Next Article in Journal
Simple Acid Digestion Procedure for the Determination of Total Mercury in Plankton by Cold Vapor Atomic Fluorescence Spectroscopy
Previous Article in Journal
Interactive Analysis, Exploration, and Visualization of RNA-Seq Data with SeqCVIBE
Previous Article in Special Issue
Specificities of Scanning Electron Microscopy and Histological Methods in Assessing Cell-Engineered Construct Effectiveness for the Recovery of Hyaline Cartilage
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Protocol

Fast and Efficient Mouse Pluripotency Reprogramming Using a Chemically-Defined Medium

1
Joint School of Life Sciences, Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou Medical University, Guangzhou 511436, China
2
CAS Key Laboratory of Regenerative Biology, Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou 510530, China
3
Guangdong Provincial Key Laboratory of Stem Cell and Regenerative Medicine, Guangzhou 510530, China
4
Laboratory of Cell Fate Control, School of Life Sciences, Westlake University, Hangzhou 310024, China
5
Center for Cell Lineage and Atlas (CCLA), Bioland Laboratory, Guangzhou Regenerative Medicine and Health GuangDong Laboratory, Guangzhou 510005, China
*
Authors to whom correspondence should be addressed.
Methods Protoc. 2022, 5(2), 28; https://doi.org/10.3390/mps5020028
Submission received: 21 January 2022 / Revised: 17 March 2022 / Accepted: 19 March 2022 / Published: 24 March 2022
(This article belongs to the Special Issue Cellular Reprogramming and Tissue Repair)

Abstract

:
The reprogramming of somatic cells to obtain induced pluripotent stem cells (iPSCs) is an important biological and medical breakthrough, providing important applications for fields such as regenerative medicine and disease modeling. However, this promising technology is damped due to its low efficiency and slow kinetics. Therefore, we generated a practical workflow to rapidly and efficiently induce iPSCs from mouse embryonic fibroblasts (MEFs) using iCD1 (iPS chemically-defined medium 1). This protocol can easily be implemented in a standard cell culture laboratory and be applied to cell fate research.

1. Introduction

A group of cells that are isolated from the inner cell mass at the blastocyst stage, termed pluripotent stem cells, are capable of in vitro self-renewal while maintaining their pluripotency. The blastocyst-derived pluripotent stem cells, named embryonic stem cells (ESCs), retain their differentiation potentials [1,2]. Their ability to differentiate into all adult cell types provides an avenue for developmental biology research and regenerative medicine [3].
Despite wide applications of ESCs, technical difficulties and ethical concerns impede the generation of human ESCs using the previous technologies such as somatic cell nuclear transfer [4] or cell fusion of somatic cells with the existing ESCs [5,6]. Since 2006, the ground-breaking discovery of mouse and human somatic reprogramming by overexpressing four transcription factors Oct4, Sox2, Klf4, and c-Myc (OSKM) [7,8,9,10,11] has substantially addressed the ethical difficulties.
The reprogramming of somatic cells into iPSCs with defined factors is a laborious and inefficient process. Usually, it takes two to three weeks to generate murine iPSCs from MEFs with the requirement of fetal bovine serum (FBS) and feeders to reach only ~0.05% efficiency [12]. Such an inefficient system greatly hinders molecular mechanism investigation of somatic reprogramming, and even the entry of laboratories in this field. Technically, the iPSC generation process includes cell preparation, factor delivery, cell fate induction, as well as culture of the reprogramming and reprogrammed cells. In our experience, a critical practice in cell preparation is the prevention of any mycoplasma contamination, an overlooked factor for the failure of reprogramming. The retroviral [7] and lentiviral [13] systems that are widely used in iPSC reprogramming are reliable and commercially available. We recommend the retroviral system as retrovirus transduction is much less cytotoxic than lentivirus. Therefore, the optimization of the reprogramming cell culture is a key process. By screening the chemicals and other components for cell culture, we developed a more efficient and fast way to generate iPSCs. We developed a feeder-independent culture medium termed iCD1 [14] that enhances the reprogramming efficiency up to 10% without the use of oncogene c-Myc.
Here we presented a stepwise method to generate iPSC and compared the efficiency of iCD1 with the traditional method using mES + Vitamin C induction medium. iPSCs can be generated within seven days. The iPSCs that are generated using this method are indistinguishable from embryonic stem cells in colony morphology, cellular functions, cell markers, and transcriptome and are thus suitable for downstream biological research [14]. Our method provides an easy-to-use system for mouse iPSC generation and serves as a starting point for further improvement of iPSC technology.

2. Experimental Design

Figure 1 shows the workflow of iPSC generation from OG2-MEFs using iCD1.

2.1. Materials

Table 1 provides all the consumables and equipment used in Section 3.

2.2. Reagents

Table 2 provides all the chemicals, antibodies, recombinant proteins, and plasmids used in Section 3.

2.3. Medium Recipes

Table 3 provides all the media, solution and their formula used in Section 3; Table 4 provides complete recipe of iCD1 use in Section 3.

2.4. Primers

Table 5 provides all the primers and their sequence used in real-time PCR.

2.5. Cell Lines

Table 6 provides all the cell lines used in Section 3.

3. Procedure

3.1. Viral Production through Calcium Phosphate Transfection

  • Plate 7.5 × 106 or 4 × 106 Plat-E cells to 100 mm or 60 mm cell culture dishes, respectively, depending on experimental design. The cells were cultured in fibroblast medium.
  • Observe the cells one day before performing calcium phosphate transfection and make sure the cells do not overgrow. The optimal confluence would be 70~80%.
  • Refresh with 7.5 mL and 2.5 mL media for 100 mm and 60 mm cell culture dishes 2 h before transfection, respectively.
  • Mix the following reagents in 1.5 mL or 15 mL tubes to prepare the cell transfection solution.
Storage Con.Usage Con.60 mm Dishes100 mm Dishes
DNA1 μg/μL/8 μg25 μg
H2O//429.5 μL1068.75 μL
CaCl22 M125 mM62.5 μL156.25 μL
2× HBS500 μL1250 μL
Total//1000 μL2500 μL
Note: Add water first, then add DNA and mix thoroughly. Add 2 M CaCl2 and pipette 15 times. Finally, add 2× HBS and shake vigorously for 15 times to mix well (if the HBS is added multiple times, add it fast to avoid pH changes for the optimal transfection efficiency). Allow the mixed reagents to rest for 5 min at room temperature.
5.
Uniformly add the mixed reagents to the cells and move back and forth and then side-to-side 1–3 times to ensure equal distribution. The calcium phosphate precipitation appears as black fine particles and can be observed throughout the dishes under a microscope. Place the cells back in a 37 °C incubator.
6.
Replace the transfection medium with 10 mL or 3.5 mL fresh fibroblast medium for a 100 mm or 60 mm dish, respectively, 12 h after transfection.
7.
Collect the supernatants that contain the viruses for the first transduction 48 h after transfection, and refresh with 10 mL or 3.5 mL fibroblast medium for a 100 mm or 60 mm dish, respectively.
8.
Collect the supernatants with viruses 72 h after transfection for the second transduction.
9.
Filter the virus-containing media with 0.45 μm filter and use the viruses freshly.

3.2. Thawing, Culturing, and Proliferating OG2-MEFs

  • Before thawing OG2-MEFs, coat the dish with 0.1% gelatin and incubate in a 37 °C incubator for at least 30 min.
    Note: OG2-MEFs should be tested for mycoplasma contamination as this will substantially impact the efficiency of iPSC generation.
  • Remove the vials from the liquid nitrogen using the appropriate safety equipment.
    Note: When handling frozen vials, make sure to wear appropriate personal protective equipment including cryo-gloves and eye protection as vials that are stored in liquid nitrogen may explode when warmed.
  • Immerse the vial in a 37 °C water bath without submerging the cap and keep swirling the vial gently.
    Note: The bottom of the vial that contains the OG2-MEFs should be immersed in the water bath; otherwise it would lead to cell death.
  • Remove the vial from the water bath when only a small piece of ice crystal is left as it will thaw within seconds due to the remaining heat.
  • Ensure that the cap is tight and spray the vial with 75% ethanol to sterilize the surface of the vial. Air-dry the vial in the sterile biosafety cabinet to ensure the absence of residual ethanol.
  • Transfer the cells into the bottom of a sterile 15 mL tube gently using a 1-mL pipette tip and add 5 mL fresh fibroblast medium dropwise with a 10 mL pipette.
    Note: If the medium is not added dropwise to make the cells adapt to the osmotic pressure of the medium, cell survival may be impacted due to the rapid change of the environment.
  • Centrifuge the cells at 200× g for 5 min.
  • Aspirate the supernatant and resuspend the cells with 1 mL fresh fibroblast medium gently.
  • Remove the 0.1% gelatin and slowly add 1 mL of the cell suspension into the 60 mm dish, followed by another 2 mL fresh fibroblast medium. Generally, 1 × 106 OG2-MEFs are sufficient for three 60 mm dishes.
  • Feed 3 mL fibroblast medium to cells in one 60 mm dish every three days until ready to be passaged or harvested.

3.3. Passaging, Counting, and Plating OG2-MEFs

  • OG2-MEFs are split when they reach 80~90% confluence. Wash the cells with 3 mL DPBS, as the serum in the fibroblast medium contains a massive amount of trypsin inhibitors.
  • Aspirate DPBS, then add 0.5 mL pre-warmed 0.25% trypsin-EDTA, and incubate at 37 °C for 2 min.
    Note: The best working temperature for trypsin is 37 °C. Pre-warmed trypsin can fully disassociate OG2-MEFs in 2 min. Long and short incubation will lead to poor cell vitality and residual cells, respectively.
  • When OG2-MEFs are well detached as single cells, add an equal volume of fibroblast medium to terminate the trypsin reaction.
  • Transfer the cell suspension to a sterile 15 mL tube. Take 10 µL of the cell suspension for cell counting.
  • Centrifuge the cells at 200× g for 5 min at room temperature. Meanwhile, count the cells using a hemocytometer or an automated cell counter.
    Note: Cell concentrations between 4–6 × 105 would give a more accurate result when using a hemocytometer.
  • Aspirate the supernatants and resuspend the cells first with 1 mL medium. Pipette up and down to ensure a single-cell suspension. Then add a proper medium volume to obtain 1.5 × 104 living cells per well in 12-well plates.
    Note: Gently shake the tube to ensure equal distribution of the cells and an equal number of cells in every well. Normally, 1.5–2 × 104 cells are recommended for OKS reprogramming and 3 × 104 cells are recommended for OK/OS/O reprogramming.
  • Gently move the plates back-and-forth to ensure uniform distribution of the cells before placing them back in the incubator.
    Note: Due to the edge effect of the plate, rotational movement should be avoided to ensure that cells do not aggregate in the middle of the well. Close the incubator gently to avoid disturbance.
  • OG2-MEFs will completely adhere to the well in 8 h which is the appropriate window for viral transduction, as poor adhesion of OG2-MEFs will lower the reprogramming efficiency.

3.4. Generation of iPSCs

  • Aspirate the spent medium and add 0.5 mL of each virus-containing media, which were collected and filtered from Section 3.1 followed by adding 0.5 mL fibroblast medium containing 4 µg/mL polybrene. Normally, the volume of the virus-containing media depends on the transfection efficiency in Plat-E cells during viral production in Section 3.1. It is recommended to use 0.5 mL virus-containing media if the efficiency achieves 90%, and to use 0.75 mL virus-containing media if the efficiency is 80% or lower.
  • Perform the second transduction by repeating step 1 one day after the primary transduction.
  • The virus-containing media are removed 24 h after the second transduction and 1 mL of iCD1 is added to the cells. The day on which virus-containing media are removed is denoted as day 0 post-transduction.
  • Feed the cells daily with 1 mL fresh medium per well of a 12-well plate, 2 mL at day 5 and hereafter, as the robust proliferation of cells will lead to a deficiency of nutrition during reprogramming.
    Note: Medium should be pre-warmed at room temperature in the dark before use, as the small molecules in the medium are photolytic. Use the medium freshly (within a week) as it contains reducing substances and many unstable growth factors.
  • Oct4-GFP positive and dome-shaped colonies are considered as reprogrammed iPSC colonies.
  • The iPSC colonies are picked at day 7 post-transduction based on Oct4-GFP expression and characteristic ESC-like morphology. The picked colonies are subsequently expanded and maintained the same way as ESCs.

3.5. Characterization of iPSCs by Immunostaining (in a Cell Culture Plate)

  • Gently remove the medium and wash the cells with 1 mL of DPBS twice.
  • Add 1 mL of 4% (wt/vol) PFA to each well of a 12-well plate and let it stand at room temperature for 30 min. Gently replace with 1 mL of DPBS and shake for 5 min at room temperature. Repeat the DPBS wash twice.
  • Add 500 μL blocking and permeabilization solution (one volume of 3% GSA and one volume of 0.2% triton mixed together). Incubate for 40 min at 25 °C.
  • Wash the well with 1 mL of DPBS, place it on a horizontal shaker at room temperature and shake for 5 min. Repeat the DPBS wash twice.
  • Incubate with the Anti-Nanog antibody (1:1000) at 4 °C overnight.
  • Wash the cells with DPBS thrice and incubate for 10 min each time at room temperature on a horizontal shaker.
  • Incubate with the secondary antibody (1:2000) for 1 h at room temperature and avoid light.
  • Wash the cells with DPBS thrice and incubate for 10 min each time at room temperature on a horizontal shaker (avoid light).
  • Add 1 mL DPBS into each well and use a fluorescence microscope to capture images.

4. Expected Results

We treated OG2-MEFs with the modified medium iCD1 and traditional induction medium mES + Vitamin C and found that the number of Oct4-GFP-positive colonies was substantially increased in iCD1. The number of Oct4-GFP-positive colonies at day seven post-treatment was almost 40-fold higher than that in mES + Vitamin C medium (Figure 2a,b). We observed that mesenchymal-epithelial transition (MET) occurred the day after the second transduction (D1). The iCD1-treated cells activated Oct4 sooner than the mES + Vitamin C-treated ones and as reprogramming progressed. The iCD1-treated cells exhibited round shape, large nucleoli, and sparse cytoplasm similar to mouse ESCs (Figure 2c). We collected RNA samples of the cells that were treated by both conditions at day three, five, and seven, followed by quantitative real-time PCR to investigate the reprogramming kinetics using primers as stated in Table 4. We found that the iCD1-treated cells exhibited earlier activation of pluripotent markers, Nanog, endogenous Oct4, and Dppa3, than those by mES + Vitamin C, indicating the advantage of iCD1 in reprogramming kinetics (Figure 2d). Next, we examined the NANOG expression of iCD1-treated cells by immunostaining using NANOG antibody. The Oct4-GFP-positive cells were also found to be NANOG-positive, further confirming the pluripotency establishment (Figure 2e). Additional characterization of iCD1-induced iPSC can be found in our previous works [14]. Altogether, the upregulation of pluripotent markers indicates a successful cell fate transition and well-established pluripotency of the reprogrammed cells.

5. Discussion

The technical improvement of iPSC reprogramming has mainly focused on reducing or replacing transcription factors (e.g., subtracting the oncogene c-Myc) [15,16]. Yet this strategy suffers from low efficiency and lengthy process compared to the iCD1 system that is described here. Alternatively, non-integrated delivery methods of reprogramming factors such as mRNA delivery and transient transfection make iPSCs more clinically applicable [17,18]. Subsequent studies have reported uses of many mouse cell types for reprogramming such as neural progenitor cells, pancreatic β cells, and stomach cells, thereby expanding the choices of the starting cell types [19,20,21,22]. Presently, more efforts are focused on adding small molecular compounds to replace transcription factors. For instance, Huangfu et al. reported that histone deacetylase (HDAC) inhibitors, particularly valproic acid (VPA), markedly improve the reprogramming efficiency [23]. Vitamin C is a dioxygenase agonist, and its remarkable role in promoting reprogramming efficiency is well documented [24]. It is noted that protocols using Knockout serum replacement (KSR)-based medium should be considered as Vitamin C-supplemented protocols, as KSR enriches Vitamin C. Hou et al. reported a successful induction of iPSC by replacing all the transcription factors with compound combinations [25]. As chemical-induced reprogramming is inefficient and requires a tedious process, optimized protocols have been developed for high efficiency and reproducibility [26,27].
However, these methods have their shortcomings. Transient transfection has delayed kinetics of reprogramming and short expression window of factors compared to the integrated expression [18]. Many reported chemicals such as 5′-azaC and BIX01294 are cytotoxic and not conducive to application [28,29]. Moreover, small molecules that replace transcription factors may have very low efficiency, a long induction time, and undefined side effects or toxicity on cells [23].
We have developed a user-friendly protocol allowing for fast and efficient reprogramming of MEFs into iPSCs in iCD1, an original reprogramming medium. Our lab has previously developed a serum-free medium containing multiple vitamins and engineered factors that improve reprogramming efficiency after testing candidate factors systematically [29,30]. The previously reported complex formulation can be substituted by iCD1, containing high glucose DMEM-supplemented N2, B27, and vitamin C. Moreover, the addition of small molecules GSK-3β inhibitor CHIR99021 and LiCl into our iCD1 medium maintains the undifferentiated state of already reprogrammed iPSCs while accelerating somatic cell reprogramming [31]. The growth factor, basic fibroblast growth factor (bFGF), is crucial to support OKS-transduced MEFs proliferation and later-stage reprogramming. Further, we used MEFs that were derived from E13.5 embryos carrying the Oct4-GFP transgenic allele [32], easy for tracing the kinetics of the reprogramming. We applied a retroviral delivery system as it is susceptible to transgene-silencing at the fully reprogrammed iPSC stage. We found that iCD1 supplemented with BMP factors can support Oct4-mediated or Oct4-Sox2-mediated reprogramming by promoting MET process, the lack of which is a major hindrance in reprogramming without Klf4 and c-Myc [33].
In general, iCD1 has extensive application in somatic reprogramming and has already been used and modified in many studies [34,35,36] to further decipher cell fate decision.

6. Conclusions

Here, we provide a detailed procedure of efficient and fast mouse iPSC generation using a chemically-defined medium that was developed in our lab previously. The resulting iPSC colonies have morphological and molecular signatures as ES cells. Our protocol has provided a reliable and efficient way to comprehensively study molecular mechanisms of cell fate transition and facilitate the application of reprogramming technologies.

Author Contributions

J.C. and D.P. conceived the study. J.H. and X.Y. performed the experiments, collected the data, and did the analyses. J.H., H.W., J.W. and J.C. wrote the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by National Basic Research Program of China [2017YFA0105201]; Frontier Science Research Program of the CAS (ZDBS-LY-SM007); Science and Technology Plan-ning Project of Guangdong Province, China (2020B1212060052); Science and Technology Projects in Guangzhou, China (202102021039); The National Natural Science Foundation of China (32000414, 32000501); GuangDong Basic and Applied Basic Research Foundation (2020A1515110096); and The Science and Technology Program of Guangzhou (202102020174).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data that are presented in this study are available within the figures.

Acknowledgments

We thank Ruhai Chen, Yuting Liu, Sa Li, Shaofei Cheng, Yujian Liu, Kaixin Wu, Jin Ming, and Yi Huang for technical support.

Conflicts of Interest

The authors declare no competing interest in this work.

References

  1. Martin, G.R. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc. Natl. Acad. Sci. USA 1981, 78, 7634–7638. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Evans, M.J.; Kaufman, M.H. Establishment in culture of pluripotential cells from mouse embryos. Nature 1981, 292, 154–156. [Google Scholar] [CrossRef] [PubMed]
  3. Goncalves, N.N.; Ambrosio, C.E.; Piedrahita, J.A. Stem cells and regenerative medicine in domestic and companion animals: A multispecies perspective. Reprod. Domest. Anim. 2014, 49 (Suppl 4), 2–10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Wilmut, I.; Schnieke, A.E.; McWhir, J.; Kind, A.J.; Campbell, K.H. Viable offspring derived from fetal and adult mammalian cells. Nature 1997, 385, 810–813. [Google Scholar] [CrossRef]
  5. Tada, M.; Takahama, Y.; Abe, K.; Nakatsuji, N.; Tada, T. Nuclear reprogramming of somatic cells by in vitro hybridization with ES cells. Curr. Biol. 2001, 11, 1553–1558. [Google Scholar] [CrossRef] [Green Version]
  6. Cowan, C.A.; Atienza, J.; Melton, D.A.; Eggan, K. Nuclear Reprogramming of Somatic Cells After Fusion with Human Embryonic Stem Cells. Science 2005, 309, 1369–1373. [Google Scholar] [CrossRef] [Green Version]
  7. Takahashi, K.; Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 2006, 126, 663–676. [Google Scholar] [CrossRef] [Green Version]
  8. Qin, D.; Li, W.; Zhang, J.; Pei, D. Direct generation of ES-like cells from unmodified mouse embryonic fibroblasts by Oct4/Sox2/Myc/Klf4. Cell Res. 2007, 17, 959–962. [Google Scholar] [CrossRef]
  9. Wernig, M.; Meissner, A.; Foreman, R.; Brambrink, T.; Ku, M.; Hochedlinger, K.; Bernstein, B.E.; Jaenisch, R. In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state. Nature 2007, 448, 318–324. [Google Scholar] [CrossRef]
  10. Okita, K.; Ichisaka, T.; Yamanaka, S. Generation of germline-competent induced pluripotent stem cells. Nature 2007, 448, 313–317. [Google Scholar] [CrossRef]
  11. Takahashi, K.; Tanabe, K.; Ohnuki, M.; Narita, M.; Ichisaka, T.; Tomoda, K.; Yamanaka, S. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 2007, 131, 861–872. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Maherali, N.; Hochedlinger, K. Guidelines and techniques for the generation of induced pluripotent stem cells. Cell Stem Cell 2008, 3, 595–605. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Welstead, G.G.; Brambrink, T.; Jaenisch, R. Generating iPS cells from MEFS through forced expression of Sox-2, Oct-4, c-Myc, and Klf4. J. Vis. Exp. 2008. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Chen, J.; Liu, J.; Chen, Y.; Yang, J.; Chen, J.; Liu, H.; Zhao, X.; Mo, K.; Song, H.; Guo, L.; et al. Rational optimization of reprogramming culture conditions for the generation of induced pluripotent stem cells with ultra-high efficiency and fast kinetics. Cell Res. 2011, 21, 884–894. [Google Scholar] [CrossRef] [Green Version]
  15. Nakagawa, M.; Koyanagi, M.; Tanabe, K.; Takahashi, K.; Ichisaka, T.; Aoi, T.; Okita, K.; Mochiduki, Y.; Takizawa, N.; Yamanaka, S. Generation of induced pluripotent stem cells without Myc from mouse and human fibroblasts. Nat. Biotechnol. 2008, 26, 101–106. [Google Scholar] [CrossRef]
  16. Wernig, M.; Meissner, A.; Cassady, J.P.; Jaenisch, R. c-Myc is dispensable for direct reprogramming of mouse fibroblasts. Cell Stem Cell 2008, 2, 10–12. [Google Scholar] [CrossRef] [Green Version]
  17. Warren, L.; Manos, P.D.; Ahfeldt, T.; Loh, Y.H.; Li, H.; Lau, F.; Ebina, W.; Mandal, P.K.; Smith, Z.D.; Meissner, A.; et al. Highly efficient reprogramming to pluripotency and directed differentiation of human cells with synthetic modified mRNA. Cell Stem Cell 2010, 7, 618–630. [Google Scholar] [CrossRef] [Green Version]
  18. Okita, K.; Nakagawa, M.; Hyenjong, H.; Ichisaka, T.; Yamanaka, S. Generation of mouse induced pluripotent stem cells without viral vectors. Science 2008, 322, 949–953. [Google Scholar] [CrossRef]
  19. Kim, J.B.; Sebastiano, V.; Wu, G.; Arauzo-Bravo, M.J.; Sasse, P.; Gentile, L.; Ko, K.; Ruau, D.; Ehrich, M.; van den Boom, D.; et al. Oct4-induced pluripotency in adult neural stem cells. Cell 2009, 136, 411–419. [Google Scholar] [CrossRef]
  20. Stadtfeld, M.; Brennand, K.; Hochedlinger, K. Reprogramming of Pancreatic β Cells into Induced Pluripotent Stem Cells. Curr. Biol. 2008, 18, 890–894. [Google Scholar] [CrossRef] [Green Version]
  21. Broccoli, V. Reprogramming of somatic cells: iPS and iN cells. Prog. Brain Res. 2017, 230, 53–68. [Google Scholar] [CrossRef] [PubMed]
  22. Aoi, T.; Yae, K.; Nakagawa, M.; Ichisaka, T.; Okita, K.; Takahashi, K.; Chiba, T.; Yamanaka, S. Generation of Pluripotent Stem Cells from Adult Mouse Liver and Stomach Cells. Science 2008, 321, 699–702. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Huangfu, D.; Maehr, R.; Guo, W.; Eijkelenboom, A.; Snitow, M.; Chen, A.E.; Melton, D.A. Induction of pluripotent stem cells by defined factors is greatly improved by small-molecule compounds. Nat. Biotechnol. 2008, 26, 795–797. [Google Scholar] [CrossRef] [PubMed]
  24. Wang, T.; Chen, K.; Zeng, X.; Yang, J.; Wu, Y.; Shi, X.; Qin, B.; Zeng, L.; Esteban, M.A.; Pan, G.; et al. The histone demethylases Jhdm1a/1b enhance somatic cell reprogramming in a vitamin-C-dependent manner. Cell Stem Cell 2011, 9, 575–587. [Google Scholar] [CrossRef] [Green Version]
  25. Hou, P.; Li, Y.; Zhang, X.; Liu, C.; Guan, J.; Li, H.; Zhao, T.; Ye, J.; Yang, W.; Liu, K.; et al. Pluripotent Stem Cells Induced from Mouse Somatic Cells by Small-Molecule Compounds. Science 2013, 341, 651–654. [Google Scholar] [CrossRef]
  26. Cao, S.; Yu, S.; Li, D.; Ye, J.; Yang, X.; Li, C.; Wang, X.; Mai, Y.; Qin, Y.; Wu, J.; et al. Chromatin Accessibility Dynamics during Chemical Induction of Pluripotency. Cell Stem Cell 2018, 22, 529–542. [Google Scholar] [CrossRef] [Green Version]
  27. Zhao, Y.; Zhao, T.; Guan, J.; Zhang, X.; Fu, Y.; Ye, J.; Zhu, J.; Meng, G.; Ge, J.; Yang, S.; et al. A XEN-like State Bridges Somatic Cells to Pluripotency during Chemical Reprogramming. Cell 2015, 163, 1678–1691. [Google Scholar] [CrossRef] [Green Version]
  28. Mikkelsen, T.S.; Hanna, J.; Zhang, X.; Ku, M.; Wernig, M.; Schorderet, P.; Bernstein, B.E.; Jaenisch, R.; Lander, E.S.; Meissner, A. Dissecting direct reprogramming through integrative genomic analysis. Nature 2008, 454, 49–55. [Google Scholar] [CrossRef]
  29. Chen, J.; Liu, J.; Han, Q.; Qin, D.; Xu, J.; Chen, Y.; Yang, J.; Song, H.; Yang, D.; Peng, M.; et al. Towards an Optimized Culture Medium for the Generation of Mouse Induced Pluripotent Stem Cells. J. Biol. Chem. 2010, 285, 31066–31072. [Google Scholar] [CrossRef] [Green Version]
  30. Wang, Y.; Chen, J.; Hu, J.L.; Wei, X.X.; Qin, D.; Gao, J.; Zhang, L.; Jiang, J.; Li, J.S.; Liu, J.; et al. Reprogramming of mouse and human somatic cells by high-performance engineered factors. EMBO Rep. 2011, 12, 373–378. [Google Scholar] [CrossRef] [Green Version]
  31. Ying, Q.; Wray, J.; Nichols, J.; Batlle-Morera, L.; Doble, B.; Woodgett, J.; Cohen, P.; Smith, A. The ground state of embryonic stem cell self-renewal. Nature 2008, 453, 519–523. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Szabo, P.E.; Hubner, K.; Scholer, H.; Mann, J.R. Allele-specific expression of imprinted genes in mouse migratory primordial germ cells. Mech Dev. 2002, 115, 157–160. [Google Scholar] [CrossRef]
  33. Chen, J.; Liu, J.; Yang, J.; Chen, Y.; Chen, J.; Ni, S.; Song, H.; Zeng, L.; Ding, K.; Pei, D. BMPs functionally replace Klf4 and support efficient reprogramming of mouse fibroblasts by Oct4 alone. Cell Res. 2011, 21, 205–212. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Yu, S.; Zhou, C.; Cao, S.; He, J.; Cai, B.; Wu, K.; Qin, Y.; Huang, X.; Xiao, L.; Ye, J.; et al. BMP4 resets mouse epiblast stem cells to naive pluripotency through ZBTB7A/B-mediated chromatin remodelling. Nat. Cell Biol. 2020, 22, 651–662. [Google Scholar] [CrossRef] [PubMed]
  35. Zhou, Z.; Yang, X.; He, J.; Liu, J.; Wu, F.; Yu, S.; Liu, Y.; Lin, R.; Liu, H.; Cui, Y.; et al. Kdm2b Regulates Somatic Reprogramming through Variant PRC1 Complex-Dependent Function. Cell Rep. 2017, 21, 2160–2170. [Google Scholar] [CrossRef] [Green Version]
  36. Li, D.; Liu, J.; Yang, X.; Zhou, C.; Guo, J.; Wu, C.; Qin, Y.; Guo, L.; He, J.; Yu, S.; et al. Chromatin Accessibility Dynamics during iPSC Reprogramming. Cell Stem Cell 2017, 21, 819–833. [Google Scholar] [CrossRef] [Green Version]
Figure 1. Workflow of iPSC generation from OG2-MEFs using iCD1. Timeline of viral production, OG2-MEFs preparation and transduction, and iPSC induction. Arrows indicate the key steps at different time points. OG2-MEFs (1 × 104 cells) are split and plated in a 12-well plate.
Figure 1. Workflow of iPSC generation from OG2-MEFs using iCD1. Timeline of viral production, OG2-MEFs preparation and transduction, and iPSC induction. Arrows indicate the key steps at different time points. OG2-MEFs (1 × 104 cells) are split and plated in a 12-well plate.
Mps 05 00028 g001
Figure 2. Characterization of generated iPSCs using the iCD1 medium. (a) Oct4-GFP-positive colonies were scored at day 7 post-treatment in indicated medium. *** p < 0.001, compared to the result of iCD1 (n = 2); (b) Images of Oct4-GFP positive colonies generated by indicated medium at day 7. Scale bar: 5mm; (c) The induction of pluripotency from MEFs by Oct4 (O), Klf4 (K), Sox2 (S) in the indicated medium during reprogramming. The bright field and GFP images were shown on the top and bottom, respectively. Green colonies indicate successful reprogramming. Scale bar: 250 μm; (d) Expression levels of Nanog, endogenous Oct4 and Dppa3 were analyzed by quantitative real-time PCR (n = 2). Expression levels of pluripotent markers were relative to Gapdh; (e) Immunofluorescent staining of NANOG in Oct4-GFP positive iPSCs, showing a co-expression of OCT4 and NANOG proteins in GFP positive cells. Scale bar: 250 μm.
Figure 2. Characterization of generated iPSCs using the iCD1 medium. (a) Oct4-GFP-positive colonies were scored at day 7 post-treatment in indicated medium. *** p < 0.001, compared to the result of iCD1 (n = 2); (b) Images of Oct4-GFP positive colonies generated by indicated medium at day 7. Scale bar: 5mm; (c) The induction of pluripotency from MEFs by Oct4 (O), Klf4 (K), Sox2 (S) in the indicated medium during reprogramming. The bright field and GFP images were shown on the top and bottom, respectively. Green colonies indicate successful reprogramming. Scale bar: 250 μm; (d) Expression levels of Nanog, endogenous Oct4 and Dppa3 were analyzed by quantitative real-time PCR (n = 2). Expression levels of pluripotent markers were relative to Gapdh; (e) Immunofluorescent staining of NANOG in Oct4-GFP positive iPSCs, showing a co-expression of OCT4 and NANOG proteins in GFP positive cells. Scale bar: 250 μm.
Mps 05 00028 g002
Table 1. Information on all consumables and equipment.
Table 1. Information on all consumables and equipment.
NameSourceIdentifierLocation
Pipette tips 10 μLCorningT-300Glendale, AZ, USA
Pipette tips 200 μLCorningT-200-YGlendale, AZ, USA
Pipette tips 1 mLCorningT-1000-BGlendale, AZ, USA
MicrotubesCorningMCT-150-CGlendale, AZ, USA
15 mL tubesCorning430790Glendale, AZ, USA
50 mL tubesCorning430828Glendale, AZ, USA
Cell culture multiwell plate, 6 wellGreiner657160Kremsmünster, Austria
Cell culture multiwell plate, 12 wellGreiner665180Kremsmünster, Austria
60 mm cell culture dishesGreiner664160Kremsmünster, Austria
100 mm cell culture dishesGreiner628160Kremsmünster, Austria
0.45 μm filterMilliporeSLHVR33RBBurlington, MA, USA
4 °C refrigeratorHaierHYCD-290Guangzhou, China
−20 °C freezerHaierHYCD-290Guangzhou, China
−80 °C freezerThermo Fisher Scientific995Waltham, MA, USA
Heracell 240i IncubatorThermo Fisher Scientific51026331Waltham, MA, USA
MicroscopeZEISSVert.A1Oberkochen, Germany
Low-speed centrifugeZONKIASC-3612Anhui, China
QuantStudioTM 3 Real-Time PCR InstrumentApplied BiosystemsA28132Waltham, MA, USA
Table 2. Information on all chemicals, antibodies, recombinant proteins, and plasmids.
Table 2. Information on all chemicals, antibodies, recombinant proteins, and plasmids.
NameSourceIdentifierLocation
Dulbecco’s
Phosphate-Buffer
Saline (DPBS)
HyCloneSH30028.02Logan, UT, USA
DMEM High GlucoseHycloneSH30022.01Logan, UT, USA
FBS (for mES +
Vitamin C medium)
LonseraS711-001sShanghai, China
FBS (for fibroblast medium)NATOCORSFBECórdoba, Argentina
GlutaMAXGIBCO35050079Waltham, MA, USA
Non-Essential Amino Acids Solution (NEAA)GIBCO11140076Waltham, MA, USA
Sodium PyruvateGIBCO11360070Waltham, MA, USA
β-MercaptoethanolGIBCO21985-023Waltham, MA, USA
Trypsin-EDTA (0.25%)GIBCO25200114Waltham, MA, USA
DAPISigmaD9542Burlington, MA, USA
GSAZSGB-BIOZLI-9022Beijing, China
Triton x-100SigmaT9284Burlington, MA, USA
Nanog Polyclonal AntibodyBETHYLA300-397Montgomery, TX, USA
Alexa Fluor 568 Goat anti-RabbitInvitrogenA11011Waltham, MA, USA
ChamQTM SYBR qPCR Master Mix kitVazymeQ311Nanjing, China
HiScript II Q RT SuperMix for qPCR kitVazymeR222-01Nanjing, China
TRI ReagentMRCTR118-200Cincinnati, OH, USA
CHIR99021SigmaSML1046Burlington, MA, USA
Thiamine hydrochlorideSigmaT1270Burlington, MA, USA
2-Phospho-L-ascorbic acid trisodium salt (Vitamin C)Sigma49752Burlington, MA, USA
Lithium chlorideSigmaL4408Burlington, MA, USA
PolybreneSigmaTR1003Burlington, MA, USA
Sodium phosphate dibasicSigmaS7907Burlington, MA, USA
Potassium chlorideSigmaP9333Burlington, MA, USA
HEPESSigmaH7523Burlington, MA, USA
D-(+)-GlucoseSigmaG6152Burlington, MA, USA
Sodium chlorideSigmaS5886Burlington, MA, USA
Mouse leukemia inhibitory factor (LIF)MilliporeESGE107Burlington, MA, USA
pMX-Oct4Addgene13366Watertown, MA, USA
pMX-Sox2Addgene13367Watertown, MA, USA
pMX-Klf4Addgene13370Watertown, MA, USA
pMX-DsRedLaboratory of D. PeiN/AGuangzhou, China
Table 3. Detailed information on the media and solution formula.
Table 3. Detailed information on the media and solution formula.
NameRecipe
2× HBS (500 mL)NaCl 8.1816 g, KCl 0.8715 g, Na2HPO4 0.10647 g, Glucose 1.08096 g, HEPES 5.95775 g, adjust PH to 6.92–6.95 with NaOH, add ultrapure water to 500 mL
2 M CaCl2 (500 mL)CaCl2 147.02 g, add ultrapure water to 500 mL
Fibroblast mediumDMEM/high glucose 500 mL, FBS (NATOCOR) 10% (56 mL), NEAA 1/100 (5.6 mL), GlutaMAX 1/100 (5.6 mL)
mES + Vitamin CLonsera FBS 7.5 mL, NEAA 500 μL, GlutaMAX 500 μL, Sodium Pyruvate 500 μL, β-Mercaptoethanol (55 mM) 91 μL (Final concentration 0.1 μM), 2-Phospho-L-ascorbic acid trisodium salt (Vitamin C, final concentration 50 μg/mL) 50 μL, Mouse leukemia inhibitory factor (0.1 mg/mL, Final concentration 12.5 ng/mL) 6.25 μL, add DMEM/high glucose to make the volume 50 mL
iCD1The recipe is shown in Table 4
3% GSA Blocking BufferGSA 1.5 mL, DPBS 48.5 mL
0.2% Permeabilization BufferTriton 0.1 mL, DPBS 49.9 mL
Table 4. Components of the iCD1 medium.
Table 4. Components of the iCD1 medium.
Substancemg/LSubstancemg/L
L-Arginine·HCl8.40 × 101Arachidonic adic2.00 × 10−2
L-Alanine8.90Cholesterol2.20
L-Asparagine1.32 × 101Linoleic acid1.00 × 10−1
L-Aspartic acid1.33 × 101Linolenic acid1.00 × 10−1
L-Cystine·2HCl6.30 × 101Myristic acid1.00 × 10−1
L-Glutamic acid1.47 × 101Oleic acid1.00 × 10−1
L-Histidine HCl·H204.20 × 101Palmitoleic acid1.00 × 10−1
L-Isoleucine1.05 × 102Palmitic acid1.00 × 10−1
L-Leucine1.05 × 102Pluronic F-181.00 × 103
L-Lystine HCl1.46 × 102Stearic acid1.00 × 10−1
L-Methionine3.00 × 101Tween 802.20 × 101
L-Phenylalanine6.60 × 1012-Phospho-L-ascorbic acid5.00 × 101
L-Proline1.15 × 101D,L-alpha-tocopherol(Vitamin E)1.00
L-Serine6.30 × 101D,L-alpha-tocopherol acetatec1.00
L-Threonine9.50 × 101Biotin1.00 × 10−1
L-Tryptophan1.60 × 101D-Ca pantothenate4.00
L-Tyrosine·2Na·2H2O1.04 × 102Choline chloride4.00
L-Valine9.40 × 101Folic acid4.00
Glycine4.50 × 101i-Inositol7.20
D-Glucose4.50 × 103Niacinamide4.00
Sodium pyruvate1.10 × 102Pyridoxine HCl4.00
D(+)-Galactose1.50 × 101Riboflavin4.00 × 10−1
Insulin(Bovine, Recombinant)5.00 × 101Thiamine HCl4.00
Transferrin(Human)1.00 × 102Retinol, all trans(Vitamin A)1.00 × 10−1
Recombinant BSA Fraction V1.00 × 103Vitamin B121.40
Catalase2.50Putrescine·2HCl3.22 × 101
Glutathione(Reduced)1.50L-Carnitine HCl2.00
Superoxide dismutase2.50Ethanolamine HCl1.00
T-3/Albumin Complex2.00 × 10−3Lipoic acid4.70 × 10−2
Corticosterone2.00 × 10−2Phenol red1.50 × 101
Progesterone1.26 × 10−2CHIR990211.40
basic FGF5.00 × 10−32-mercaptoethanol8.17
Leukemia inhibitory factor1.00 × 10−2
LiCl2.12 × 102
CaCl2(anhyd.)2.00 × 102
Fe(NO3)3·9H201.00 × 10−1
KCl4.00 × 102
MgSO49.77 × 101
NaCl6.40 × 103
NaHCO33.70 × 103
NaH2PO4·H2O1.25 × 102
Sodium selenite1.86 × 10−2
Table 5. Information on the primers.
Table 5. Information on the primers.
NameSequence (5′ to 3′)
Gapdh-FAACTTTGGCATTGTGGAAGGGCTCA
Gapdh-RTTGGCAGCACCAGTGGATGCAGGGA
Nanog-FCTCAAGTCCTGAGGCTGACA
Nanog-RTGAAACCTGTCCTTGAGTGC
Endo-Oct4-FTAGGTGAGCCGTCTTTCCAC
Endo-Oct4-RGCTTAGCCAGGTTCGAGGAT
Dppa3-FTGTGGAGAACAAGAGTGA
Dppa3-RCTCAATCCGAACAAGTCTT
Table 6. Detailed information on the cell lines.
Table 6. Detailed information on the cell lines.
NameSource
Platinum-E (Plat-E)A gift from The Fourth Military Medical University
OG2 Mouse Embryonic FibroblastE13.5 mouse embryos from crossing male Oct4–GFP transgenic mice (CBA/CaJ XC57BL/6J) to 129Sv/Jae female mice
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Huang, J.; Yang, X.; Wang, J.; Wu, H.; Pei, D.; Chen, J. Fast and Efficient Mouse Pluripotency Reprogramming Using a Chemically-Defined Medium. Methods Protoc. 2022, 5, 28. https://doi.org/10.3390/mps5020028

AMA Style

Huang J, Yang X, Wang J, Wu H, Pei D, Chen J. Fast and Efficient Mouse Pluripotency Reprogramming Using a Chemically-Defined Medium. Methods and Protocols. 2022; 5(2):28. https://doi.org/10.3390/mps5020028

Chicago/Turabian Style

Huang, Junju, Xuejie Yang, Jie Wang, Haoyu Wu, Duanqing Pei, and Jiekai Chen. 2022. "Fast and Efficient Mouse Pluripotency Reprogramming Using a Chemically-Defined Medium" Methods and Protocols 5, no. 2: 28. https://doi.org/10.3390/mps5020028

APA Style

Huang, J., Yang, X., Wang, J., Wu, H., Pei, D., & Chen, J. (2022). Fast and Efficient Mouse Pluripotency Reprogramming Using a Chemically-Defined Medium. Methods and Protocols, 5(2), 28. https://doi.org/10.3390/mps5020028

Article Metrics

Back to TopTop