Promotion of Adrenal Pheochromocytoma (PC-12) Cell Proliferation and Outgrowth Using Schwann Cell-Laden Gelatin Methacrylate Substrate
Abstract
:1. Introduction
2. Result and Discussion
2.1. Material Characterization of GelMA
2.2. Encapsulation of SCs in GelMA
2.3. PC-12 Cells Proliferation and Differentiation with SCs Co-Culture
2.4. Neurotrophic Factors Expression
3. Conclusions
4. Materials and Methods
4.1. Materials
4.2. Synthesis of GelMA
4.3. Scanning Electron Microscope
4.4. Mechanical Characterization
4.5. Swelling Test
4.6. Cell Culture
4.7. SCs Encapsulation in GelMA
4.8. Co-Culture of PC-12 Cells and SCs on GelMA
4.9. Cellular Proliferation Analysis
4.10. Live-Dead Assay
4.11. Immunofluorescent Assay
4.12. Real-Time PCR
4.13. ELISA Assay for the Secretion of Neurotrophic Factors
4.14. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Johnson, E.O.; Zoubos, A.B.; Soucacos, P.N. Regeneration and repair of peripheral nerves. Injury 2005, 36, 24–29. [Google Scholar] [CrossRef] [PubMed]
- Höke, A. Mechanisms of Disease: What factors limit the success of peripheral nerve regeneration in humans? Nat. Clin. Pract. Neurol. 2006, 2, 448–454. [Google Scholar] [CrossRef] [PubMed]
- Du, J.; Chen, H.; Qing, L.; Yang, X.; Jia, X. Biomimetic neural scaffolds: A crucial step towards optimal peripheral nerve regeneration. Biomater. Sci. 2018, 6, 1299–1311. [Google Scholar] [CrossRef] [PubMed]
- Hu, Y.; Wu, Y.; Gou, Z.; Tao, J.; Zhang, J.; Liu, Q.; Kang, T.; Jiang, S.; Huang, S.; He, J.; et al. 3D-engineering of Cellularized Conduits for Peripheral Nerve Regeneration. Sci. Rep. 2016, 6, 32184. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jahromi, M.; Razavi, S.; Bakhtiari, A. The advances in nerve tissue engineering: From fabrication of nerve conduit to in vivo nerve regeneration assays. J. Tissue Eng. Regen. Med. 2019, 13, 2077–2100. [Google Scholar] [CrossRef]
- Tang, S.; Zhu, J.; Xu, Y.; Xiang, A.P.; Jiang, M.H.; Quan, D. The effects of gradients of nerve growth factor immobilized PCLA scaffolds on neurite outgrowth in vitro and peripheral nerve regeneration in rats. Biomaterials 2013, 34, 7086–7096. [Google Scholar] [CrossRef]
- Daly, W.T.; Knight, A.M.; Wang, H.; de Boer, R.; Giusti, G.; Dadsetan, M.; Spinner, R.J.; Yaszemski, M.J.; Windebank, A.J. Comparison and characterization of multiple biomaterial conduits for peripheral nerve repair. Biomaterials 2013, 34, 8630–8639. [Google Scholar] [CrossRef]
- Zhang, D.; Suo, H.; Qian, J.; Yin, J.; Fu, J.; Huang, Y. Physical understanding of axonal growth patterns on grooved substrates: Groove ridge crossing versus longitudinal alignment. Bio-Des. Manuf. 2020, 3, 348–360. [Google Scholar] [CrossRef]
- Hoffman, A.S. Hydrogels for biomedical applications. Adv. Drug Deliv. Rev. 2012, 64, 18–23. [Google Scholar] [CrossRef]
- Han, M.-E.; Kang, B.J.; Kim, S.-H.; Kim, H.D.; Hwang, N.S. Gelatin-based extracellular matrix cryogels for cartilage tissue engineering. J. Ind. Eng. Chem. 2017, 45, 421–429. [Google Scholar] [CrossRef]
- Dosorio, A.; Lee, B.E.J.; Kwiecien, J.M.; Wang, X.; Shahid, I.; Hurley, A.L.; Cranston, E.D.; Grandfield, K. Cross-linked cellulose nanocrystal aerogels as viable bone tissue scaffolds. Acta Biomater. 2019, 87, 152–165. [Google Scholar]
- Yahya, E.B.; Amirul, A.A.; Olaiya, N.G.; Iqbal, M.O.; Jummaat, F.; Adnan, A.S. Insights into the Role of Biopolymer Aerogel Scaffolds in Tissue Engineering and Regenerative Medicine. Polymers 2021, 13, 1612. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Wu, Y.; Xiang, Y.; Kruth, M.B.; Wei, P.; Dai, G.; Xu, K.; Yin, J.; Huang, Y. Efficacy of Large Groove Texture on Rat Sciatic Nerve Regeneration In Vivo Using Polyacrylonitrile Nerve Conduits. Ann. Biomed. Eng. 2021, 49, 394–406. [Google Scholar] [CrossRef] [PubMed]
- Suo, H.; Wang, Z.; Dai, G.; Fu, J.; Yin, J.; Chang, L. Polyacrylonitrile Nerve Conduits with Inner Longitudinal Grooved Textures to Enhance Neuron Directional Outgrowth. J. Microelectromech. Syst. 2018, 27, 457–463. [Google Scholar] [CrossRef]
- Liu, J.; Zhang, B.; Li, L.; Yin, J.; Fu, J. Additive-lathe 3D bioprinting of bilayered nerve conduits incorporated with supportive cells. Bioact. Mater. 2021, 6, 219–229. [Google Scholar] [CrossRef]
- Johnson, P.J.; Wood, M.D.; Moore, A.M.; Mackinnon, S.E. Tissue engineered constructs for peripheral nerve surgery. Eur. Surg. 2013, 45, 122–135. [Google Scholar] [CrossRef] [Green Version]
- Thoenen, H.; Barde, Y.A.; Davies, A.M.; Johnson, J.E. Neurotrophic factors, and neuronal death. Ciba Found. Symp. 1987, 126, 82–95. [Google Scholar]
- Levi-Montalcini, R. The Nerve Growth Factor 35 Years Later. Science 1987, 237, 1154–1162. [Google Scholar] [CrossRef]
- Lee, A.C.; Yu, V.M.; Lowe, J.B.; Brenner, M.J.; Hunter, D.A.; Mackinnon, S.E.; Sakiyama-Elbert, S.E. Controlled release of nerve growth factor enhances sciatic nerve regeneration. Exp. Neurol. 2003, 184, 295–303. [Google Scholar] [CrossRef]
- Near, S.L.; Whalen, L.R.; Miller, J.A.; Ishii, D.N. Insulin-like growth factor II stimulates motor nerve regeneration. Proc. Natl. Acad. Sci. USA 1992, 89, 11716. [Google Scholar] [CrossRef] [Green Version]
- Gospodarowicz, D.; Ferrara, N.; Schweigerer, L.; Neufeld, G. Structural characterization and biological functions of fibroblast growth factor. Endocr. Rev. 1987, 8, 95–114. [Google Scholar] [CrossRef] [PubMed]
- Ito, Y. Regulation of cellular gene expression by artifcial materials immobilized with biosignal molecules. Jpn J. Artif. Organs 1998, 27, 541–544. [Google Scholar]
- Kim, S.M.; Ueki, M.; Ren, X.; Akimoto, J.; Sakai, Y.; Ito, Y. Micropatterned nanolayers immobilized with nerve growth factor for neurite formation of PC12 cells. Int. J. Nanomed. 2019, 14, 7683–7694. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yu, L.M.; Wosnick, J.H.; Shoichet, M.S. Miniaturized system of neurotrophin patterning for guided regeneration. J. Neurosci. Methods 2008, 171, 253–263. [Google Scholar] [CrossRef] [PubMed]
- Zhang, K.; Huang, D.; Yan, Z.; Wang, C. Heparin/collagen encapsulating nerve growth factor multilayers coated aligned PLLA nanofibrous scaffolds for nerve tissue engineering. J. Biomed. Mater. Res. A 2017, 105, 1900–1910. [Google Scholar] [CrossRef] [PubMed]
- Dinis, T.M.; Elia, R.; Vidal, G.; Dermigny, Q.; Denoeud, C.; Kaplan, D.L.; Egles, C.; Marin, F. 3D multi-channel bi-functionalized silk electrospun conduits for peripheral nerve regeneration. J. Mech. Behav. Biomed. Mater. 2015, 41, 43–55. [Google Scholar] [CrossRef]
- Guénard, V.; Xu, X.M.; Bunge, M.B. The use of schwann cell transplantation to foster central nervous system repair. Semin. Neurosci. 1993, 5, 401–411. [Google Scholar] [CrossRef]
- Aszmann, O.C.; Korak, K.J.; Luegmair, M.; Frey, M. Bridging critical nerve defects through an acellular homograft seeded with autologous schwann cells obtained from a regeneration neuroma of the proximal stump. J. Reconstr. Microsurg. 2008, 24, 151–158. [Google Scholar] [CrossRef]
- Wu, Z.; Li, Q.; Xie, S.; Shan, X.; Cai, Z. In vitro and in vivo biocompatibility evaluation of a 3D bioprinted gelatin-sodium alginate/rat Schwann-cell scaffold. Mater. Sci. Eng. C Mater. Biol. Appl. 2020, 109, 110530. [Google Scholar] [CrossRef]
- Xia, L.; Wan, H.; Hao, S.Y.; Li, D.Z.; Chen, G.; Gao, C.C.; Li, J.H.; Yang, F.; Wang, S.G.; Liu, S. Co-transplantation of neural stem cells and Schwann cells within poly (L-lactic-co-glycolic acid) scaffolds facilitates axonal regeneration in hemisected rat spinal cord. Chin. Med. J. 2013, 126, 909–917. [Google Scholar]
- Zeng, Y.S.; Ding, Y.; Wu, L.Z.; Guo, J.S.; Li, H.B.; Wong, W.M.; Wu, W.T. Co-transplantation of schwann cells promotes the survival and differentiation of neural stem cells transplanted into the injured spinal cord. Dev. Neurosci. 2005, 27, 20–26. [Google Scholar] [CrossRef] [PubMed]
- Xu, K.; Wang, Z.; Copland, J.A.; Chakrabarti, R.; Florczyk, S.J. 3D porous chitosan-chondroitin sulfate scaffolds promote epithelial to mesenchymal transition in prostate cancer cells. Biomaterials 2020, 254, 120126. [Google Scholar] [CrossRef] [PubMed]
- Yin, J.; Yan, M.; Wang, Y.; Fu, J.; Suo, H. 3D Bioprinting of Low-Concentration Cell-Laden Gelatin Methacrylate (GelMA) Bioinks with a Two-Step Cross-linking Strategy. ACS Appl. Mater. Interfaces 2018, 10, 6849–6857. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Li, L.; Suo, H.; Yan, M.; Yin, J.; Fu, J. 3D printing of biomimetic multi-layered GelMA/nHA scaffold for osteochondral defect repair. Mater. Des. 2019, 171, 107708. [Google Scholar] [CrossRef]
- Wu, Y.; Xiang, Y.; Fang, J.; Li, X.; Lin, Z.; Dai, G.; Yin, J.; Wei, P.; Zhang, D. The influence of the stiffness of GelMA substrate on the outgrowth of PC12 cells. Biosci. Rep. 2019, 39. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.C.; Lin, R.Z.; Qi, H.; Yang, Y.; Bae, H.; Melero-Martin, J.M.; Khademhosseini, A. Functional Human Vascular Network Generated in Photocrosslinkable Gelatin Methacrylate Hydrogels. Adv. Funct. Mater. 2012, 22, 2027–2039. [Google Scholar] [CrossRef] [Green Version]
- Nichol, J.W.; Koshy, S.T.; Bae, H.; Hwang, C.M.; Yamanlar, S.; Khademhosseini, A. Cell-laden microengineered gelatin methacrylate hydrogels. Biomaterials 2010, 31, 5536–5544. [Google Scholar] [CrossRef] [Green Version]
- Athirasala, A.; Lins, F.; Tahayeri, A.; Hinds, M.; Smith, A.J.; Sedgley, C.; Ferracane, J.; Bertassoni, L.E. A Novel Strategy to Engineer Pre-Vascularized Full-Length Dental Pulp-like Tissue Constructs. Sci. Rep. 2017, 7, 3323. [Google Scholar] [CrossRef] [Green Version]
- Thakur, T.; Xavier, J.R.; Cross, L.; Jaiswal, M.K.; Mondragon, E.; Kaunas, R.; Gaharwar, A.K. Photocrosslinkable and elastomeric hydrogels for bone regeneration. J. Biomed. Mater. Res. A 2016, 104, 879–888. [Google Scholar] [CrossRef]
- Yuan, Z.; Yuan, X.; Zhao, Y.; Cai, Q.; Wang, Y.; Luo, R.; Yu, S.; Wang, Y.; Han, J.; Ge, L.; et al. Injectable GelMA Cryogel Microspheres for Modularized Cell Delivery and Potential Vascularized Bone Regeneration. Small 2021, 17, e2006596. [Google Scholar] [CrossRef]
- Xiao, S.; Zhao, T.; Wang, J.; Wang, C.; Du, J.; Ying, L.; Lin, J.; Zhang, C.; Hu, W.; Wang, L.; et al. Gelatin Methacrylate (GelMA)-Based Hydrogels for Cell Transplantation: An Effective Strategy for Tissue Engineering. Stem Cell Rev. Rep. 2019, 15, 664–679. [Google Scholar] [CrossRef] [PubMed]
- Liu, T.; Weng, W.; Zhang, Y.; Sun, X.; Yang, H. Applications of Gelatin Methacryloyl (GelMA) Hydrogels in Microfluidic Technique-Assisted Tissue Engineering. Molecules 2020, 25, 5305. [Google Scholar] [CrossRef]
- Ning, L.; Xu, Y.; Chen, X.; Schreyer, D.J. Influence of mechanical properties of alginate-based substrates on the performance of Schwann cells in culture. J. Biomater. Sci. Polym. Ed. 2016, 27, 898–915. [Google Scholar] [CrossRef] [PubMed]
- Blumenthal, J.; Cohen-Matsliah, S.I.; Levenberg, S. Olfactory bulb-derived cells seeded on 3D scaffolds exhibit neurotrophic factor expression and pro-angiogenic properties. Tissue Eng. Part A 2013, 19, 2284–2291. [Google Scholar] [CrossRef] [PubMed]
- Kimura, Y.; Ozeki, M.; Inamoto, T.; Tabata, Y. Adipose tissue engineering based on human preadipocytes combined with gelatin microspheres containing basic fibroblast growth factor. Biomaterials 2003, 24, 2513–2521. [Google Scholar] [CrossRef]
- Dreesmann, L.; Ahlers, M.; Schlosshauer, B. The pro-angiogenic characteristics of a cross-linked gelatin matrix. Biomaterials 2007, 28, 5536–5543. [Google Scholar] [CrossRef] [PubMed]
- Klotz, B.J.; Gawlitta, D.; Rosenberg, A.; Malda, J.; Melchels, F.P.W. Gelatin-Methacryloyl Hydrogels: Towards Biofabrication-Based Tissue Repair. Trends Biotechnol. 2016, 34, 394–407. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shahidi, S.; Janmaleki, M.; Riaz, S.; Nezhad, A.S.; Syed, N. A tuned gelatin methacryloyl (GelMA) hydrogel facilitates myelination of dorsal root ganglia neurons in vitro. Mater. Sci. Eng. C Mater. Biol. Appl. 2021, 126, 112131. [Google Scholar] [CrossRef]
- Leibrock, J.; Lottspeich, F.; Hohn, A.; Hofer, M.; Hengerer, B.; Masiakowski, P.; Thoenen, H.; Barde, Y.-A. Molecular cloning and expression of brain-derived neurotrophic factor. Nature 1989, 341, 149–152. [Google Scholar] [CrossRef]
- Klein, R.; Nanduri, V.; Jing, S.A.; Lamballe, F.; Tapley, P.; Bryant, S.; Cordon-Cardo, C.; Jones, K.R.; Reichardt, L.F.; Barbacid, M. The trkB tyrosine protein kinase is a receptor for brain-derived neurotrophic factor and neurotrophin-3. Cell 1991, 66, 395–403. [Google Scholar] [CrossRef]
- An, Y.H.; Wan, H.; Zhang, Z.S.; Wang, H.Y.; Gao, Z.X.; Sun, M.Z.; Wang, Z.C. Effect of rat Schwann cell secretion on proliferation and differentiation of human neural stem cells. Biomed. Environ. Sci. 2003, 16, 90–94. [Google Scholar] [PubMed]
- Li, X.; Zhou, D.; Jin, Z.; Chen, H.; Wang, X.; Zhang, X.; Xu, T. A coaxially extruded heterogeneous core-shell fiber with Schwann cells and neural stem cells. Regen. Biomater. 2020, 7, 131–139. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yu, Z.; Men, Y.; Dong, P. Schwann cells promote the capability of neural stem cells to differentiate into neurons and secret neurotrophic factors. Exp. Ther. Med. 2017, 13, 2029–2035. [Google Scholar] [CrossRef] [Green Version]
- Wu, S.; Chen, M.-S.; Maurel, P.; Lee, Y.-s.; Bunge, M.B.; Arinzeh, T.L. Aligned fibrous PVDF-TrFE scaffolds with Schwann cells support neurite extension and myelination in vitro. J. Neural Eng. 2018, 15, 056010. [Google Scholar] [CrossRef] [PubMed]
- Aregueta-Robles, U.A.; Martens, P.J.; Poole-Warren, L.A.; Green, R.A. Tissue engineered hydrogels supporting 3D neural networks. Acta Biomater. 2019, 95, 269–284. [Google Scholar] [CrossRef]
- Park, J.; Kang, Y.; Kim, J.; Lee, J.; Kim, H. 3D microenvironment of collagen hydrogel enhances the release of neurotrophic factors from human umbilical cord blood cells and stimulates the neurite outgrowth of human neural precursor cells. Biochem. Biophys. Res. Commun. 2014, 447, 400–406. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Mao, Q.; Yin, J.; Wang, Y.; Fu, J.; Huang, Y. Theoretical prediction and experimental validation of the digital light processing (DLP) working curve for photocurable materials. Addit. Manuf. 2021, 37, 101716. [Google Scholar] [CrossRef]







| Primer Name | Sequence (F) 5′–3′ | Sequence (R) 5′–3′ |
|---|---|---|
| ACTIN | CCGCGAGTACAACCTTCTTG | CAGTTGGTGACAATGCCGTG |
| Ki67 | CGCAGGAAGACTCGCAGTTT | CTGAATCTGCTAATGTCGCCAA |
| NGF | GGACGCAGCTTTCTATCCTGG | CCCTCTGGGACATTGCTATCTG |
| BDNF | TCATACTTCGGTTGCATGAAGG | AGACCTCTCGAACCTGCCC |
| GDNF | CTGACTTGGGTTTGGGCTAC | CCTGGCCTACCTTGTCACTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, Y.; Xu, K.; Liu, J.; Dai, G.; Yin, J.; Wei, P. Promotion of Adrenal Pheochromocytoma (PC-12) Cell Proliferation and Outgrowth Using Schwann Cell-Laden Gelatin Methacrylate Substrate. Gels 2022, 8, 84. https://doi.org/10.3390/gels8020084
Huang Y, Xu K, Liu J, Dai G, Yin J, Wei P. Promotion of Adrenal Pheochromocytoma (PC-12) Cell Proliferation and Outgrowth Using Schwann Cell-Laden Gelatin Methacrylate Substrate. Gels. 2022; 8(2):84. https://doi.org/10.3390/gels8020084
Chicago/Turabian StyleHuang, Yuye, Kailei Xu, Jingyi Liu, Guangli Dai, Jun Yin, and Peng Wei. 2022. "Promotion of Adrenal Pheochromocytoma (PC-12) Cell Proliferation and Outgrowth Using Schwann Cell-Laden Gelatin Methacrylate Substrate" Gels 8, no. 2: 84. https://doi.org/10.3390/gels8020084
APA StyleHuang, Y., Xu, K., Liu, J., Dai, G., Yin, J., & Wei, P. (2022). Promotion of Adrenal Pheochromocytoma (PC-12) Cell Proliferation and Outgrowth Using Schwann Cell-Laden Gelatin Methacrylate Substrate. Gels, 8(2), 84. https://doi.org/10.3390/gels8020084

