biológicas, Instituto Politécnico Nacional, Alcaldía Miguel Hidalgo, Ciudad de México 11340, Mexico
3
Facultad de Ciencias Forestales, Universidad Autónoma de Nuevo León, Linares 67700, Nuevo León, Mexico
4
Facultad de Ciencias, Universidad Nacional Autónoma de México, Alcaldía Coyoacán, Ciudad de México 04510, Mexico
*
Author to whom correspondence should be addressed.
†
urn:lsid:ipni.org:names:77379786-1.
Taxonomy 2026, 6(2), 33; https://doi.org/10.3390/taxonomy6020033
Submission received: 19 January 2026 / Revised: 30 April 2026 / Accepted: 1 May 2026 / Published: 20 May 2026
Browse Figures
Versions Notes

Abstract

Opuntia miquihuanensis (Cactaceae: Opuntioideae), a new species endemic to the locality Peña-Aserradero, part of the Sierra Madre Oriental, Tamaulipas, Mexico, is formally described and illustrated. Phylogenetic analyses used maximum parsimony, maximum likelihood and Bayesian inference, based on sequences of trnL-trnF, psbJ-petA, matK, ycf1, ppc and ITS. The micromorphology of spines, epidermis, stoma, and pollen was characterized with scanning electron microscopy. Opuntia miquihuanensis is recovered as a supported species within Opuntia s.str.

1. Introduction

The cactus family (Cactaceae) contains charismatic ornamental horticultural plants, which belong to the order Caryophyllales, with approximately 174 genera and nearly 1850 species [1,2,3]. Mexico is considered the main center of diversity of the family [4].
They exhibit a range of life forms from geophytes and cushion plants to dwarf shrubs, shrubs, or small trees [5].
The tribe Opuntieae DC. (Cactaceae Juss., Opuntioideae K. Schum.) consists of the following seven genera: Airampoa Frič, Brasiliopuntia Berger, Consolea Lemaire, Miqueliopuntia Frič ex F. Ritter, Opuntia Miller, Salmonopuntia P. V. Heath and Tacinga Britton & Rose [3].
Opuntia (L.) Miller is one of the most iconic groups and it is recognized as the second most speciose genus within the family after Mammillaria Haworth [6], comprising approximately 154 species [3], 97 of which are found in Mexico and species continue to be added. The genus has undergone a rapid radiation, resulting in a broad distribution and high morphological diversity among species [7], thrives predominantly in the arid and semiarid regions of America, and is cultivated globally [7]. Opuntia species are stress-tolerant (e.g., salinity, drought), succulent CAM plants with highly efficient water use [8].
One of the most critical areas for Cactaceae diversity is northern Mexico, where Sthe state of Tamaulipas is located. Some studies have been carried out in Tamaulipas that integrate knowledge about this family, such as the distribution analysis carried out by Martínez-Ávalos and Jurado [9]; meanwhile, García-Morales [10,11] deals with the richness and distribution of the cacti of the Sierra Madre Oriental and neighboring montane isolated regions of the Sierra de San Carlos and Sierra de Tamaulipas, and recently produced two studies at the State level, documenting 40 [12] and 36 [13] species of Opuntia, which suggests a lack of botanical explorations in the State of Tamaulipas.
During the scientific exploration in the Miquihuana Municipality, in the Sierra Madre Oriental, west of the State of Tamaulipas, we found a species of Opuntia that, due to its morphological characteristics, does not fit into known species, but shares characteristics of members of the Rhizomatosa clade. Therefore, it is proposed here as a new species.

2. Materials and Methods

2.1. Species Sampling

The specimens were widely studied in the wild at Km. 12, path Ejido La Peña-Aserradero, Miquihuana, Mexico (Figure 1). The morphological description and photographs are based on wild specimens.
Morphological observations and measurements were made with the aid of a digital caliper. The relevant literature was analyzed [13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32].
Taxonomy 06 00033 g001
Figure 1. Map showing the type locality of Opuntia miquihuanensis, in the Miquihuana Municipality, State of Tamaulipas, Mexico. The map was generated using ArcMap 10 (ESRI, Redlands, CA, USA).
Figure 1. Map showing the type locality of Opuntia miquihuanensis, in the Miquihuana Municipality, State of Tamaulipas, Mexico. The map was generated using ArcMap 10 (ESRI, Redlands, CA, USA).
Taxonomy 06 00033 g001

2.2. Surface Analysis (SEM)

Spines, epidermis and pollen were studied by SEM from material collected in situ and fixed in FAA (formol, alcohol and acetic acid) for 48 h. All materials were dissected under a stereomicroscope (Leica MZ 75, Wetzlar, Germany) (manufacturer, city, and country), dehydrated in an ethanol series, subjected to critical point drying in a Bal-Tec CPD 030, mounted on metal stubs using double-sided carbon tape, and then coated in gold in an Emitech K550X sputter coater (Kent, United Kingdom). All SEM observations were performed using a Hitachi, SU1510 model scanning electron microscope (Hitachi, Tokyo, Japan), at 10 KV at the Institute of Biology of the Universidad Nacional Autónoma de México (UNAM). The measurements were obtained using the Image Tool version 3.0 image analyzer [33].

2.3. Data from Herbaria

We reviewed the collections of the following herbaria: (ANSM, CHAP, CHAPA, CHIP, CICY, CIIDIR, ECO-TA-H, ECO-SH-H, ENCB, FCME, FMVZ, HEM, HUAA, IBUG, IEB, INEGI, INIF, ITCV, MEXU, SLPM, UAG, UAQ, UAS, UAT, UJAT, XAL and ZEA), and (virtual herbarium databases) at F, HUH, MO, NY, REMIB and US were examined (acronyms according to Thiers 2026 [34] [continuously update]). The species’ identity was verified for each specimen examined.

2.4. Isolation of DNA Extraction

The DNA was obtained from 50–100 mg of the plant stem. Genomic DNA was extracted using the CTAB method [35]. The DNA was quantified with a Nanodrop 2000c (Thermo, Waltham, MA, USA). We prepared dilutions from each sample at 20 ng to amplify the genes.

2.5. PCR Amplification and Sequencing

The reaction mixture for PCR was prepared in a final volume of 15 μL. The PCR amplification reaction procedure involved pre-denaturation at 94 °C for 4 min, followed by 35 cycles of denaturation at 94 °C for 45 s, annealing at 1 min at a specific temperature for each gene (Table 1), and extension at 72 °C for 5 min. The PCR products were analyzed using 1.2% agarose gel electrophoresis at a setting voltage of 87 V and current of 100 mA for 55~60 min. The amplified products were purified using the ExoSAP Purification kit (Affymetrix, Santa Clara, CA, USA), according to the manufacturer’s instructions. These products were sequenced in both directions with an Applied Biosystems model 3730XL (Applied BioSystems, Waltham, MA, USA), at the Instituto de Biología of the Universidad Nacional Autónoma de México (UNAM).

2.6. Sequence Assembly

The sequences of both strands of each of the genes were analyzed, edited, and assembled using BioEdit version 7.0.5 [42] to generate a consensus sequence. These consensus sequences were compared with those deposited in GenBank of the National Center for Biotechnology Information (NCBI), using the BLAST 2.2.19 tool [43].

2.7. Phylogenetic Methods

The sequences were subjected to standard BLAST searches in GenBank database to ensure taxon and gene matches.
To infer the phylogenetic relationships of the new species of Opuntia within the Opuntia sensu stricto clade an alignment was made based on the taxonomic sampling employed by Majure et al. (2012) [41], including Mexican species [44,45]. Sequences were generated from the chloroplast regions (matK, ycf1, trnL intron, the trnL-trnF spacer, and psbj-petA), ppc, and the ITS nuclear region (Table 2). Each region was independently aligned using the online version of MAFFT v7.490 with the E-INS-i algorithm, a 100PAM/k = 2 scoring matrix, a 1.3 gap open penalty, and a 0.123 offset value [46,47,48]. The alignments were reviewed in PhyDE v.10.0 [49], followed by minor manual adjustments to ensure character homology of every nucleotide at each position in the alignment. The collective chloroplast dataset (matK, ycf1, psbJ-petA, trnL-trnF), ppc and the ITS were analyzed separately and then concatenated to produce a total evidence dataset. Not all gene regions were available for all taxa and some taxa had incomplete datasets. Missing data were treated as a continuous series of Ns in concatenated datasets [50]. Given the dataset draws from different loci, topological incongruence between partitions (nuclear markers vs. chloroplast markers) was examined using the incongruence length difference (ILD) test implemented in PAUP* 4.0a169 [51] with 1000 heuristic after the removal of all invariable characters. The data were analyzed using maximum parsimony (MP), maximum likelihood (ML), and Bayesian inference (BI). Maximum parsimony analyses were carried out in PAUP* 4.0a169 [51] using the heuristic search mode, with 1000 random starting replicates and TBR branch swapping, with MULTREES and Collapse on. Bootstrap values were estimated using 1000 bootstrap replicates under the heuristic search mode, each with 100 random starting replicates. Bayesian inference was performed in MrBayes v3.2.6 x64 [52,53]. Two independent Markov chain Monte Carlo (MCMC) analyses were performed in parallel, each consisting of four chains run for 3.5 million generations. This run length was sufficient for the standard deviation of split frequencies to fall below 0.01, indicating convergence of the chains. Trees were sampled every 100 generations. PartitionFinder [54,55,56] was used to select the best-fitting mode for BI and ML analyses. Substitution models were assigned separately to each partition based on the specific evolutionary patterns of each marker as follows: a TIM1+G model was applied to matK, a TIM3+G model to ycf1, a TVM+G model to the psbJ-petA spacer, a TPM1uf+G model to the trnL intron and the trnL–trnF intergenic spacer, a HKY+G+I for ITS, and HKY+G for ppc. Default priors were used, and all substitution model parameters were unlinked across loci. Tracer 1.6 [57] was employed to assess stationarity and determine an appropriate burn-in period. After discarding burn-in samples, the remaining trees from both runs were combined to construct a 50% majority-rule consensus topology, with nodal support evaluated using posterior probabilities (BIPP). ML analysis was conducted using RAxML v.8.2.10, which performed 1000 rapid bootstrap replicates followed by a search for the best-scoring tree in a single run. The best-fit model GTR+G for the combined dataset for BI and ML was selected under the Akaike Information Criterion (AIC) using PartitionFinder [54,56]. The phylogenetic trees were edited using Figtree 1.4.3 (http://tree.bio.ed.ac.uk/software/figtree/, accessed on 1 May 2026).

3. Results

3.1. Phylogenetic Results

Thef combined matK + ycf1 + psbJ-petA + trnL-trnF + ITS + ppc dataset comprises 65 taxa with 5399 characters, including gaps. The three phylogenetic analyses, MP, ML, and BI, were conducted and resulted in generally congruent topologies. The best RAxML tree with a final likelihood value of –29540.258400 is presented. The matrix had 1101 distinct alignment patterns, with 9.84% undetermined characters or gaps. Estimated base frequencies were as follows: A = 0.108624, C = 0.200816, G = 0.280341, and T = 0.262750; substitution rates AC = 1.108312, AG = 2.083041, AT = 1.831201, CG = 1.030428, CT = 6.106258, and GT = 1.000000; gamma distribution shape parameter α = 0.100084. In the Bayesian analysis, the standard deviation between the chains stabilized at 0.0002 after 3.5 million generations. No significant changes in tree topology trace or cumulative split frequencies of selected nodes were observed after about 1.5 million generations, so the first 980,000 sampled trees (25%) were discarded as burn-in. To confirm that the sample size was sufficient, the parameter file was examined in Tracer 1.6 [57,58], and all parameters had an estimated sample size above 1500. Both the maximum parsimony, maximum likelihood, and Bayesian inference recovered Opuntia miquihuanensis, supporting the existence of a new taxon distinctive from related species of Opuntia s. str. (BS = 100%, BS = 100%, BI = 1) (Figure 2).

3.2. Taxonomic Treatment

Opuntia miquihuanensis Martínez-Gon., García-Mor. & García-Jim., sp. nov. (Figure 3).
Type: MEXICO, Tamaulipas, Miquihuana Municipality, 23°36′03.79″ N, 99°42′22.88″ E, elevation 2663 m, 26 March 2016, García-Morales 5345B (holotype: ITCV!; isotypes: CHAP! and CHAPA!).
Diagnosis: O. miquihuanensis shows greater similarity to O. pachyrrhiza, but differs in having longer cladodes, a greater number of areole series, straight (75–100°), diffuse (21–74°), and radial or adpressed (0–20°) spines, as well as longer fruits with a pedunculate-claviform shape.
Description: Low-growing habit, 30–40 cm in height (Figure 4A). Trunk not defined. Epidermis glabrous (Figure 8C). Rhizome erect, succulent, tuberiform. Cladodes elliptical, 18–21 × 12–17 cm, and approximately 1.8 cm thick, green (Figure 4C). Areoles arranged in 6–7 series, 2.3 cm apart between series, 2 cm apart between areoles, elliptical to obovate, 0.4 × 0.1–0.2 cm, with short, dark-colored trichomes. Brown, short glochids (0.2 cm). Spines 1–11 per areole, white with amber or dark-tipped apices, setose, porrect and divergent, unequal, 0.5–4.3 cm long (Figure 5B). Juvenile cladodes light green, with prominent tubercles; areoles bearing short, cream-colored trichomes; leaves subulate, erect, green with reddish and hooked apices (Figure 4B). Floral buds acute; perianth segments reddish with acuminate apices; pericarpels turbinate with elevated tubercles; areoles bearing long, cream-colored trichomes; glochids yellow (Figure 5C,D). Flowers yellow (Figure 5E), 10–11 cm long; pericarpel turbinate, ca. 4.7 × 2.3 cm; areoles arranged in three series, spaced 1.1 cm apart, with a thick basal scale; outer perianth segments obovate, emarginate at the apex, yellow with a green stripe; inner segments obovate, apices acuminate, yellow; stamens one-third the length of the perianth (Figure 6B); filaments white; anthers yellow; style cuneate, ca. 2.5 cm long, white; stigma lobes eight, papillose, ca. 0.5 cm long, green with a whitish median stripe. Pollen grains hexagonal, tectate, suprareticulate, with broad and slightly verrucose walls (Figure 8E). Fruits pedunculate (Figure 6F), 6.1–6.5 cm long, 3.1–3.6 cm wide, yellowish green; floral scar slightly depressed (0.6 cm), slightly striate (Figure 7B); areoles small, arranged in 3–4 series, circular to semicircular, with long gray trichomes (Figure 7C), spaced 1.5 cm apart and 2.2 cm between series; spines almost absent, white to reddish; walls thin, greenish-white and tasteless; pyriform 2.1–2.4 cm long; funicule white, succulent, and tasteless (Figure 7A). Seeds slightly reniform or discoidal, cream-colored, ca. 0.32 cm in diameter; aril lateral, irregular; hilum–micropylar region lateral, slightly depressed; micropyle and funicle included (Figure 7D).
Taxonomy 06 00033 g003
Figure 3. Opuntia miquihuanensis. (A) Low-growing habit. (B) Spines. (C) Areole. (D) Juvenile cladode. (E) Mature cladode. (F) Flower side view. (G) Flower in anthesis. (H) Pyriform fruits. (I) Inner part of the fruit. Illustration by Ericka Belén Cortez on the type specimen García-Morales 5345B (ITCV).
Figure 3. Opuntia miquihuanensis. (A) Low-growing habit. (B) Spines. (C) Areole. (D) Juvenile cladode. (E) Mature cladode. (F) Flower side view. (G) Flower in anthesis. (H) Pyriform fruits. (I) Inner part of the fruit. Illustration by Ericka Belén Cortez on the type specimen García-Morales 5345B (ITCV).
Taxonomy 06 00033 g003
Taxonomy 06 00033 g004
Figure 4. Opuntia miquihuanensis. (A) Plant prostate, trunk not defined. (B) Juvenile cladode with elevated podaria, white spines with amber tips, some with reddish bases. (C) Dark green elliptical cladodes covered with a wax layer.
Figure 4. Opuntia miquihuanensis. (A) Plant prostate, trunk not defined. (B) Juvenile cladode with elevated podaria, white spines with amber tips, some with reddish bases. (C) Dark green elliptical cladodes covered with a wax layer.
Taxonomy 06 00033 g004
Taxonomy 06 00033 g005
Figure 5. Opuntia miquihuanensis. (A) Elliptical black areole, and base with five spines. (B) White spines with amber tips. (C) Flower button, upper view. (D) Lateral view of the flower button, turbinate pericarpel with brown bristles. (E) Yellow flower in anthesis. (F) Flower side view, turbinate pericarpel with brown bristles.
Figure 5. Opuntia miquihuanensis. (A) Elliptical black areole, and base with five spines. (B) White spines with amber tips. (C) Flower button, upper view. (D) Lateral view of the flower button, turbinate pericarpel with brown bristles. (E) Yellow flower in anthesis. (F) Flower side view, turbinate pericarpel with brown bristles.
Taxonomy 06 00033 g005
Taxonomy 06 00033 g006
Figure 6. Opuntia miquihuanensis. (A) Should be longitudinal section of flower. (B) Obovate yellow inner segments, acuminate apex. (C) Outer segments of obovate perianth, emarginate apex, yellow, with a green stripe in the middle. (D) Style white. (E) Eight green papillose stigma lobes, with a white midstripe. (F) Yellowish green color of the fruit.
Figure 6. Opuntia miquihuanensis. (A) Should be longitudinal section of flower. (B) Obovate yellow inner segments, acuminate apex. (C) Outer segments of obovate perianth, emarginate apex, yellow, with a green stripe in the middle. (D) Style white. (E) Eight green papillose stigma lobes, with a white midstripe. (F) Yellowish green color of the fruit.
Taxonomy 06 00033 g006
Taxonomy 06 00033 g007
Figure 7. Opuntia miquihuanensis. (A) Longitudinal cut of the fruit. (B) Floral scar depressed, slightly striate. (C) Areoles small, circular with long gray trichomes. (D) Reniform or discoidal seed with irregular lateral aril.
Figure 7. Opuntia miquihuanensis. (A) Longitudinal cut of the fruit. (B) Floral scar depressed, slightly striate. (C) Areoles small, circular with long gray trichomes. (D) Reniform or discoidal seed with irregular lateral aril.
Taxonomy 06 00033 g007

3.3. Micromorphology

Spines with long, wide and lignified epidermal cells in the apical part, 120.40 ± 1.2 µm and 19.17 ± 1.3 µm, respectively (Figure 8A), the middle part of the spine with epidermal cells of 88.66 ± 1.8 µm long and 16.21 ± 1.2 µm wide, non-continuous epidermal cells with fissures between cells and smooth texture (Figure 8B). Glabrous epidermis (Figure 8C), irregular epidermal cells (Figure 8D), and paracytic stomata (Figure 8D). Pollen grains, with polyhedron shape, pantoaperturate (Figure 8E), 102.90 ± 3.2 μm in diameter, 7504.45 μm2 in area, 17.39 ± 2.9 μm, distance between each distal opening (pores), with a diameter of 25.16 ± 1.5 μm, 16–17 pores with walls of 1.77 ± 0.02 μm, width and warty (Figure 8F).

3.4. Etymology

The epithet refers to the municipality of Miquihuana, Tamaulipas, where this new species is found as a microendemic taxon and the only known distribution area of this new species.

3.5. Phenology

It flowers once a year in March–April, and depending on the distribution of rainfall during the cycle, it usually reaches maturity in July–August.

3.6. Distribution and Habitat

This species is by now only found around natural open grasslands and flatlands on the top of mountains among pine and oak forests, between the 1600 and 1800 m elevation (Figure 9).

3.7. Conservation Status

This species was found during visits to the type locality in 2016, and recently again in 2023 and 2024; only 10 individuals were observed in the type location, and a few dozen more were scattered along a larger area within the municipality. Considering that its natural habitat is highly altered by habitat loss and livestock grazing, it is herein proposed as “Critically Endangered” CR B1ab (i, ii, iii, v)” + 2ab (i, ii, iii, v) under the UICN criteria (IUCN Standards and Petitions Committee 2022). In addition, this species should be considered for its inclusion in a protection category (i.e., subject to special protection) within the Mexican Official Standard on threatened species (NOM-059-SEMARNAT 2010) [59].

4. Discussion

Mexico is a highly varied country with mountain ranges, plateaus, deep canyons, and coastal plains among other relief features, this complex physiography result from the interaction of five tectonic plates [60]. The Sierra Madre Oriental (SMO), located in northeastern Mexico, is home to 6981 species of vascular plants, of which 1542 are endemic [61], and constitutes one of the five mountain ranges of the Mexican Transition Zone, where the Nearctic and Neotropical biogeographic realms meet [62], and from a biological viewpoint is one of the most important mountain systems in Mexico. Temperate forests in the SMO occur in high “island mountain ranges” surrounded by contrasting vegetation types and are characterized by high endemism, suggesting geographical isolation is an important factor enhancing allopatric speciation processes [62].
In recent years, the species documentation of Opuntia in Tamaulipas has increased substantially, with García-Morales et al. [12] adding 31 new records not mentioned in the Mexican Cactus Inventory [16], the checklist of Cactaceae [9] and the checklist of Mexican vascular plants [63].
A total of 5500 specimens of the genus Opuntia were examined from the herbaria consulted; only 12 correspond to O. pachyrrhiza, all from the MEXU and SLPM collections.
In the phylogenetic analysis, species belonging to the Rhizomatosa clade were included: O. chaffeyi, O. megarrhiza, O. miquihuanensis, and two individuals of O. pachyrrhiza (Puente 601 and 1260). These taxa formed a monophyletic clade, which is congruent with their shared possession of rhizomes. O. miquihuanensis is supported as an independent lineage from the other known rhizomatous species.
Morphologically, O. miquihuanensis shows greater similarity to O. pachyrrhiza (Table 3), differing in having longer cladodes, a greater number of areole series, straight (75–100°), diffuse (21–74°), and radial or adpressed (0–20°) spines, as well as longer fruits with a pedunculate–claviform shape. At the type locality of O. miquihuanensis, O. pachyrrhiza is also present, and the latter corresponds to the description provided by Hernández et al. [20]. Therefore, O. miquihuanensis is not a hybrid derived from O. pachyrrhiza, as no ambiguities were observed in the ITS region (ITS1, 5.8, ITS2).
Interestingly O. miquihuanensis lives together with O. pachyrrhyza in the mountains of Miquihuana, Tamaulipas, the reason it remained hidden as a cryptic species until this study. Opuntia megarrhiza is also found nearby the known locations of this new taxon, supporting the biogeographical concept of a speciation area including three of the four known species of this group of Opuntia.
The diversity and phylogenetic relationships within the genus Opuntia remain insufficiently studied, with only a few species having been formally molecularly characterized to date.
This study establishes an integrative framework for delimiting one novel Opuntia species. The discovery of O. miquihuanensis represents a significant advancement in our understanding of the morphological and phylogenetic of Opuntia, a recently established genus (around 7.5 mya) of nopales [64,65].
This finding supports the original concept of the genus as a cohesive evolutionary lineage defined by both morphological and molecular characters.

Author Contributions

Conceptualization, C.R.M.-G., L.J.G.-M. and J.G.J.; methodology, T.R., J.J.-R., F.G.-O. and L.J.G.-M.; formal analysis, C.R.M.-G. and L.J.G.-M.; investigation, C.R.M.-G. and J.G.J.; resources, J.G.J.; writing―original draft preparation, C.R.M.-G.; writing―review and editing, C.R.M.-G., L.J.G.-M. and J.G.J. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Tecnológico Nacional de México, Instituto Tecnológico de Ciudad Victoria, throughout the Programa de Doctorado en Ciencias en Biología.

Data Availability Statement

The original contribution presented in the study is included in the article, and further inquiries can be directed to the corresponding author.

Acknowledgments

The authors thank Laura Márquez and Nelly López (LaNaBio, Instituto de Biología, Universidad Nacional Autónoma de México) for sequencing the PCR products. They also thank Berenit Mendoza (LaNaBio, Instituto de Biología, Universidad Nacional Autónoma de México) for taking the images in the scanning electron microscope and Ericka Belén Cortez for the wonderful illustration.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Novoa, A.; Le Roux, J.J.; Robertson, M.P.; Wilson, J.R.; Richardson, D.M. Introduced and invasive cactus species: A global review. AoB PLANTS 2014, 7, plu078. [Google Scholar] [CrossRef]
  2. Abouseadaa, H.H.; Atia, M.A.M.; Younis, I.Y.; Issa, M.Y.; Ashour, H.A.; Saleh, I.; Osman, G.H.; Arif, I.A.; Mohsen, E. Gene-targeted molecular phylogeny, phytochemical profiling, and antioxidant activity of nine species belonging to family Cactaceae. Saudi J. Biol. Sci. 2020, 27, 1649–1658. [Google Scholar] [CrossRef] [PubMed]
  3. Korotkova, N.; Aquino, D.; Arias, S.; Eggli, U.; Franck, A.; Gómez-Hinostrosa, C.; Guerrero, P.C.; Hernández, H.M.; Kohlbecker, A.; Köhler, M.; et al. Cactaceae at Caryophyllales.org—A dynamic online species-level taxonomic backbone for the family. Willdenowia 2021, 51, 251−270. [Google Scholar] [CrossRef]
  4. Goettsch, B.; Hernández, H.M. Beta diversity and similarity among cactus assemblages in the Chihuahuan Desert. J. Arid. Environ. 2006, 65, 513–528. [Google Scholar] [CrossRef]
  5. Ritz, C.M.; Reiker, J.; Charles, G.; Hoxey, P.; Hunt, D.; Lowry, M.; Stuppy, W.; Taylor, N. Molecular phylogeny and character evolution in terete-stemmed Andean opuntias (Cactaceae-Opuntioideae). Mol. Phylogenet. Evol. 2012, 65, 668–681. [Google Scholar] [CrossRef] [PubMed]
  6. Hernández-Ledesma, P.; Berendsohn, W.G.; Borsch, T.; Mering, S.V.; Akhani, H.; Arias, S.; Castañeda-Noa, I.; Eggli, U.; Eriksson, R.; Flores-Olvera, H.; et al. A taxonomic backbone for the global synthesis of species diversity in the angiosperm order Caryophyllales. Willdenowia 2015, 45, 281–383. [Google Scholar] [CrossRef]
  7. Anderson, E.F. The Cactus Family; Timber Press: Portland, OR, USA, 2001. [Google Scholar]
  8. Vilà, M.; Burriel, J.A.; Pino, J.; Chamizo, J.; Llach, E.; Porterias, M.; Vives, M. Association between Opuntia species invasion and changes in land-cover in the Mediterranean region. Glob. Change Biol. 2003, 9, 1234–1239. [Google Scholar] [CrossRef]
  9. Martínez-Avalos, J.G.; Jurado, E. Geographic distribution and conservation of Cactaceae from Tamaulipas Mexico. Biodivers. Conserv. 2005, 14, 2483–2506. [Google Scholar] [CrossRef]
  10. García-Morales, L.J. Contribución al conocimiento de la diversidad taxonómica de las cactáceas (Caryophyllales, Cactaceae) en Tamaulipas, México. In La biodiversidad en Tamaulipas; Cruz Angón, A., López Higareda, D., Malgarejo, E.D., Rodríguez Ruiz, E.R., Eds.; Comisión Nacional para el Conocimiento y Uso de la Biodiversidad (CONABIO): Mexico City, Mexico, 2024; pp. 127–138. [Google Scholar]
  11. García-Morales, L.J. Estudio Sobre la Diversidad, Distribución y Algunos Aspectos Ecológicos de las Cactáceas (Caryophyllales: Cactaceae) de la Sierra Madre Oriental, Sierra de San Carlos y Zonas Adyacentes en el Estado de Tamaulipas, México. Bachelor’s Thesis, Instituto Tecnológico de Ciudad Victoria, Ciudad Victoria, Mexico, 2006. [Google Scholar]
  12. García-Morales, L.J.; García-Jiménez, J.; Contreras-Medina, R.; Alcántara-Ayala, O.; Luna-Vega, I. Diversity, distribution and conservation of the Cactaceae (Caryophyllales) from Tamaulipas Mexico. Plant Biosyst. 2022, 156, 1405–1421. [Google Scholar] [CrossRef]
  13. García-Morales, L.J.; Contreras-Medina, R.; Alcántara-Ayala, O.; Luna-Vega, I.; García-Jiménez, J. Biodiversidad Tamaulipeca Vol. I; Dirección General de Educación Superior Tecnológica (DGEST)—Instituto Tecnológico de Ciudad Victoria: Ciudad Victoria, Mexico, 2005. [Google Scholar]
  14. Bravo-Hollis, H. Las Cactáceas de México Vol. 1; Universidad Nacional Autónoma de México: Mexico City, Mexico, 1978; 351p. [Google Scholar]
  15. Britton, N.L.; Rose, J.N. The Cactaceae: Description and illustrations of Plants of the Cactus Family, Vol. 1; Carnegie Institution: Washington, DC, USA, 1919; 236p. [Google Scholar]
  16. Guzmán, U.L.; Arias, S.; Dávila, P. Catálogo de Cactáceas Mexicanas; Universidad Nacional Autónoma de México: Mexico City, Mexico, 2003; 315p. [Google Scholar]
  17. Hunt, D.; Taylor, N.; Charles, G. The New Cactus Lexicon; DH Books: Milborne Port, UK, 2006. [Google Scholar]
  18. Hunt, D. Further Studies in Opuntioideae (Cactaceae). Succ. Pl. Res. 2014, 8, 185−200. [Google Scholar]
  19. Hunt, D. CITES Cactaceae Checklist, 3rd ed.; DH Books: Milborne Port, UK, 2016. [Google Scholar]
  20. Hernández, H.M.; Gómez-Hinostrosa, C.; Bárcenas, R.T. Studies on Mexican Cactaceae. I. Opuntia pachyrrhiza, a new species from the Chihuahuan Desert, Mexico. Novon 2001, 11, 309–314. [Google Scholar] [CrossRef]
  21. Lodé, J. Taxonomy of the Cactaceae (Supplement); Alphabetical INDEX of Taxa in Current Usage and Their Synonyms; Cactus Adventures International: Barcelona, Spain, 2015; 46p. [Google Scholar]
  22. Martínez-González, C.R. Opuntia × soumaya (Cactaceae; Opuntioideae), a new hybrid from Mexico based on morphological, micromorphology and molecular evidence. Phytotaxa 2025, 717, 31–51. [Google Scholar] [CrossRef]
  23. Parfitt, B.D.; Pinkava, D.J. Nomenclatural systematic reassessment of Opuntia engelmanii and Opuntia lindheimeri (Cactaceae). Madroño 1988, 35, 342−349. [Google Scholar]
  24. Pinkava, D.J. Nomenclatural changes in Opuntia (Cactaceae). Haseltonia 1996, 4, 103−104. [Google Scholar]
  25. Pinkava, D.J. On the evolution of the continental North American Opuntioideae. Studies in the Opuntioideae (Cactaceae). Succ. Pl. Res. 2002, 6, 59–98. [Google Scholar]
  26. Scheinvar, L. Opuntia heliabravoana, Una Especie Nueva de Cactaceae; Anales del Instituto de Biología, Universidad Nacional Autónoma de México, Serie Botánica: Mexico City, Mexico, 1974; Volume 45, pp. 75–86. [Google Scholar]
  27. Scheinvar, L. Redescubrimiento de Opuntia oligacantha Forster en el Valle de México y en la Altiplanicie Mexicana; Anales del Instituto de Biología, Universidad Nacional Autónoma de México, Serie Botánica: Mexico City, Mexico, 1987; Volume 57, pp. 109–122. [Google Scholar]
  28. Scheinvar, L. Opuntia zamudioi, una nueva especie de Querétaro. Cactáceas Suculentas Mex. 1999, 44, 88−93. [Google Scholar]
  29. Scheinvar, L. Opuntia stricta (Haw.) Haw. subsp. esparzae, una nueva subespecie de las dunas del río Concá, Arroyo Seco, Querétaro, México. Cactáceas Suculentas Mex. 2002, 47, 94−102. [Google Scholar]
  30. Scheinvar, L.; Manzanero, G. Opuntia chiangiana, una nueva especie de Cactaceae de Oaxaca, México. Novon 2009, 19, 222−228. [Google Scholar] [CrossRef]
  31. Scheinvar, L.; Olalde, G.; Filardo, S.; Beckler, P. Diez Especies Mexicanas Productoras de Xoconostles: Opuntia spp. y Cylindropuntia imbricata (Cactaceae); Universidad Nacional Autónoma de México: Mexico City, Mexico; Universidad Autónoma del estado de Hidalgo: Mexico City, Mexico; Universidad Autónoma Metropolitana: Mexico City, Mexico, 2010; 177p. [Google Scholar]
  32. Scheinvar, L.; Gallegos-Vázquez, C.; Gámez-Tamariz, N.; Olalde-Parra, G. Atlas de los Nopales Silvestres Mexicanos; Universidad Nacional Autónoma de México: Mexico City, Mexico, 2020; 607p. [Google Scholar]
  33. Wilcox, C.D.; Dove, S.; McDavis, W.; Greer, D. Image Tool, version 3.0; University of Texas Health Center: San Antonio, TX, USA, 2002. [Google Scholar]
  34. Thiers, B. Index Herbariorum: A Global Directory of Public Herbaria and Associated Staff. New York Botanical Garden’s Virtual Herbarium. Available online: https://sweetgum.nybg.org/science/ih/ (accessed on 1 February 2025).
  35. Martínez-González, C.R.; Ramírez-Mendoza, R.; Jiménez-Ramírez, J.; Gallegos-Vázquez, C.; Luna-Vega, I. Improved method for genomic DNA extraction for Opuntia Mill. (Cactaceae). Plant Methods 2017, 13, 82. [Google Scholar] [CrossRef] [PubMed]
  36. Schmitz-Linneweber, C.; Maier, R.; Jean-Pierre, A.; Cottet, A.; Herrmann, R.; Mache, R. The plastid chromosome of spinach (Spinacia oleracea): Complete nucleotide sequence and gene organization. Plant Mol. Biol. 2001, 45, 307−315. [Google Scholar] [CrossRef] [PubMed]
  37. Dong, W.; Xu, C.; Li, C.; Sun, J.; Zuo, Y.; Shi, S.; Cheng, T.; Guo, J.; Zhou, S. ycf1, the most promising plastid DNA barcode of land plants. Sci. Rep. 2015, 5, 8348. [Google Scholar] [CrossRef]
  38. Taberlet, P.G.; Ludovic, P.; Guy, P.; Bouvet, J. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol. 1991, 17, 1105−1109. [Google Scholar] [CrossRef]
  39. Shaw, J.; Lickey, E.B.; Schilling, E.E.; Small, R.L. Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperms: The tortoise and the hare III. Am. J. Bot. 2007, 94, 275−288. [Google Scholar] [CrossRef]
  40. White, T.J.; Bruns, T.D.; Lee, S.B.; Taylor, J.W. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: New York, NY, USA, 1990; pp. 135–322. [Google Scholar]
  41. Majure, L.; Puente, R.; Griffith, M.P.; Judd, W.S.; Soltis, P.S.; Soltis, D.E. Phylogeny of Opuntia s.s. (Cactaceae): Clade delineation, geographic origins, and reticulate evolution. Am. J. Bot. 2012, 99, 847−864. [Google Scholar] [CrossRef]
  42. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95−98. [Google Scholar]
  43. Zhang, Z.; Schwartz, S.; Wagner, L.; Miller, W. A greedy algorithm for aligning DNA sequences. J. Comput. Biol. 2000, 7, 203−214. [Google Scholar] [CrossRef] [PubMed]
  44. Martínez-González, C.R.; Gallegos-Vázquez, C.; Scheinvar, L.; Muñiz-Díaz de León, M.E.; Jiménez-Ramírez, J. Re-evaluation of Opuntia matudae (Cactaceae). Phytotaxa 2019, 423, 158−170. [Google Scholar] [CrossRef]
  45. Martínez-González, C.R.; Muñiz-Díaz de León, M.E.; González-Martínez, C.A.; Jiménez-Ramírez, J.; Morales-Sandoval, J.; Gallegos-Vázquez, C. Phylogenetic placement and new data on macro- and micromorphology of Opuntia joconostle (Cactaceae). Bradleya 2020, 38, 158−169. [Google Scholar] [CrossRef]
  46. Katoh, K.; Misawa, K.; Kuma, K.; Miyata, T. MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 2002, 30, 3059–3066. [Google Scholar] [CrossRef]
  47. Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. 2017, 20, 1160–1166. [Google Scholar] [CrossRef] [PubMed]
  48. Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772−780. [Google Scholar] [CrossRef]
  49. Müller, K.; Quandt, D.; Müller, J.; Neinhuis, C. PhyDE®-Phylogenetic Data Editor. Program Distributed by the Authors, Versión 10.0. Available online: http://www.phyde.de/ (accessed on 16 April 2025).
  50. Wiens, J.J. Missing data and the design of phylogenetic analyses. J. Biomed. Inform. 2006, 39, 34−42. [Google Scholar] [CrossRef]
  51. Swofford, D.L. PAUP*, Phylogenetic Analysis Using Parsimony (* and Other Methods); Version 4.10; Sinauer Associates: Sunderland, MA, USA, 2002. [Google Scholar]
  52. Huelsenbeck, J.P.; Ronquist, F. MrBayes: Bayesian inference of phylogeny. Bioinformatics 2001, 17, 754−755. [Google Scholar] [CrossRef]
  53. Huelsenbeck, J.P.; Larget, B.; Alfaro, M.E. Bayesian phylogenetic model selection using reversible jump Markov Chain Montecarlo. Mol. Biol. Evol. 2004, 21, 1123−1133. [Google Scholar] [CrossRef] [PubMed]
  54. Frandsen, P.B.; Calcott, B.; Mayer, C.; Lanfear, R. Automatic selection of partitioning schemes for phylogenetic analyses using iterative k-means clustering of site rates. BMC Evol. Biol. 2015, 15, 13. [Google Scholar] [CrossRef]
  55. Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef] [PubMed]
  56. Lanfear, R.; Frandsen, P.B.; Wright, A.M.; Senfeld, T.; Calcott, B. PartitionFinder 2: New methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Mol. Biol. Evol. 2016, 34, 772−773. [Google Scholar] [CrossRef] [PubMed]
  57. Rambaut, A.; Drummond, A.J.; Xie, D.; Baele, G.; Suchard, M.A. Posterior Summarization in Bayesian Phylogenetics Using Tracer 1.7. Syst. Biol. 2018, 67, 901–904. [Google Scholar] [CrossRef]
  58. Bouckaert, R.; Heled, J.; Kühnert, D.; Vaughan, T.; Wu, C.-H.; Xie, D.; Suchard, M.A.; Rambaut, A.; Drummond, A.J. BEAST 2: A software platform for Bayesian Evolutionary analysis. PLoS Comput. Biol. 2014, 10, E1003537. [Google Scholar] [CrossRef]
  59. SEMARNAT. Secretaría de Medio Ambiente y Recursos Naturales (2010) Norma Oficial Mexicana NOM-059-SEMARNAT; Diario Oficial de la Federación (DOF): Mexico City, Mexico, 2010.
  60. Estrada, A.E.; Arévalo, J.R.; Villarreal, J.A.; Salinas, M.M.; Encina-Domínguez, J.A.; González, H.; Cantú, C.M. Classification and ordination of main plant communities along an altitudinal gradient in the arid and temperate climates of northeastern Mexico. Sci. Nat. 2015, 102, 59. [Google Scholar] [CrossRef]
  61. Salinas-Rodríguez, M.M.; Hernández-Sandoval, L.; Carrillo-Reyes, P.; Castillo-Gómez, H.A.; Castro-Castro, A.; Estrada-Castillón, E.; Figueroa-Martínez, D.S.; Gómez-Escamilla, I.N.; González-Elizondo, M.; Gutiérrez-Ortega, J.S.; et al. Diversidad de plantas vasculares de la Provincia Fisiográfica de la Sierra Madre Oriental, México. Bot. Sci. 2022, 100, 469–492. [Google Scholar] [CrossRef]
  62. Halftter, G.; Morrone, J.J. An analytical review of Halffter’s Mexican transition zone, and its relevance for evolutionary biogeography, ecology and biogeographical regionalization. Zootaxa 2017, 4226, 1–46. [Google Scholar] [CrossRef] [PubMed]
  63. Villaseñor, J. Checklist of the native vascular plants of Mexico. Rev. Mex. Biodiv. 2016, 87, 559–902. [Google Scholar] [CrossRef]
  64. Vázquez-Sánchez, M.; Terrazas, T.; Arias, S.; Ochoterena, H. Molecular phylogeny, origin and taxonomic implications of the tribe Cacteae (Cactaceae). Syst. Biodivers. 2013, 11, 103–116. [Google Scholar] [CrossRef]
  65. Majure, L.C.; Achá, S.; Baker, M.A.; Puente-Martínez, R.; Köhler, M.; Fehlberg, S. Phylogenomics of One of the World’s Most Intriguing Groups of CAM Plants, the Opuntioids (Opuntioideae: Cactaceae): Adaptation to Tropical Dry Forests Helped Drive Prominent Morphological Features in the Clade. Diversity 2023, 15, 570. [Google Scholar] [CrossRef]
Taxonomy 06 00033 g002
Figure 2. Phylogram of Opuntia s.s., based on the concatenated matK, ycf1, psbJ-petA, trnL-trnF, ITS, and ppc sequence alignment. For each node, the following values are provided: maximum parsimony (MP ≥ 90%, left)/maximum likelihood bootstrap (ML ≥ 90%, middle), and Bayesian inference posterior probability (BIPP ≥ 0.90, right). The phylogenetic position of Opuntia miquihuanensis is shown in bold. The scale bar represents the expected number of nucleotide substitutions per site.
Figure 2. Phylogram of Opuntia s.s., based on the concatenated matK, ycf1, psbJ-petA, trnL-trnF, ITS, and ppc sequence alignment. For each node, the following values are provided: maximum parsimony (MP ≥ 90%, left)/maximum likelihood bootstrap (ML ≥ 90%, middle), and Bayesian inference posterior probability (BIPP ≥ 0.90, right). The phylogenetic position of Opuntia miquihuanensis is shown in bold. The scale bar represents the expected number of nucleotide substitutions per site.
Taxonomy 06 00033 g002
Taxonomy 06 00033 g008
Figure 8. Opuntia miquihuanensis. (A) Epidermal cells of the middle region of the spine, with fissures between cells and rough texture. (B) Epidermal cells of the apical region of the spine. (C) Glabrous epidermis. (D) Irregular epidermal cells, paracytic stoma. (E) Pollen grains are hexagonal, tectate, and suprareticulate. (F) Close-up of a pore, with slightly warty walls.
Figure 8. Opuntia miquihuanensis. (A) Epidermal cells of the middle region of the spine, with fissures between cells and rough texture. (B) Epidermal cells of the apical region of the spine. (C) Glabrous epidermis. (D) Irregular epidermal cells, paracytic stoma. (E) Pollen grains are hexagonal, tectate, and suprareticulate. (F) Close-up of a pore, with slightly warty walls.
Taxonomy 06 00033 g008
Taxonomy 06 00033 g009
Figure 9. Habitat of Opuntia miquihuanensis (indicated with a white arrow) at the type locality.
Figure 9. Habitat of Opuntia miquihuanensis (indicated with a white arrow) at the type locality.
Taxonomy 06 00033 g009
Table 1. Primers were used in this study.
Table 1. Primers were used in this study.
Loci/SegmentNameSequence 5′-3′Tm (°C)Reference
matk1326RTCTAGCACACGAAAGTCGAAGT48[36]
390FCGATCTATTCATTCAATATTTC48[36]
ycf1118 FCTTATCTCTTACTTCTCCAAGCTC52[37]
1330RGCGGCTAAACTAGGTGGATGTG52[37]
trnL-trnFCCGAAATCGGTAGACGCTACG50[38]
DGGGGATAGAGGGACTTGAAC50[38]
EGGTTCAAGTCCCTCTATCCC50[38]
FATTTGAACTGGTGACACGAG50[38]
psbJ-petApsbJATAGGTACTGTARCYGGTATT50[39]
petAAACARTTYGARAAGGTTCAATT50[39]
ITSITS5GGAAGTAAAAGTCGTAACAAGG57[40]
ITS4TCCTCCGCTTATTGATATGC57[40]
ppcOp 19FGAGATGAGGGCAGGGATGAGTTACTTCC55[41]
Op 569RCTAGCCAACAAGCAAACATC55[41]
Table 2. GenBank accession numbers correspond to the sequences used in the phylogenetic analyses. The newly generated sequences are indicated in bold and missing sequences are indicated by –.
Table 2. GenBank accession numbers correspond to the sequences used in the phylogenetic analyses. The newly generated sequences are indicated in bold and missing sequences are indicated by –.
Species NameGenBank Accessions
trnL-trnFmatKITSpsbJ-petAycf1ppc
Brasiliopuntia brasiliensisJF712685JF786712JF786876JF787469JN387143JN387207
Maihueniopsis ovataJF712696JF786723JF786887JF787479JN387144JN387208
Miqueliopuntia miqueliiJF712698JF786725JF786889JF787480JN387145JN387210
Opuntia auberiJF712699JF786726JF786890JF787481JN387146JN387211
Opuntia chaffeyiJF712733JF786761JF786922JF787513––
Opuntia cochenilliferaJF712700JF786727JF786891JF787482JN387147JN387212
Opuntia dejecta–JF786729JF786893–JN387148JN387213
Opuntia gaumeriJF712702JF786730JF786894JF787484JN387149JN387214
Opuntia inapertaJF712706JF786734JF786898JF787488JN387151JN387216
Opuntia karwinskianaJF712707JF786735JF786899JF787489JN387152JN387217
Opuntia abjectaJF712838JF786865JF787021JF787598JN387199JN387264
Opuntia arechavalataeJF712714JF786742JF786906JF787496JN387155JN387220
Opuntia arenariaJF712715JF786743JF786907–JN387155JN387220
Opuntia aureispinaJF712718JF786746JF786910JF787607JN387158JN387223
Opuntia austrinaJF712719JF786747JF786911JF787499JQ676985JN387224
Opuntia basilarisJF712722JF786750JF786913JF787502JN387159JN387225
Opuntia caracassanaJF712729JF786757JF786918JF787509JN387159JN387225,
Opuntia chisosensisJF712734JF786762JF786923JF787514JN387159JN387225
Opuntia chloroticaJF712735JF786763JF786924JF787608JN387162JN387228
Opuntia delafuentianaKM678218KM678215KM678221–––
Opuntia drummondiiJF712742JF786770JF786930JF787520JN387163JN387229
Opuntia elataJF712746JF786774JF786934–JN387164JN387230
Opuntia ellisianaJF712747JF786775JF786935JF787523JN387166JN387232
Opuntia excelsaJF712755JF786783JF786942JF787530JN387167JN387233
Opuntia gosselinianaJF712761JF786789JF786948JF787611JN387169JN387234
Opuntia humifusaJF712762JF786790JF786949JF787536JN387169JN387234
Opuntia hyptiacanthaMW504058MW553200MW475081ON254911––
Opuntia hystricinaJF712764JF786792JF786951JF787538––
Opuntia jamaicensisJF712765JF786793JF786952–JN387169JN387234
Opuntia lasiacanthaMW504050MW545824KM507353–––
Opuntia leiascheinvarianaKM507356KM507350KM507353–––
Opuntia macbrideiJF712771JF786799JF786957JF787542JN387172JN387238
Opuntia macrocentraJF712773JF786801JF786959JF787544JN387174JN387240
Opuntia macrorhizaJF712774JF786802JF786960JF787545JQ676983JN387241
Opuntia megacanthaMW504046MW520856MW475069ON254903––
Opuntia megarhyzaJF712779JF786807JF786964JF787549JN387175–
Opuntia microdasysJF712781JF786809JF786966JF787551JN387175JN387242
Opuntia miquihuanensisPX965785PX962276PX945583 ––
Opuntia miquihuanensisPX965786PX962277PX945584 ––
Opuntia pachyrrhyzaJF712785JF786813JF786970JF787554JN387178JN387178
Opuntia polyacanthaJF712794JF786822JF786979JF787562JN387180JN387245
Opuntia pusillaJF712800JF786827JF786984JF787566JN387181JN387246
Opuntia pycnanthaJF712803JF786830JF786987JF787565JN387182JN387247
Opuntia quimiloJF712804JF786831JF786988JF787569JN387183JN387248
Opuntia retrorsaJF712814JF786839JF786995JF787575JN387185JN387250
Opuntia rufidaJF712812JF786840JF786997JF787577JN387251JF786840
Opuntia sanguineaJF712817–JF787000JF787580JN387190JN387255
Opuntia scheeriJF712819JF786847JF787002JF787581JN387192JN387257
Opuntia schickendantziiJF712820JF786848JF787003JF787582JN387192JN387257
Opuntia stenopetalaJF712825JF786852JF787008JF787618JN387192JN387257
Opuntia streptacanthaMW504054MW546909MW745077ON254899––
Opuntia strigilJF712829JF786856JF787012JF787590JN387195JN387260
Opuntia taponaJF712833JF786860JF787016JF787593JN387198JN387263
Opuntia tehuacanaMT887611–MT856449–––
Opuntia triacantha–JN676103JN676102JN676105JN387200JN387265
Salmiopuntia salmianaJF712815JF786842JF786998JF787578JN387188JN387253
Tacinga funalis–AY042660––––
Tacinga inamoenaJF786870JF786870JF787026JF787619JN387201JF787026
Tacinga lilaeJF712769JF786797JF786955JF787612JN387171JN387237
Tacinga palmadoraJF712845JF786872JF787028JF787603JN387203JN387267
Tacinga saxatilisJF712846JF786873JF787029JF787620JN387204JN387268
Table 3. Morphological comparison between Opuntia miquihuanensis and O. pachyrrhiza.
Table 3. Morphological comparison between Opuntia miquihuanensis and O. pachyrrhiza.
HabitOpuntia miquihuanensisOpuntia pachyrrhiza
Erect to ProstrateErect to Prostrate
Shape of cladodesEllipticElliptic
Long of cladodes18–21 cm40 cm
Diameter of cladodes12–17 cm12 cm
EpidermisGlabrousGlabrous
Number of areola series in the cladodes6–78–9
Direction of the spinesStraight (75–100°) and diffuse (21–74°)Straight (75–100°), diffuse (21–74°) and radial or adpressed (0–20°)
Flower colorYellowYellow
Number of stigma lobes86–10
Shape of the styleCuneateSubconical
Fruit shapePedunculateObovoid
Fruit length6.1–6.5 cm long2.7 cm long
Pedunculated fruitYes-----
External color of fruitsYellowish greenYellow
Trichomes on the areolasLong gray trichomesLong yellow trichomes
Internal color of fruitsGreenish-white-----
Color of the funicularsWhite-----
FunicularsTasteless-----
Seed shapeDiscoidDiscoid
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Martínez-González, C.R.; Raymundo, T.; Garza-Ocañas, F.; García-Morales, L.J.; Jiménez-Ramírez, J.; García Jimenéz, J. Taxonomy and Phylogeny Reveal a Cryptic New Species of Opuntia (Cactaceae) from Tamaulipas, Mexico. Taxonomy 2026, 6, 33. https://doi.org/10.3390/taxonomy6020033

AMA Style

Martínez-González CR, Raymundo T, Garza-Ocañas F, García-Morales LJ, Jiménez-Ramírez J, García Jimenéz J. Taxonomy and Phylogeny Reveal a Cryptic New Species of Opuntia (Cactaceae) from Tamaulipas, Mexico. Taxonomy. 2026; 6(2):33. https://doi.org/10.3390/taxonomy6020033

Chicago/Turabian Style

Martínez-González, César Ramiro, Tania Raymundo, Fortunato Garza-Ocañas, Leccinum J. García-Morales, Jaime Jiménez-Ramírez, and Jesús García Jimenéz. 2026. "Taxonomy and Phylogeny Reveal a Cryptic New Species of Opuntia (Cactaceae) from Tamaulipas, Mexico" Taxonomy 6, no. 2: 33. https://doi.org/10.3390/taxonomy6020033

APA Style

Martínez-González, C. R., Raymundo, T., Garza-Ocañas, F., García-Morales, L. J., Jiménez-Ramírez, J., & García Jimenéz, J. (2026). Taxonomy and Phylogeny Reveal a Cryptic New Species of Opuntia (Cactaceae) from Tamaulipas, Mexico. Taxonomy, 6(2), 33. https://doi.org/10.3390/taxonomy6020033

Article Metrics

Back to TopTop