Next Article in Journal
Modulation of IL-1β and TGF-β1 Gene Expression in Stress-Induced Depression Rat Supplemented with Malaysian Acacia Honey
Previous Article in Journal
Transparent Packaging for Tea: Exploring the Role of Trust in Emerging Markets for Tea Beverages
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Foods
Volume 14
Issue 22
10.3390/foods14223894
foods-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Role of ccpA in Nitrogen Source-Induced Heat and Oxidative Stress Tolerance Changes in Lacticaseibacillus rhamnosus

by
Mengting Li
1,2,
Haohao Cheng
1,3,
Qiming Li
4,
Yue Sun
1,2,
You Wu
1,2,
Haikang Wang
1,2,
Yunchao Wa
1,2,
Dawei Chen
1,2,
Chengran Guan
1,2,
Yujun Huang
1,2,
Ruixia Gu
1,2 and
Chenchen Zhang
1,2,*
1
School of Food Science and Engineering, Yangzhou University, Yangzhou 225127, China
2
Jiangsu Provincial Key Laboratory of Probiotics and Dairy Deep Processing, Yangzhou University, Yangzhou 225127, China
3
Department of Medical Technology, Guangxi Health Science College, Nanning 530021, China
4
Dairy Nutrition and Function Key Laboratory of Sichuan Province, New Hope Dairy Co., Ltd., Chengdu 610023, China
*
Author to whom correspondence should be addressed.
Foods 2025, 14(22), 3894; https://doi.org/10.3390/foods14223894
Submission received: 10 October 2025 / Revised: 4 November 2025 / Accepted: 13 November 2025 / Published: 14 November 2025
(This article belongs to the Section Food Microbiology)
Browse Figures
Versions Notes

Abstract

The viable bacterial count is a crucial quality indicator for lactic acid bacteria (LAB) starters and fermented foods. Metabolic activity is an integral component of stress tolerance pathways. Lacticaseibacillus rhamnosus exhibits enhanced heat and oxidative stress tolerance in tryptone-free media. To investigate the stress tolerance mechanisms from a metabolic perspective, the heat and oxidative stress tolerance and transcriptomic changes in L. rhamnosus hsryfm 1301 and its ccpA deficient strain (ΔccpA) were analyzed under different nitrogen source conditions. Slower growth, decreased heat stress tolerance, and enhanced oxidative stress tolerance were observed in ΔccpA in MRS. Compared to the wild-type strain, 260 genes were upregulated and 55 genes were downregulated in ΔccpA, mainly including carbon source transport and metabolism genes, but no typical stress tolerance genes. The regulation of pfk, pyk, dnaK, and groEL was different from that in other lactic acid bacteria. The pathways related to acetate production were regulated solely by ccpA deletion, while dnaK, groEL, and de novo pyrimidine synthesis genes were only regulated by tryptone. Fatty acid and purine synthesis genes and glmS were co-regulated by ccpA and tryptone. The deletion of ccpA eliminated the nitrogen source-induced oxidative stress tolerance changes. It was found that ccpA in L. rhamnosus can affect both carbon and nitrogen source metabolism, altering stress tolerance.

Graphical Abstract

1. Introduction

Lactic acid bacteria (LAB) are widely used in food production. Their metabolic activities impart unique flavors, textures, and extended shelf life to food, making it more acceptable and digestible for humans [1]. Moreover, the live bacterial cells, upon entering the human body, can exert probiotic effects such as regulating gut microbiota, modulating immunity, and producing beneficial substances [2]. Therefore, the viable bacterial count is a crucial quality indicator for LAB starters and fermented foods.
LAB have a long history of application in food fermentation. With the confirmation of their probiotic functions, their forms in food have become increasingly diverse (including starters, fermentation broths, bacterial powders, cell pastes, granules, etc.). During production, transportation, and storage, LAB encounter more complex stress scenarios (such as spray drying) involving acid, oxidation, heat, osmotic pressure, and freezing, posing greater challenges to maintaining their viability [3]. Therefore, stress tolerance mechanisms of LAB have consistently been a research hotspot in this field.
Stress tolerance in microbes is a complex environmental response. Using random gene inactivation, comparative genomics, transcriptomics, and proteomics, researchers have identified numerous typical genes and pathways like ctsR, hrcA, lexA, relA, and two -/multi-component systems [4,5,6,7]. In recent years, omics data have revealed that among the hundreds of genes responding to a single stressor, a significant proportion are often metabolism-related genes. Moreover, the regulation of these genes is more sensitive and widespread compared to typical stress tolerance genes [8,9]. This indicates that metabolic activities not only play a crucial role in microbial growth but also an integral component of stress tolerance pathways.
Lacticaseibacillus rhamnosus is widely distributed in the human gut and breast milk [10,11], recognized as one of the most extensively studied and applied probiotics. Strains such as hsryfm 1301, GG, HN001, LYO, and SP1 exhibit enhanced heat and oxidative stress tolerance under low-tryptone conditions. Moreover, amino acids including glutamate, methionine, alanine, histidine, isoleucine, and phenylalanine significantly reduce their heat and oxidative stress tolerance [12]. This indicates that nitrogen metabolism critically modulates the stress tolerance of L. rhamnosus. However, the nitrogen metabolism regulator GlnR only affects induced heat and oxidative stress tolerance (e.g., via sublethal preadaptation) and has no impact on direct heat/oxidative shock resistance [13].
CcpA, the global regulator of carbon catabolism, is another extensively studied metabolic regulatory element in LAB. In the presence of glucose, CcpA binds with cofactors such as fructose-1,6-bisphosphate and phosphate groups to repress the utilization of non-preferred carbon sources [14]. Additionally, CcpA performs other regulatory functions. In lactic acid bacteria such as Lactiplantibacillus plantarum, Lactobacillus delbrueckii, and Lactococcus lactis, inactivating the ccpA gene affects the expression of over a hundred genes. These genes are involved in carbon and nitrogen source utilization, stress tolerance, and metabolic flux redistribution [15,16,17,18]. Significantly, both oxidative stress and heat stress tolerance in these LAB is controlled by CcpA [19].
This study focused on L. rhamnosus hsryfm 1301 and its ccpA deficient strain. By analyzing their stress tolerance capabilities under different nitrogen source conditions combined with transcriptome data, we aimed to investigate whether the ccpA gene plays a role in nitrogen source-induced alterations of heat stress and oxidative stress tolerance in L. rhamnosus.

2. Materials and Methods

2.1. Bacterial Strains, Plasmids, and Growth Conditions

The strains used in this study are listed in Table 1. L. rhamnosus hsryfm 1301 was firstly isolated from the gut of a centenarian, possessing valuable probiotic properties [20,21]. L. rhamnosus strains were cultured in de Man, Rogosa and Sharpe (MRS) broth (2% (v/v) inoculation) at 37 °C under static incubation. Plasmid construction was implemented using Escherichia coli XL1-Blue as the host [13].
The base formulation for MRS medium (tryptone 10 g L−1) was as described in a previous study [12]. NP-MRS (tryptone-free MRS) were prepared according to our previous studies [22].
Table 1. The strains and plasmids used in this study.
Table 1. The strains and plasmids used in this study.
StrainsGenotype or Characteristics
L. rhamnosus hsryfm1301Chinese centenarian; CGMCC No. 8545
L. rhamnosus ΔccpAccpA mutant of L. rhamnosus hsryfm 1301
L. rhamnosus ∆ccpA/pccpA(L.r.)+L. rhamnosus ΔccpA with pccpA(L.r.)+
L. rhamnosus ∆ccpA/pccpA(L.p.)+L. rhamnosus ΔccpA with pccpA(L.p.)+
L. paracasei PC-01Commercially available drink Youyi C
E. coli XL1-BlueSHBCC, Shanghai, China
PlasmidsGenotype or Characteristics
pUC19eErmr, pUC19 derivative [12]
pUC19e-ccpAUDErmr, pUC19e derivative with upstream and downstream sequences of ccpA gene
pMG36eErmr [23]
pccpA(L.r.)+Ermr, pMG36e derivative with ccpA gene of L. rhamnosus hsryfm 1301
pccpA(L.p.)+Ermr, pMG36e derivative with ccpA gene of L. paracasei PC-01

2.2. Construction of Plasmids

The plasmids used in this study are listed in Table 1. Primers used are listed in Table 2. PrimeSTAR Max DNA polymerase, restriction enzymes, T4 DNA ligase (TaKaRa, Beijing, China), Taq polymerase, and ClonExpress Ultra One Step Cloning Kit (Vazyme, Nanjing, China) were used according to standard procedures.
The suicide vector, pUC19e-ccpAUD was constructed as previously described [13]. The upstream (amplified with primers Eco-ccpaupF and ccpaupR) and downstream (amplified with primers ccpadownF and hind-ccpadownR) sequences of the ccpA gene of L. rhamnosus hsryfm 1301 were PCR spliced and inserted into pUC19e.
The pMG36e fragment was amplified with primers pMG36eF and pMG36eR. The ccpA gene of L. rhamnosus hsryfm 1301 (1301-ccpA, including the promoter) was amplified with primers Eco-1301ccpAF and Hind-1301ccpAR. The pMG36e and 1301-ccpA fragments were digested with EcoR I and Hind III and ligated with T4 DNA ligase, resulting in pccpA(L.r.)+. The ccpA gene (FGL-ccpA, including the promoter) of Lacticaseibacillus paracasei PC-01 was amplified with primers 36e-FGL-ccpAF and 36e-FGL-ccpAR, and pccpA(L.r.)+ was constructed by fusing the pMG36e and FGL-ccpA fragments with the ClonExpress Ultra One Step Cloning Kit.

2.3. Gene Deletion and Complementation

The marker-free deletion of ccpA gene in L. rhamnosus hsryfm 1301 was implemented by using pUC19e-ccpAUD. The single-crossover mutants were identified using PCR with the primer pairs ccpaTestF/RV-M and ccpaTestR/M13c-F, and the ccpA mutants with double-crossover were identified using PCR with the primer pair ccpaTestF/ccpaTestR.
To complement the ccpA gene, pccpA(L.r.)+ and pccpA(L.p.)+ were, respectively, transformed into the ccpA mutant of L. rhamnosus hsryfm 1301 by electroporation (2500 V, 25 µF, 400 Ω).

2.4. Growth Investigation of L. rhamnosus Strains

Before the growth investigation, L. rhamnosus strains were activated by overnight incubation (20 h). The cultures were diluted 50-fold in 5 mL of fresh MRS broth, and growth curves were measured using a microbiological growth analyzer (Bioscreen C, LabSystems, Helsinki, Finland).

2.5. Detection of Heat Stress and Oxidative Stress Tolerance

After overnight incubation, L. rhamnosus hsryfm 1301, ΔccpA, ∆ccpA/pccpA(L.r.)+, and ∆ccpA/pccpA(L.p.)+ were diluted 50-fold in 5 mL of fresh MRS and NP-MRS broth, and incubated at 37 °C. OD600 values were measured using a biophotometer (BioPhotometer Plus, Eppendorf, Germany). Tolerance detection was performed when the OD600 reached 1.8–2.0 (in exponential phase). The treatment conditions of heat stress were 53 °C 1 h, 54 °C 1 h, 55 °C 1 h. The treatment conditions of oxidative stress were 2.0 mmol L−1 H2O2 1 h, 3.0 mmol L−1 H2O2 1 h, and 4.0 mmol L−1 H2O2 1 h. The viable counts of the samples before and after the treatment were measured as previously described, and the survival rates were calculated [12,24].

2.6. RNA Isolation, and RNA Sequencing (RNA-seq)

After overnight incubation, L. rhamnosus hsryfm 1301 was diluted 50-fold in 50 mL of fresh MRS (YM group) and NP-MRS (YN group), respectively, and so was L. rhamnosus ΔccpA (QM and QN group). When the OD600 values reached 1.8–2.0, RNA isolation, library construction and RNA-seq of the samples were performed according to a previous study [22].

2.7. Mapping Reads to the Reference Genome and Normalized Gene Expression

Mapping reads to the reference genome were performed according to a previous study [22,25].

2.8. Differential Expression Analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) Enrichment Analysis

Differential expression and KEGG enrichment analyses were performed as previously described [22]. Transcripts with |log2FoldChange| > 1 and p value < 0.05 were considered as differentially expressed genes (DEGs). Pathways with a p value ≤ 0.05 were considered significantly enriched [26].

2.9. Nucleotide Sequence Accession Numbers

The raw sequence data have been deposited in the Genome Sequence Archive at National Genomics Data Center [27,28], (GSA: CRA027319, CRX1820520-CRX1820531; publicly accessible at https://ngdc.cncb.ac.cn/gsa, accessed on 9 October 2025).

2.10. Statistical Analysis

Growth investigation, survival rate measurement, and RNA sequencing were repeated three times. Survival rates and fragments per kilobase of exon model per million mapped fragments (FPKM) were analyzed with GraphPad Prism (Version 9.0.0, GraphPad Software, San Diego, CA, USA) using one-way ANOVA with Tukey’s post hoc multiple comparison test (p < 0.05).

3. Results

3.1. Deletion and Complementation of ccpA Gene in L. rhamnosus Hsryfm 1301

An in-frame marker-free deletion of ccpA gene was implemented in L. rhamnosus hsryfm 1301, generating L. rhamnosus ΔccpA. Using the primer pair ccpaTestF/ccpaTestR, a 3292 bp band should be amplified from L. rhamnosus hsryfm 1301. Given ccpA’s coding sequence is 1002 bp, this primer pair should amplify a 2290 bp band from its ccpA deficient strain. The electrophoresis of L. rhamnosus hsryfm 1301 and the mutant matched expectations (Figure 1a), confirming the successful knockout of the ccpA gene. This ccpA deficient strain was designated as L. rhamnosus ΔccpA. With reference to the first derivative of OD600, L. rhamnosus hsryfm 1301 entered the stationary phase at 24 h, while ΔccpA exhibited a delayed entry into the stationary phase at 35 h. (Figure 1b). Although the growth rate of ΔccpA was slower, its final growth amount was not significantly affected. The ccpA sequences including their promoters from L. rhamnosus and L. paracasei are 1243 bp and 1250 bp in length, respectively. PCR results confirmed that both sequences were successfully complemented into ΔccpA, constructing L. rhamnosus ∆ccpA/pccpA(L.r.)+ and L. rhamnosus ∆ccpA/pccpA(L.p.)+ (Figure 1a). Growth curve analysis indicated that the growth rates of both complemented strains were restored to the level of the wild-type strain (Figure 1b). L. rhamnosus ∆ccpA/pccpA(L.p.)+ exhibiting higher growth, which might result from the difference between the genes from L. rhamnosus and L. paracasei.

3.2. Impact of ccpA Gene Knockout on Heat and Oxidative Stress Tolerance in L. rhamnosus

When the OD600 reached approximately 1.8 (using a biophotometer), the viable cell counts of both L. rhamnosus hsryfm 1301 and ΔccpA were in the range of 8.55–8.75 lg (CFU mL−1). After treatment at 53 °C, 54 °C, and 55 °C, the viable counts of L. rhamnosus hsryfm 1301 decreased to 8.48, 8.02, and 5.84 lg (CFU mL−1), respectively. In contrast, ΔccpA exhibited decreased viable counts of 8.10, 6.38, and 4.90 lg (CFU mL−1), respectively (Figure 2a). These results demonstrate that the ccpA knockout reduced the heat stress tolerance of ΔccpA. Following treatment with 2 mmol L−1, 3 mmol L−1, and 4 mmol L−1 H2O2, the viable counts of L. rhamnosus hsryfm 1301 decreased to 5.93, 5.36, and 4.06 lg (CFU mL−1), respectively. Conversely, ΔccpA showed significantly higher tolerance, with viable counts decreasing only to 7.93, 7.59, and 6.85 lg (CFU mL−1), respectively (Figure 2b). This indicates that the ccpA knockout enhanced the oxidative stress tolerance of ΔccpA across all three H2O2 concentrations. The ccpA gene is thus a key element in L. rhamnosus for tolerating both oxidative and heat stress.

3.3. The Impact of ccpA Knockout on Gene Transcription in L. rhamnosus

L. rhamnosus hsryfm 1301 and ΔccpA were cultured in MRS medium. When the OD600 reached approximately 1.8, transcriptomic data were determined using RNA sequencing technology. In ΔccpA, no detectable transcription of the ccpA gene was observed, further confirming the successful knockout of ccpA. Compared to the wild-type strain, 260 genes were upregulated and 55 genes were downregulated in the ccpA deficient strain. However, typical stress tolerance genes, such as the heat shock protein gene (hsp20), ATP-dependent protease genes (clpP, clpC, clpX, clpL), and molecular chaperone genes (groEL, groES, dnaK), were not included among them. KEGG analysis revealed enrichment in 16 metabolic pathways, including phosphotransferase system (PTS), fructose and mannose metabolism, pyruvate metabolism, fatty acid biosynthesis, propanoate metabolism, inositol phosphate metabolism, galactose metabolism, starch and sucrose metabolism, pentose and glucuronate interconversions, and ascorbate and aldarate metabolism (Figure 3a).
The overwhelming majority (184 out of 199) of the regulated carbon source transport and metabolism genes were upregulated, including 10 genes related to ascorbate and aldarate metabolism. Conversely, among the 12 regulated fatty acid synthesis genes, the accBCDA genes responsible for generating malonyl-CoA and the fabZHacpPfabDGF genes involved in fatty acid synthesis are downregulated. In the glycolysis/gluconeogenesis pathway, the pfkA gene (encoding 6-phosphofructokinase for fructose-1,6-bisphosphate synthesis) and the pyk gene (encoding pyruvate kinase for the conversion of phosphoenolpyruvate (PEP) to pyruvate) were not significantly regulated. However, the genes for their reverse reactions, fbp (encoding fructose-1,6-bisphosphatase) and ppdK (encoding phosphate dikinase), were upregulated. The ppdK gene was upregulated 28-fold. In the Pyruvate metabolism pathway, genes related to formate metabolism (pflA, pflB), acetyl-CoA generation (pdhDCBA), acetate generation (pta, ackA), and pyruvate oxidation (spxB) were upregulated. While the adhE gene, which consumes NADH, was downregulated (Figure 3b). In other aspects, the rate-limiting enzyme of hexosamine synthesis, glmS, was strongly downregulated. The nagA gene, which catalyzes the deacetylation of N-acetylglucosamine-6-phosphate (GlcNAc-6-P), and the glgC gene, which catalyzes the reaction of ATP and α-D-glucose-1-phosphate to produce ADP-glucose and pyrophosphate, are upregulated by 3.86 and 10.58 times, respectively. Overall, the strongest upregulation observed was approximately 2000-fold, while the strongest downregulation was 7%.

3.4. Changes in Heat and Oxidative Stress Tolerance of ΔccpA Under Different Nitrogen Conditions

Given the pronounced effect of ccpA on the strain’s heat and oxidative stress tolerance, differential treatment intensities were employed for the various strains to facilitate the successful acquisition of their stress tolerance variances across different nitrogen source conditions. In terms of heat stress tolerance, the wild-type strain exhibited survival rates of 3.09% in MRS and 10.84% in NP-MRS (Figure 4a), indicating that a tryptone-free environment significantly enhanced its heat stress tolerance. Similarly, the ccpA deficient strain (ΔccpA) also showed higher heat stress tolerance in NP-MRS compared to standard MRS (Figure 4b). The complemented strains exhibited the same trend in tolerance changes (Figure 4c,d). This indicates that the enhancing effect of a tryptone-free environment on the heat stress tolerance of L. rhamnosus was still present in the ccpA deficient mutant.
Regarding oxidative stress tolerance, the wild-type strain exhibited survival rates of 0.07% in MRS and 10.78% in tryptone-free MRS (Figure 5a). The tryptone-free environment significantly enhanced its oxidative stress tolerance. In contrast, ΔccpA showed an oxidative stress survival rate of 10.28% in NP-MRS and 10.79% in MRS (Figure 5b). Its survival rates in these two media were identical, indicating that the effect of nitrogen source on oxidative tolerance was abolished in the mutant. Moreover, in two complemented strains, the phenomenon of low-nitrogen enhancing oxidative stress tolerance was re-established, resulting in a trend consistent with the wild-type strain (Figure 5c,d). Therefore, the tryptone-free environment likely regulates the oxidative stress tolerance of L. rhamnosus through CcpA.

3.5. Effect of ccpA Gene Knockout on the Nitrogen Source Response in L. rhamnosus

The total number of genes regulated by tryptone was lower in the wild-type strain compared to the mutant strain, with 70 and 101 genes, respectively. The deletion of the ccpA gene caused a similar upregulation of carbon utilization and transport pathways in NP-MRS as in MRS. However, the number of regulated genes in these pathways was lower than in MRS (Table 3).
At the pathway level, purine metabolism and pyrimidine metabolism pathways were enriched in both the YM (wild-type in MRS) vs. YN (wild-type in NP-MRS) and QM (∆ccpA in MRS) vs. QN (∆ccpA in NP-MRS) groups, indicating that the transcription of these pathways was affected by nitrogen sources. Under low-nitrogen conditions, purine metabolism pathway was primarily upregulated, while pyrimidine metabolism pathway was primarily downregulated. Notably, in the YN vs. QN group, the purine metabolism pathway was also significantly regulated. In the wild-type strain, the fatty acid biosynthesis pathway was unaffected by the nitrogen source, but it was upregulated in the ccpA deficient strain (Table 3). This indicates that both purine metabolism and fatty acid biosynthesis pathways are simultaneously influenced by the ccpA gene and the nitrogen source environment. In the YM vs. YN group, 12 PTS sugar transport-related genes were upregulated but not enriched.
From an expression perspective, the genes involved in pyruvate metabolism were largely unaffected by the nitrogen source, but were upregulated in the mutant strain across different nitrogen conditions (Figure 6a). For typical stress tolerance genes, the transcription of groEL and dnaK was significantly upregulated by the tryptone-free environment. Other genes, such as hrcA, dnaJ, clpP, and hsp20, were also influenced by the tryptone-free environment (though their fold changes did not reach 2-fold), and this regulation was unaffected by the absence of the ccpA gene (Figure 6b). The pyrimidine de novo biosynthesis operon genes were downregulated by tryptone, with the same trend in both the wild-type and mutant strains (Figure 7a). Conversely, the genes of the purine de novo synthesis operon were upregulated by tryptone in both strains. However, the regulatory effect of the tryptone-free environment on the purine de novo synthesis operon genes was significantly stronger in the wild-type strain than in the mutant strain (Figure 7b), indicating that ccpA enhanced nitrogen source-mediated regulation of purine de novo biosynthesis. The tryptone-induced downregulation of fatty acid biosynthesis genes occurred only in MRS broth and not in low-nitrogen conditions (Figure 7c). Notably, the glms gene was downregulated by tryptone in the wild-type strain but upregulated in the mutant strain (Figure 7d). These findings demonstrate that ccpA exerts gene-specific effects on the nitrogen source response.

3.6. Effects of Cytosine on the Heat and Oxidative Stress Tolerance of L. rhamnosus

To investigate the impact of nucleotide metabolism on the heat and oxidative stress tolerance of L. rhamnosus, varying concentrations of cytosine were added to NP-MRS. The results showed that the addition of cytosine significantly reduced the heat stress tolerance of L. rhamnosus. Notably, when the cytosine concentration exceeded 0.2 g L−1, the heat stress tolerance of L. rhamnosus began to recover with increasing cytosine concentrations (Figure 8a). At 0.4 g L−1, cytosine reduced the oxidative stress survival rate of L. rhamnosus to approximately 15%. Higher concentrations of cytosine had a diminished effect on the oxidative stress tolerance of L. rhamnosus (Figure 8b). Importantly, in the cytosine-supplemented broth, L. rhamnosus showed significantly higher tolerance to heat and oxidative stress than in MRS broth.

4. Discussion

The carbon catabolite repression (CCR) in homolactic fermentation LAB (such as L. plantarum, L. delbrueckii, Lc. lactis, etc.) is dependent on the ccpA gene [15,29,30]. The ccpA gene regulates crucial physiological activities in these LAB, including nutrient utilization, growth, and stress tolerance, which are highly relevant to food production and development. However, the ccpA gene in L. rhamnosus, which is one of the most widely used probiotics, has not been studied.
In this study, an unmarked ccpA mutant of L. rhamnosus hsryfm 1301, ΔccpA, was constructed. After ccpA deletion, the mutant exhibited slow growth and a 10-h-delayed stationary phase, but the final biomass was not significantly affected. Complementation with the ccpA gene from either L. rhamnosus or L. paracasei restored the growth rate to the wild-type level. This suggests that, similar to Lc. lactis, L. plantarum, and L. delbrueckii [15,29,30], the ccpA gene increases the growth rate of L. rhamnosus, which may help it rapidly occupy ecological niches. The ccpA genes from L. rhamnosus and L. paracasei could play a similar role.
In L. rhamnosus, the deletion of ccpA led to the upregulation of 46 genes related to carbon source transport or involved in the utilization of fructose, mannose, galactose, starch, sucrose, and pentoses. This highlights the ccpA gene’s key role in CCR of L. rhamnosus. In Lc. lactis, several genes related to glycolysis (pfk, pyk, ldh) are upregulated by CcpA [17]. Similarly, in L. plantarum and L. delbrueckii, the same four glycolysis and lactate production genes (pfk, pyk, pgk, ldh) are significantly downregulated in ccpA mutants [15,16]. This downregulation is likely the main reason for the slower growth of the ccpA mutants in these three LAB species. However, in L. rhamnosus ΔccpA, pfk, pyk, and pgk were not downregulated, and ldh was even upregulated. Instead, the gluconeogenesis genes fbp (reverse reaction of pfk) and ppdK (reverse reaction of pyk) were upregulated. Therefore, in L. rhamnosus, CcpA enhances growth rate not by upregulating glycolysis, but by repressing gluconeogenesis. Additionally, GlmS is the rate-limiting enzyme in the hexosamine pathway, providing precursor molecules for the biosynthesis of peptidoglycan, essential components of bacterial cell walls [31]. The glmS gene was strongly downregulated in L. rhamnosus ΔccpA, with transcript levels only 7% of the wild-type strain, and the transcription of the fatty acid synthesis operon was also downregulated, which may also contribute to the reduced growth rate.
The regulatory scope of CcpA is broad; thus, its deletion impacts not only nutrient utilization and cell growth but also stress tolerance and environmental adaptation [15,16,17,18]. L. rhamnosus ΔccpA showed significantly stronger tolerance to oxidative stress at various intensities, but lower survival rates under heat stress conditions of varying intensities. Similarly, the ccpA deficient strain of L. plantarum exhibited stronger oxidative stress tolerance but lower tolerance to osmotic, cold, heat, and starvation stresses than the wild-type strain [19,32]. The L. delbrueckii ccpA mutant exhibited the same trend of changes in heat and oxidative stress tolerance [29]. For applications where oxidative stress is the primary concern, selecting natural variants or constructing strains with attenuated CcpA activity could be beneficial. Conversely, for processes involving heat stress, strains with fully functional CcpA are preferable. This highlights the potential for stress-specific starter culture selection.
In the ccpA deficient strain of L. plantarum, the decrease in heat stress tolerance was accompanied by decreased transcription of class I heat shock response genes, particularly dnaK, groEL, grpE, clpL, and clpE, which was confirmed by proteomic data [19,33,34]. These genes are related to oxidative stress and heat stress tolerance and may response to freeze-drying [35]. Furthermore, in the L. delbrueckii ccpA mutant, hrcA was upregulated, while tuf, dnaK, and groEL were downregulated [16]. These data point to the hypothesis that the reduced heat stress tolerance in ccpA mutants is related to the regulation of class I heat shock response genes. However, in L. rhamnosus ΔccpA, genes such as hrcA, groEL, groES, dnaK, hsp20, clpP, clpC, clpX, clpL, tuf, and ctsR were not regulated. This suggests that the reduced heat stress tolerance of L. rhamnosus was not caused by these typical stress tolerance genes, but rather by the transcriptional regulation of other genes.
Genes related to ROS detoxification, such as catalase and superoxide dismutase, were not found in the L. rhamnosus genome [36]. The deletion of ccpA also did not cause transcriptional changes in DNA repair genes (e.g., recA, uvrA, uvrB). In L. rhamnosus, pyruvate metabolism genes are upregulated under oxidative conditions [37]. Pyruvate metabolism genes were extensively regulated in ΔccpA. Genes in multiple pathways related to acetate production (phdDCBA, spxB/pox, pflAB, ackA) were upregulated. In L. plantarum, the regulation of pox and ack in mixed acid metabolism was consistent under aerobic cultivation, non-preferred carbon source cultivation, and ccpA deletion, along with nox (NADH oxidase gene) and npr (NADH peroxidase gene) involved in NAD/NADH cycling [15,19,38,39]. These pathways compete with LDH and can reduce NADH consumption. Furthermore, the NADH-consuming adhE and fatty acid synthesis pathways were downregulated in L. rhamnosus ΔccpA. Correspondingly, one of the two NADH oxidase genes was upregulated. Therefore, the enhanced oxidative stress tolerance in the L. rhamnosus ccpA mutant might be related to NADH/NAD balance. While the relative ratios of NADH/NAD were not directly measured in this study, it is a compelling hypothesis that the observed enhanced oxidative stress tolerance is facilitated by these metabolic adjustments. Future studies quantifying these metabolite pools will be critical to validate this proposed mechanism and to fully elucidate how CcpA-mediated regulation influences the redox economy of L. rhamnosus. Additionally, SpxB/Pox generates H2O2 when utilizing pyruvate, which could potentially pre-adapt the ccpA mutant to oxidative stress, thereby enhancing its tolerance.
LAB often live in nutrition-rich environments, relying mainly on external oligopeptide uptake for nitrogen sources and having weak amino acid self-synthesis ability [40]. Amino acids play a positive role in the tolerance of LAB to stresses such as acid, oxidation, and osmotic pressure. For instance, the decarboxylation of glutamate and aspartate, as well as the deamination of arginine, serve as crucial pathways for LAB to resist acid stress [41]. To combat oxidative stress, the reduction in cysteine is helpful [7]. Previous studies showed that low-nitrogen cultivation improves the heat and oxidative stress tolerance of L. rhamnosus [12,22]. GlnR is the global regulatory element for nitrogen source metabolism in lactobacilli. In environments with high amino acid or AMP concentrations, GlnR, assisted by GlnA, suppresses the transcription of genes related to nitrogen source transport, peptidases, and amino acid metabolism [42]. GlnR in Levilactobacillus brevis is associated with acid stress tolerance [43]. However, glnR in L. rhamnosus hsryfm 1301 only affects induced heat and oxidative stress tolerance (e.g., via sublethal preadaptation), but has no impact on direct heat/oxidative shock resistance [13].
After ccpA knockout, the ccpA mutant no longer showed enhanced oxidative stress tolerance under low nitrogen conditions. Complementation with the ccpA gene from either L. rhamnosus or L. paracasei restored the enhancing effect of low nitrogen cultivation on oxidative stress tolerance. In contrast, L. rhamnosus ΔccpA still exhibited higher heat stress tolerance under low nitrogen conditions. This suggests that the effect of nitrogen source on oxidative stress tolerance is mediated through the ccpA gene. This study reconfirmed that low-nitrogen conditions significantly enhance the heat stress and oxidative stress tolerance of L. rhamnosus. Modulating the nitrogen composition, specifically by reducing the concentration of tryptone or certain amino acids in the fermentation medium could be a viable approach to improve bacterial survival during subsequent processing stresses like spray drying, heat treatment, and storage. However, this enhancement effect depends on the ccpA gene. Therefore, the optimization of carbon sources should not be overlooked when adjusting the nitrogen source composition of the culture medium.
In both MRS and NP-MRS, L. rhamnosus hsryfm 1301 and ΔccpA showed strong consistency in the regulation of carbon source transport and utilization pathways, although the number of regulated genes within these pathways decreased. This indicates that the ccpA gene performs its CCR function under both conditions. The expression of genes related to mixed-acid metabolism (phdDCBA, spxB/pox, pflAB, ackA) was also unaffected by the nitrogen source environment. However, under low nitrogen conditions, the regulation of some genes was relieved. The downregulating effect of ccpA deletion on the fatty acid synthesis operon and glmS gene was weakened by low nitrogen conditions. These genes in the ccpA mutant were upregulated under low nitrogen. This indicates they are co-regulated by CcpA and nitrogen availability. The fatty acid synthesis operon directly affects the fatty acid composition of the cell membrane, thereby influencing membrane fluidity and stability [44], which may relate to heat stress tolerance. Furthermore, dnaK and groEL in L. rhamnosus hsryfm 1301 were both upregulated by low nitrogen conditions, and this upregulation was unaffected by the ccpA gene deletion, potentially also linked to changes in heat stress tolerance. The fluctuations in heat stress tolerance caused by ccpA deletion and changes in nitrogen source environment may result from distinct gene expression changes, whose specific functions require further study.
Various amino acid supplementations reverse the low-tryptone phenotypes of L. rhamnosus [12]. Nucleic acid metabolism is a downstream pathway of amino acid metabolism. A particularly intriguing finding was the differential regulation of the de novo purine and pyrimidine biosynthesis pathways by the interplay between CcpA and nitrogen availability. The de novo synthesis pathways of purine and pyrimidine in both L. rhamnosus hsryfm 1301 and ΔccpA were significantly regulated by nitrogen source, but in opposite directions. The de novo purine synthesis was upregulated under low nitrogen, while the de novo pyrimidine synthesis was downregulated. This suggests that the role of CcpA and nitrogen sensing extends beyond biomass production. Notably, transcript levels revealed that the upregulating effect of low nitrogen on de novo purine synthesis was significantly greater in the wild-type than in the ccpA mutant, indicating that the de novo purine synthesis pathway is co-regulated by CcpA and nitrogen availability, and ccpA deletion weakens nitrogen source regulation of the pur operon. We propose that the energy-intensive nature of purine synthesis makes it more dependent on the efficient carbon catabolism enforced by CcpA, explaining its upregulation when carbon flux is optimal. In L. plantarum, inactivation of ccpA also affects nucleotide metabolism, with its pyr operon being downregulated. Researchers speculated that CcpA might regulate the pyrimidine synthesis pathway by upregulating CO2 concentration or binding directly to the regulatory region [34]. After heat or oxidative stress pretreatment, L. rhamnosus hsryfm 1301 downregulates cytosine uptake genes [13]. Since de novo pyrimidine and purine synthesis pathways share common substrates, PRPP and glutamine, it is hypothesized that the upregulation of the pur operon in L. rhamnosus might have a similar effect to the downregulation of the pyr operon, namely increasing purine concentration and decreasing pyrimidine concentration. Adding 0.4–0.8 g L−1 cytosine to NP-MRS reduced both the heat and oxidative stress tolerance of L. rhamnosus hsryfm 1301, but the reduction was less than in medium supplemented with tryptone. This suggests that changes in nucleotide concentration might be one reason for amino acid-induced changes in stress tolerance, but other mechanisms exist. Nevertheless, this is a novel finding that the heat and oxidative stress tolerance of L. rhamnosus in foods might be enhanced by avoiding the use of components with high pyrimidine content. The reasons why oxidative stress tolerance in the L. rhamnosus ccpA mutant is unaffected by nitrogen concentration may include: (1) the deletion of ccpA relieved or weakened gene regulation; (2) the upregulation of mixed-acid metabolism genes caused by ccpA deletion masked the effect of nitrogen-regulated genes.

5. Conclusions

This study investigated the heat and oxidative stress tolerance, along with transcriptome changes, of L. rhamnosus and its ccpA mutant under different nitrogen source conditions. The ccpA gene is the central regulator of CCR in L. rhamnosus. Its presence enhances the growth rate of L. rhamnosus, maintains its homolactic fermentation pattern, improves its heat stress tolerance, and reduces its oxidative stress tolerance. Fatty acid metabolism and purine metabolism in L. rhamnosus are co-regulated by the ccpA gene and nitrogen levels. After ccpA deletion, the nitrogen source-induced changes in oxidative stress tolerance disappeared. The heat and oxidative stress tolerance of L. rhamnosus is determined by a complex metabolic network. This study further investigates the stress tolerance mechanisms of L. rhamnosus from a metabolic regulation perspective. The viability of LAB during food processing, such as heat treatment, dehydration, and spray drying, can be maintained by controlling the concentration of tryptone or the types of sugars.

Author Contributions

M.L.: Data curation; Formal analysis; Investigation; Writing—original draft. H.C.: Data curation; Investigation. Q.L.: Project administration; Resources. Y.S.: Investigation. Y.W. (You Wu): Data curation. H.W.: Investigation. Y.W. (Yunchao Wa): Software; Visualization. D.C.: Validation; Writing—review & editing. C.G.: Validation; Writing—review & editing. Y.H.: Validation; Writing—review & editing. R.G.: Conceptualization; Funding acquisition; Project administration; Resources. C.Z.: Conceptualization; Data curation; Funding acquisition; Methodology; Validation; Visualization; Writing—original draft; and Writing—review & editing. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (No. 32272333), the Sichuan Province Science and Technology Plan (2023YFN0101), the Jiangsu Province College Student Innovation and Entrepreneurship Training Program (202411117007Z), the Scientific and Technological Innovation Platform Co-built by Yangzhou City-Yangzhou University (YZ2020265), the High-level Talents Project of Yangzhou University and the Qinglan Project of Yangzhou University.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The raw sequence data have been deposited in the Genome Sequence Archive at National Genomics Data Center (GSA: CRA027319, CRX1820520-CRX1820531; publicly accessible at https://ngdc.cncb.ac.cn/gsa, accessed on 9 October 2025).

Acknowledgments

Sequencing service were provided by Personal Biotechnology Co., Ltd. Shanghai, China.

Conflicts of Interest

Author Qiming Li was employed by the company New Hope Dairy Co., Ltd. He participated in Project administration and Resources in the study. The role of the company was a Participant in the study. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Abbreviations

The following abbreviations are used in this manuscript:
LABLactic acid bacteria
KEGGKyoto Encyclopedia of Genes and Genomes
DEGsdifferentially expressed genes
FPKMfragments per kilobase of exon model per million mapped fragments
PTSPhosphotransferase system
CCRcarbon catabolite repression
ROSreactive oxygen species

References

  1. Hu, Y.; Zhang, L.; Wen, R.; Chen, Q.; Kong, B. Role of lactic acid bacteria in flavor development in traditional Chinese fermented foods: A review. Crit. Rev. Food Sci. Nutr. 2022, 62, 2741–2755. [Google Scholar] [CrossRef] [PubMed]
  2. Smolinska, S.; Popescu, F.D.; Zemelka-Wiacek, M. A Review of the Influence of Prebiotics, Probiotics, Synbiotics, and Postbiotics on the Human Gut Microbiome and Intestinal Integrity. J. Clin. Med. 2025, 14, 3673. [Google Scholar] [CrossRef]
  3. Parlindungan, E.; Jones, O.A.H. Using metabolomics to understand stress responses in Lactic Acid Bacteria and their applications in the food industry. Metabolomics 2023, 19, 99. [Google Scholar] [CrossRef]
  4. Rossi, F.; Zotta, T.; Iacumin, L.; Reale, A. Theoretical insight into the heat shock response (HSR) regulation in Lactobacillus casei and L. rhamnosus. J. Theor. Biol. 2016, 402, 21–37. [Google Scholar] [CrossRef]
  5. Kelley, W.L. Lex marks the spot: The virulent side of SOS and a closer look at the LexA regulon. Mol. Microbiol. 2006, 62, 1228–1238. [Google Scholar] [CrossRef]
  6. Starosta, A.L.; Lassak, J.; Jung, K.; Wilson, D.N. The bacterial translation stress response. FEMS Microbiol. Rev. 2014, 38, 1172–1201. [Google Scholar] [CrossRef] [PubMed]
  7. Papadimitriou, K.; Alegría, Á.; Bron, P.A.; de Angelis, M.; Gobbetti, M.; Kleerebezem, M.; Lemos, J.A.; Linares, D.M.; Ross, P.; Stanton, C.; et al. Stress Physiology of Lactic Acid Bacteria. Microbiol. Mol. Biol. Rev. 2016, 80, 837–890. [Google Scholar] [CrossRef] [PubMed]
  8. Basu Thakur, P.; Long, A.R.; Nelson, B.J.; Kumar, R.; Rosenberg, A.F.; Gray, M.J. Complex Responses to Hydrogen Peroxide and Hypochlorous Acid by the Probiotic Bacterium Lactobacillus reuteri. mSystems 2019, 4, e00453-19. [Google Scholar] [CrossRef]
  9. Zhang, C.; Cheng, H.; Han, Y.; Wa, Y.; Chen, D.; Guan, C.; Huang, Y.; Gu, R. Transcriptome-phenotype matching analysis of how nitrogen sources influence Lacticaseibacillus rhamnosus tolerance to heat stress and oxidative stress. Microb. Cell Fact. 2022, 21, 257. [Google Scholar] [CrossRef]
  10. Zhang, C.; Yu, X.; Wang, D.; Gui, Y.; Wang, C.; Li, Q.; Wang, J.; Yin, B.; Pan, Z.; Gu, R. Rapid strain-specific identification of two Lactobacillus rhamnosus strains using PCR based on gene family analysis. LWT 2021, 146, 111395. [Google Scholar] [CrossRef]
  11. Kang, W.; Pan, L.; Peng, C.; Dong, L.; Cao, S.; Cheng, H.; Wang, Y.; Zhang, C.; Gu, R.; Wang, J.; et al. Isolation and characterization of lactic acid bacteria from human milk. J. Dairy Sci. 2020, 103, 9980–9991. [Google Scholar] [CrossRef]
  12. Zhang, C.; Han, Y.; Gui, Y.; Wa, Y.; Chen, D.; Huang, Y.; Yin, B.; Gu, R. Influence of nitrogen sources on the tolerance of Lacticaseibacillus rhamnosus to heat stress and oxidative stress. J. Ind. Microbiol. Biotechnol. 2022, 49, kuac020. [Google Scholar] [CrossRef]
  13. Zhang, C.; Wang, H.; Han, Y.; Sun, Y.; Cheng, H.; Wa, Y.; Chen, D.; Guan, C.; Gu, R. The role of glnR gene in heat and oxidative stress cross-adaptation in Lacticaseibacillus rhamnosus. LWT 2024, 201, 116278. [Google Scholar] [CrossRef]
  14. Görke, B.; Stülke, J. Carbon catabolite repression in bacteria: Many ways to make the most out of nutrients. Nat. Rev. Microbiol. 2008, 6, 613–624. [Google Scholar] [CrossRef]
  15. Lu, Y.; Song, S.; Tian, H.; Yu, H.; Zhao, J.; Chen, C. Functional analysis of the role of CcpA in Lactobacillus plantarum grown on fructooligosaccharides or glucose: A transcriptomic perspective. Microb. Cell Fact. 2018, 17, 201. [Google Scholar] [CrossRef]
  16. Zhang, G.; Liu, L.; Li, C. Effects of ccpA gene deficiency in Lactobacillus delbrueckii subsp. bulgaricus under aerobic conditions as assessed by proteomic analysis. Microb. Cell Fact. 2020, 19, 9. [Google Scholar] [CrossRef] [PubMed]
  17. Zomer, A.L.; Buist, G.; Larsen, R.; Kok, J.; Kuipers, O.P. Time-resolved determination of the CcpA regulon of Lactococcus lactis subsp. cremoris MG1363. J. Bacteriol. 2007, 189, 1366–1381. [Google Scholar] [CrossRef] [PubMed]
  18. Kim, J.N.; Burne, R.A. CcpA and CodY Coordinate Acetate Metabolism in Streptococcus mutans. Appl. Environ. Microbiol. 2017, 83, e03274. [Google Scholar] [CrossRef] [PubMed]
  19. Zotta, T.; Ricciardi, A.; Guidone, A.; Sacco, M.; Muscariello, L.; Mazzeo, M.F.; Cacace, G.; Parente, E. Inactivation of ccpA and aeration affect growth, metabolite production and stress tolerance in Lactobacillus plantarum WCFS1. Int. J. Food Microbiol. 2012, 155, 51–59. [Google Scholar] [CrossRef]
  20. Chen, D.; Liang, Y.; Liang, J.; Shen, F.; Cheng, Y.; Qu, H.; Wa, Y.; Guo, C.; Gu, R.; Qian, J.; et al. Beneficial effects of Lactobacillus rhamnosus hsryfm 1301 fermented milk on rats with nonalcoholic fatty liver disease. J. Dairy Sci. 2023, 106, 1533–1548. [Google Scholar] [CrossRef]
  21. Qu, H.; Zong, L.; Sang, J.; Wa, Y.; Chen, D.; Huang, Y.; Chen, X.; Gu, R. Effect of Lactobacillus rhamnosus hsryfm 1301 Fermented Milk on Lipid Metabolism Disorders in High-Fat-Diet Rats. Nutrients 2022, 14, 4850. [Google Scholar] [CrossRef]
  22. Zhang, C.; Gui, Y.; Chen, X.; Chen, D.; Guan, C.; Yin, B.; Pan, Z.; Gu, R. Transcriptional homogenization of Lactobacillus rhamnosus hsryfm 1301 under heat stress and oxidative stress. Appl. Microbiol. Biotechnol. 2020, 104, 2611–2621. [Google Scholar] [CrossRef]
  23. van de Guchte, M.; van der Vossen, J.M.; Kok, J.; Venema, G. Construction of a lactococcal expression vector: Expression of hen egg white lysozyme in Lactococcus lactis subsp. lactis. Appl. Environ. Microbiol. 1989, 55, 224–228. [Google Scholar] [CrossRef]
  24. Zhang, C.; Yang, L.; Ding, Z.; Yin, B.; Chen, D.; Guan, C.; Gu, R. New selective media for isolation and enumeration of Lactobacillus rhamnosus and Streptococcus thermophilus. J. Food Meas. Charact. 2019, 13, 1431–1439. [Google Scholar] [CrossRef]
  25. Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods. 2012, 9, 357–359. [Google Scholar] [CrossRef]
  26. Kanehisa, M.; Araki, M.; Goto, S.; Hattori, M.; Hirakawa, M.; Itoh, M.; Katayama, T.; Kawashima, S.; Okuda, S.; Tokimatsu, T.; et al. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 2008, 36, D480–D484. [Google Scholar] [CrossRef] [PubMed]
  27. Chen, T.; Chen, X.; Zhang, S.; Zhu, J.; Tang, B.; Wang, A.; Dong, L.; Zhang, Z.; Yu, C.; Sun, Y.; et al. The Genome Sequence Archive Family: Toward Explosive Data Growth and Diverse Data Types. Genom. Proteom. Bioinf. 2021, 19, 578–583. [Google Scholar] [CrossRef]
  28. CNCB-NGDC Members and Partners. Database Resources of the National Genomics Data Center, China National Center for Bioinformation in 2025. Nuclei Acid Res. 2025, 53, D30–D44. [Google Scholar] [CrossRef]
  29. Li, C.; Sun, J.W.; Zhang, G.F.; Liu, L.B. Effect of the absence of the CcpA gene on growth, metabolic production, and stress tolerance in Lactobacillus delbrueckii ssp. bulgaricus. J. Dairy Sci. 2016, 99, 104–111. [Google Scholar] [CrossRef]
  30. Zhang, C.; Guo, T.; Xin, Y.; Gao, X.; Kong, J. Catabolite responsive element deficiency of xyl operon resulting in carbon catabolite derepression in Lactobacillus fermentum 1001. J. Appl. Microbiol. 2016, 120, 126–137. [Google Scholar] [CrossRef] [PubMed]
  31. Reichenbach, B.; Maes, A.; Kalamorz, F.; Hajnsdorf, E.; Görke, B. The small RNA GlmY acts upstream of the sRNA GlmZ in the activation of glmS expression and is subject to regulation by polyadenylation in Escherichia coli. Nucleic Acids Res. 2008, 36, 2570–2580. [Google Scholar] [CrossRef] [PubMed]
  32. Chen, C.; Huang, K.; Li, X.; Tian, H.; Yu, H.; Huang, J.; Yuan, H.; Zhao, S.; Shao, L. Effects of CcpA against salt stress in Lactiplantibacillus plantarum as assessed by comparative transcriptional analysis. Appl. Microbiol. Biotechnol. 2021, 105, 3691–3704. [Google Scholar] [CrossRef]
  33. Castaldo, C.; Siciliano, R.A.; Muscariello, L.; Marasco, R.; Sacco, M. CcpA affects expression of the groESL and dnaK operons in Lactobacillus plantarum. Microb. Cell Fact. 2006, 5, 35. [Google Scholar] [CrossRef] [PubMed]
  34. Mazzeo, M.F.; Cacace, G.; Peluso, A.; Zotta, T.; Muscariello, L.; Vastano, V.; Parente, E.; Siciliano, R.A. Effect of inactivation of ccpA and aerobic growth in Lactobacillus plantarum: A proteomic perspective. J. Proteom. 2012, 75, 4050–4061. [Google Scholar] [CrossRef]
  35. Sirima, S.J.; Pachamon, P.; Ratsadakorn, Y.M.; Cheng, K.C.; Kaemwich, J. Transcriptional analysis of oxidative-tolerant and temperature-sensitive genes of Bifidobacterium animalis BF052 during freeze-drying process and development of its soymilk-synbiotic product containing banana and jicama powders. Food Res. Int. 2025, 221, 117600. [Google Scholar] [CrossRef]
  36. An, H.; Zhai, Z.; Yin, S.; Luo, Y.; Han, B.; Hao, Y. Coexpression of the superoxide dismutase and the catalase provides remarkable oxidative stress resistance in Lactobacillus rhamnosus. J. Agric. Food Chem. 2011, 59, 3851–3856. [Google Scholar] [CrossRef]
  37. Dinarieva, T.Y.; Klimko, A.I.; Kahnt, J.; Cherdyntseva, T.A.; Netrusov, A.I. Adaptation of Lacticaseibacillus rhamnosus CM MSU 529 to Aerobic Growth: A Proteomic Approach. Microorganisms 2023, 11, 313. [Google Scholar] [CrossRef] [PubMed]
  38. Quatravaux, S.; Remize, F.; Bryckaert, E.; Colavizza, D.; Guzzo, J. Examination of Lactobacillus plantarum lactate metabolism side effects in relation to the modulation of aeration parameters. J. Appl. Microbiol. 2006, 101, 903–912. [Google Scholar] [CrossRef]
  39. Zhai, Z.; Yang, Y.; Wang, H.; Wang, G.; Ren, F.; Li, Z.; Hao, Y. Global transcriptomic analysis of Lactobacillus plantarum CAUH2 in response to hydrogen peroxide stress. Food Microbiol. 2020, 87, 103389. [Google Scholar] [CrossRef]
  40. Sun, J.; Chen, H.; Qiao, Y.; Liu, G.; Leng, C.; Zhang, Y.; Lv, X.; Feng, Z. The nutrient requirements of Lactobacillus rhamnosus GG and their application to fermented milk. J. Dairy Sci. 2019, 102, 5971–5978. [Google Scholar] [CrossRef]
  41. Yang, H.; He, M.; Wu, C. Cross protection of lactic acid bacteria during environmental stresses: Stress responses and underlying mechanisms. LWT 2021, 144, 111203. [Google Scholar] [CrossRef]
  42. Randazzo, P.; Aucouturier, A.; Delumeau, O.; Auger, S. Revisiting the in vivo GlnR-binding sites at the genome scale in Bacillus subtilis. BMC Res. Notes 2017, 10, 422. [Google Scholar] [CrossRef] [PubMed]
  43. Gong, L.; Ren, C.; Xu, Y. GlnR Negatively Regulates Glutamate-Dependent Acid Resistance in Lactobacillus brevis. Appl. Environ. Microbiol. 2020, 86, e02615-19. [Google Scholar] [CrossRef] [PubMed]
  44. Janßen, H.J.; Steinbüchel, A. Fatty acid synthesis in Escherichia coli and its applications towards the production of fatty acid based biofuels. Biotechnol. Biofuels 2014, 7, 7. [Google Scholar] [CrossRef] [PubMed]
Foods 14 03894 g001
Figure 1. Deletion and complementation of the ccpA gene. (a) Left: Verification of the knockout of the ccpA gene with primers ccpaTestF and ccpaTestR. C, L. rhamnosus hsryfm 1301; S, strain with double-crossover. Right: Verification of the complementation of the ccpA gene from L. rhamnosus hsryfm 1301 (h) or L. paracasei PC-01 (p). (b) Growth curves of L. rhamnosus hsryfm 1301, ΔccpA, ∆ccpA/pccpA(L.r.)+ and ∆ccpA/pccpA(L.p.)+.
Figure 1. Deletion and complementation of the ccpA gene. (a) Left: Verification of the knockout of the ccpA gene with primers ccpaTestF and ccpaTestR. C, L. rhamnosus hsryfm 1301; S, strain with double-crossover. Right: Verification of the complementation of the ccpA gene from L. rhamnosus hsryfm 1301 (h) or L. paracasei PC-01 (p). (b) Growth curves of L. rhamnosus hsryfm 1301, ΔccpA, ∆ccpA/pccpA(L.r.)+ and ∆ccpA/pccpA(L.p.)+.
Foods 14 03894 g001
Foods 14 03894 g002
Figure 2. Heat and oxidative stress tolerance of L. rhamnosus ΔccpA. (a) Heat stress tolerance. (b) Oxidative stress tolerance. a–g Values within each column with different superscripts are significantly different (p < 0.05).
Figure 2. Heat and oxidative stress tolerance of L. rhamnosus ΔccpA. (a) Heat stress tolerance. (b) Oxidative stress tolerance. a–g Values within each column with different superscripts are significantly different (p < 0.05).
Foods 14 03894 g002
Foods 14 03894 g003
Figure 3. Genes regulated by the deletion of ccpA (ΔccpA compared with hsryfm 1301). (a) KEGG enrichment analysis of DEGs. Rich factor is the ratio of DEG number enriched in one pathway to the total gene number of this pathway. The size of circle dot means gene number. Pathway: 1, Phosphotransferase system (PTS); 2, Fructose and mannose metabolism; 3, Pyruvate metabolism; 4, Fatty acid biosynthesis; 5, Propanoate metabolism; 6, Inositol phosphate metabolism; 7, Galactose metabolism; 8, Starch and sucrose metabolism; 9, Pentose and glucuronate interconversions; 10, Ascorbate and aldarate metabolism; 11, Staphylococcus aureus infection; 12, Glycolysis/Gluconeogenesis; 13, Cationic antimicrobial peptide (CAMP) resistance; 14, Carbon fixation pathways in prokaryotes; 15, Citrate cycle (TCA cycle); 16, Biotin metabolism. (b) The key genes with altered expression in the Pyruvate metabolism and Glycolysis/Gluconeogenesis pathways. Red arrows: downregulation; Green arrows: upregulation; Black arrows: not significantly regulated.
Figure 3. Genes regulated by the deletion of ccpA (ΔccpA compared with hsryfm 1301). (a) KEGG enrichment analysis of DEGs. Rich factor is the ratio of DEG number enriched in one pathway to the total gene number of this pathway. The size of circle dot means gene number. Pathway: 1, Phosphotransferase system (PTS); 2, Fructose and mannose metabolism; 3, Pyruvate metabolism; 4, Fatty acid biosynthesis; 5, Propanoate metabolism; 6, Inositol phosphate metabolism; 7, Galactose metabolism; 8, Starch and sucrose metabolism; 9, Pentose and glucuronate interconversions; 10, Ascorbate and aldarate metabolism; 11, Staphylococcus aureus infection; 12, Glycolysis/Gluconeogenesis; 13, Cationic antimicrobial peptide (CAMP) resistance; 14, Carbon fixation pathways in prokaryotes; 15, Citrate cycle (TCA cycle); 16, Biotin metabolism. (b) The key genes with altered expression in the Pyruvate metabolism and Glycolysis/Gluconeogenesis pathways. Red arrows: downregulation; Green arrows: upregulation; Black arrows: not significantly regulated.
Foods 14 03894 g003
Foods 14 03894 g004
Figure 4. Heat stress tolerance of L. rhamnosus strains in MRS and NP-MRS. (a) hsryfm 1301, 55 °C, 1 h. (b) ΔccpA, 55 °C, 1 h. (c) ∆ccpA/pccpA(L.r.)+, 56 °C, 1 h. (d) ∆ccpA/pccpA(L.p.)+, 56 °C, 1 h. a,b Values within each column with different superscripts are significantly different (p < 0.05).
Figure 4. Heat stress tolerance of L. rhamnosus strains in MRS and NP-MRS. (a) hsryfm 1301, 55 °C, 1 h. (b) ΔccpA, 55 °C, 1 h. (c) ∆ccpA/pccpA(L.r.)+, 56 °C, 1 h. (d) ∆ccpA/pccpA(L.p.)+, 56 °C, 1 h. a,b Values within each column with different superscripts are significantly different (p < 0.05).
Foods 14 03894 g004
Foods 14 03894 g005
Figure 5. Oxidative stress tolerance of L. rhamnosus strains in MRS and NP-MRS. (a) hsryfm 1301, 3 mmol L−1 H2O2, 1 h. (b) ΔccpA, 4 mmol L−1 1 h. (c) ∆ccpA/pccpA(L.r.)+, 3 mmol L−1, 1 h. (d) ∆ccpA/pccpA(L.p.)+, 4 mmol L−1, 1 h. a,b Values within each column with different superscripts are significantly different (p < 0.05).
Figure 5. Oxidative stress tolerance of L. rhamnosus strains in MRS and NP-MRS. (a) hsryfm 1301, 3 mmol L−1 H2O2, 1 h. (b) ΔccpA, 4 mmol L−1 1 h. (c) ∆ccpA/pccpA(L.r.)+, 3 mmol L−1, 1 h. (d) ∆ccpA/pccpA(L.p.)+, 4 mmol L−1, 1 h. a,b Values within each column with different superscripts are significantly different (p < 0.05).
Foods 14 03894 g005
Foods 14 03894 g006
Figure 6. Transcriptional levels of key genes related to acetate production and typical stress tolerance. (a) Genes related to acetate production. (b) Typical stress tolerance genes. a–d Values within each column with different superscripts are significantly different (p < 0.05). YM, wild-type in MRS; YN, wild-type in NP-MRS; QM, ∆ccpA in MRS; QN, ∆ccpA in NP-MRS.
Figure 6. Transcriptional levels of key genes related to acetate production and typical stress tolerance. (a) Genes related to acetate production. (b) Typical stress tolerance genes. a–d Values within each column with different superscripts are significantly different (p < 0.05). YM, wild-type in MRS; YN, wild-type in NP-MRS; QM, ∆ccpA in MRS; QN, ∆ccpA in NP-MRS.
Foods 14 03894 g006
Foods 14 03894 g007
Figure 7. Transcriptional levels of key genes potentially associated with heat and oxidative stress tolerance. (a) Genes in the de novo pyrimidine synthesis operon (pyr operon). (b) Genes in the de novo purine synthesis operon (pur operon). (c) Genes in the fatty acid synthesis operon (fab operon). (d) Genes related to hexosamine pathway. a–d Values within each column with different superscripts are significantly different (p < 0.05). YM, wild-type in MRS; YN, wild-type in NP-MRS; QM, ∆ccpA in MRS. QN; ∆ccpA in NP-MRS.
Figure 7. Transcriptional levels of key genes potentially associated with heat and oxidative stress tolerance. (a) Genes in the de novo pyrimidine synthesis operon (pyr operon). (b) Genes in the de novo purine synthesis operon (pur operon). (c) Genes in the fatty acid synthesis operon (fab operon). (d) Genes related to hexosamine pathway. a–d Values within each column with different superscripts are significantly different (p < 0.05). YM, wild-type in MRS; YN, wild-type in NP-MRS; QM, ∆ccpA in MRS. QN; ∆ccpA in NP-MRS.
Foods 14 03894 g007
Foods 14 03894 g008
Figure 8. Heat and oxidative stress tolerance of L. rhamnosus hsryfm 1301 in NP-MRS supplemented with cytosine. (a) Heat stress, 54 °C, 1 h. (b) Oxidative stress, 3 mmol L−1 H2O2, 1 h. C-MRS 0.2, NP-MRS supplemented with 0.2 g L−1 cytosine; C-MRS 0.4, NP-MRS supplemented with 0.4 g L−1 cytosine; C-MRS 0.8, NP-MRS supplemented with 0.8 g L−1 cytosine; C-MRS 1.6, NP-MRS supplemented with 1.6 g L−1 cytosine. a–d Values within each column with different superscripts are significantly different (p < 0.05).
Figure 8. Heat and oxidative stress tolerance of L. rhamnosus hsryfm 1301 in NP-MRS supplemented with cytosine. (a) Heat stress, 54 °C, 1 h. (b) Oxidative stress, 3 mmol L−1 H2O2, 1 h. C-MRS 0.2, NP-MRS supplemented with 0.2 g L−1 cytosine; C-MRS 0.4, NP-MRS supplemented with 0.4 g L−1 cytosine; C-MRS 0.8, NP-MRS supplemented with 0.8 g L−1 cytosine; C-MRS 1.6, NP-MRS supplemented with 1.6 g L−1 cytosine. a–d Values within each column with different superscripts are significantly different (p < 0.05).
Foods 14 03894 g008
Table 2. Primers used in this study.
Table 2. Primers used in this study.
Primer Sequence (5′-3′)Restriction Site
Eco-ccpaupFTTTGAATTCCATATACCCATGATTGTCGGTGCEcoR I
ccpaupRTTTATTTTCTCCTTAGTCGTGAAAA 
ccpadownFTTTTCACGACTAAGGAGAAAATAAAACAGAAGTAACACGATATTCTGGC 
hind-ccpadownRAAGAAGCTTGTCATCAAGTCAAAAAGACCAAGHind III
ccpaTestFGTCCATCGCGGTTAAGTTAGCC 
ccpaTestRCAACATTCGCCAATCAAGGTG 
M13c-FCCCAGTCACGACGTTGTAAAACG 
RV-MGAGCGGATAACAATTTCACACAGG 
Eco-1301ccpAFGGAATTCGGCTACTCCTTAAAACTCGCTGEcoR I
Hind-1301ccpARATTAAGCTTCTACTTGGTTGAACCACGCTTCHind III
pMG36eFTAATTCGAGCTCGCCCGG 
pMG36eRACCGAATTCGATCGACCCATA 
36e-FGL-ccpAFTATGGGTCGATCGAATTCGGTCAATCAAGCATCGTGGTAAAATAG 
36e-FGL-ccpARCCGGGCGAGCTCGAATTATTATTTCGTTGAACCACGCTTC 
Table 3. Distribution of upregulated and downregulated genes in the four pair-wise comparisons based on KEGG pathway enrichment.
Table 3. Distribution of upregulated and downregulated genes in the four pair-wise comparisons based on KEGG pathway enrichment.
YM vs. QMYN vs. QNYM vs. YNQM vs. QN
PathwaysU *D *PathwaysU *D *PathwaysU *D *PathwaysU *D *
Phosphotransferase system (PTS) 462Phosphotransferase system (PTS) 332Purine metabolism131Fatty acid biosynthesis90
Fructose and mannose metabolism 282Fructose and mannose metabolism 202Pyrimidine metabolism29Pyrimidine metabolism39
Pyruvate metabolism 126Inositol phosphate metabolism 80beta-Lactam resistance50Purine metabolism130
Fatty acid biosynthesis 012Ascorbate and aldarate metabolism 100Alanine, aspartate and glutamate metabolism14beta-Lactam resistance51
Propanoate metabolism 64Staphylococcus aureus infection 50Tuberculosis20Quorum sensing90
Inositol phosphate metabolism 90Galactose metabolism 170RNA degradation21Alanine, aspartate and glutamate metabolism23
Galactose metabolism 220Starch and sucrose metabolism 170Quorum sensing50Biotin metabolism30
Starch and sucrose metabolism 210Cationic antimicrobial peptide (CAMP) resistance 50   ABC transporters101
Pentose and glucuronate interconversions 100Pyruvate metabolism 110   Prodigiosin biosynthesis20
Ascorbate and aldarate metabolism 100Glycolysis/Gluconeogenesis130   Propanoate metabolism30
Staphylococcus aureus infection 50Purine metabolism 013      
Glycolysis/Gluconeogenesis 151Pentose and glucuronate interconversions 70      
Cationic antimicrobial peptide (CAMP) resistance 50Citrate cycle (TCA cycle) 40      
Carbon fixation pathways in prokaryotes 34Propanoate metabolism50      
Citrate cycle (TCA cycle) 40         
Biotin metabolism04         
* U: Number of genes upregulated; D: Number of genes downregulated; YM, wild-type in MRS; YN, wild-type in NP-MRS; QM, ∆ccpA in MRS; QN, ∆ccpA in NP-MRS.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, M.; Cheng, H.; Li, Q.; Sun, Y.; Wu, Y.; Wang, H.; Wa, Y.; Chen, D.; Guan, C.; Huang, Y.; et al. The Role of ccpA in Nitrogen Source-Induced Heat and Oxidative Stress Tolerance Changes in Lacticaseibacillus rhamnosus. Foods 2025, 14, 3894. https://doi.org/10.3390/foods14223894

AMA Style

Li M, Cheng H, Li Q, Sun Y, Wu Y, Wang H, Wa Y, Chen D, Guan C, Huang Y, et al. The Role of ccpA in Nitrogen Source-Induced Heat and Oxidative Stress Tolerance Changes in Lacticaseibacillus rhamnosus. Foods. 2025; 14(22):3894. https://doi.org/10.3390/foods14223894

Chicago/Turabian Style

Li, Mengting, Haohao Cheng, Qiming Li, Yue Sun, You Wu, Haikang Wang, Yunchao Wa, Dawei Chen, Chengran Guan, Yujun Huang, and et al. 2025. "The Role of ccpA in Nitrogen Source-Induced Heat and Oxidative Stress Tolerance Changes in Lacticaseibacillus rhamnosus" Foods 14, no. 22: 3894. https://doi.org/10.3390/foods14223894

APA Style

Li, M., Cheng, H., Li, Q., Sun, Y., Wu, Y., Wang, H., Wa, Y., Chen, D., Guan, C., Huang, Y., Gu, R., & Zhang, C. (2025). The Role of ccpA in Nitrogen Source-Induced Heat and Oxidative Stress Tolerance Changes in Lacticaseibacillus rhamnosus. Foods, 14(22), 3894. https://doi.org/10.3390/foods14223894

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop