Rice Protein Reduces Triglyceride Levels through Modulating CD36, MTP, FATP, and FABP Expression in Growing and Adult Rats
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals Experiments
2.2. Measurement of Triglyceride and Free Fatty Acid Contents
2.3. Quantitative Real-Time PCR
2.4. Western Blotting Analysis
2.5. Statistical Analysis
3. Results and Discussion
3.1. The Chemical Analysis of the Extracted Rice Protein
3.2. Body Weight Gain and Food Intake
3.3. Effect of Rice Protein on Triglyceride Levels
3.4. Effect of Rice Protein on Free Fatty Acids Content
3.5. Effect of Rice Protein on CD36 Expression
3.6. Effect of Rice Protein on MTP Expression
3.7. Effect of Rice Protein on FATP Expression
3.8. Effect of Rice Protein on FABP Expression
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kadowaki, M.; Kubota, M.; Watanabe, R. Physiological multifunctions of rice proteins of endosperm and bran. J. Nutr. Sci. Vitaminol. 2019, 65, S42–S47. [Google Scholar] [CrossRef]
- Zhao, X.; Gao, R.; Cui, C.; Sun-Waterhouse, D. Structural characteristics, functional properties and in vitro digestibility of rice protein prepared from rice wine lees via an alkaline extraction process or carbohydrate-lipid removal process. J. Cereal Sci. 2024, 117, 103913. [Google Scholar] [CrossRef]
- Wang, Z.; Liang, M.; Li, H.; Cai, L.; Yang, L. Rice protein exerts anti-inflammatory effect in growing and adult rats via suppressing NF-κB pathway. Int. J. Mol. Sci. 2019, 20, 6164. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Wang, Z.; Liang, M.; Cai, L.; Yang, L. Methionine augments antioxidant activity of rice protein during gastrointestinal digestion. Int. J. Mol. Sci. 2019, 20, 868. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Chen, J.; Xu, T.; Qiu, W.; Zhang, Y.; Zhang, L.; Xu, F.; Liu, H. Rice protein extracted by different methods affects cholesterol metabolism in rats due to its lower digestibility. Int. J. Mol. Sci. 2011, 12, 7594–7608. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Kumagai, T.; Kawamura, H.; Watanabe, T.; Kubota, M.; Fujimura, S.; Watanabe, R.; Kadowaki, M. Effects of rice proteins from two cultivars, Koshihikari and Shunyo, on cholesterol and triglyceride metabolism in growing and adult rats. Biosci. Biotechnol. Biochem. 2007, 71, 694–703. [Google Scholar] [CrossRef]
- Yang, L.; Chen, J.H.; Lv, J.; Wu, Q.; Xu, T.; Zhang, H.; Liu, Q.H.; Yang, H.K. Rice protein improves adiposity, body weight and reduces lipids level in rats through modification of triglyceride metabolism. Lipids Health Dis. 2012, 11, 24. [Google Scholar] [CrossRef]
- Kubota, M.; Watanabe, R.; Yamaguchi, M.; Hosojima, M.; Saito, A.; Fujii, M.; Fujimura, S.; Kadowaki, M. Rice endosperm protein slows progression of fatty liver and diabetic nephropathy in Zucker diabetic fatty rats. Br. J. Nutr. 2016, 116, 1326–1335. [Google Scholar] [CrossRef]
- Zhang, H.; Bartley, G.E.; Mitchell, C.R.; Zhang, H.; Yokoyama, W. Lower weight gain and hepatic lipid content in hamsters fed high fat diets supplemented with white rice protein, brown rice protein, soy protein, and their hydrolysates. J. Agric. Food Chem. 2011, 59, 10927–10933. [Google Scholar] [CrossRef]
- Kohno, M. Soybean protein and peptide as complementation medical food materials for treatment of dyslipidemia and inflammatory disorders. Food Sci. Technol. Res. 2017, 23, 773–782. [Google Scholar] [CrossRef][Green Version]
- Yang, L.; Kadowaki, M. Effects of rice proteins from two cultivars, Koshihikari and Shunyo, on hepatic cholesterol secretion by isolated perfused livers of rats fed cholesterol-enriched diets. Ann. Nutr. Metab. 2009, 54, 283–290. [Google Scholar] [CrossRef]
- Pepino, M.Y.; Kuda, O.; Samovski, D.; Abumrad, N.A. Structure-function of CD36 and importance of fatty acid signal transduction in fat metabolism. Ann. Rev. Nutr. 2014, 34, 281–303. [Google Scholar] [CrossRef]
- Hussaina, M.M.; Ravaa, P.; Pana, X.; Daia, K.; Douganb, S.K.; Iqbala, J.; Lazarea, F.; Khatun, I. Microsomal triglyceride transfer protein in plasma and cellular lipid metabolism. Curr. Opin. Lipidol. 2008, 19, 277–284. [Google Scholar] [CrossRef]
- Hussain, M.M.; Bakillah, A. New approaches to target microsomal triglyceride transfer protein. Curr. Opin. Lipidol. 2008, 19, 572–578. [Google Scholar] [CrossRef]
- Dourlen, P.; Sujkowski, A.; Wessells, R.; Mollereau, B. Fatty acid transport proteins in disease: New insights from invertebrate models. Prog. Lipid Res. 2015, 60, 30–40. [Google Scholar] [CrossRef]
- Makowski, L.; Hotamisligil, G.S. The role of fatty acid binding proteins in metabolic syndrome and atherosclerosis. Curr. Opin. Lipidol. 2005, 16, 543–548. [Google Scholar] [CrossRef]
- Glatza, J.F.C.; Nabbena, M.; Luiken, J.J.F.P. CD36 (SR-B2) as master regulator of cellular fatty acid homeostasis. Curr. Opin. Lipidol. 2022, 33, 103–111. [Google Scholar] [CrossRef]
- Febbraio, M.; Hajjar, D.P.; Silverstein, R.L. CD36: A class B scavenger receptor involved in angiogenesis, atherosclerosis, inflammation, and lipid metabolism. J. Clin. Investig. 2001, 108, 785–791. [Google Scholar] [CrossRef]
- Abumrad, N.; Coburn, C.; Ibrahimi, A. Membrane proteins implicated in long-chain fatty acid uptake by mammalian cells: CD36, FATP and FABPm. Biochim. Biophys. Acta 1999, 1441, 4–13. [Google Scholar] [CrossRef]
- Chen, X.L.; Liang, P.L.; Gong, M.J.; Xu, Y.; Zhang, L.; Qiu, X.H.; Zhang, J.; Huang, Z.H.; Xu, W. Polyphenolics from Syzygium brachythyrsum inhibits oxidized low-density lipoprotein-induced macrophage-derived foam cell formation and inflammation. Foods 2022, 11, 3543. [Google Scholar] [CrossRef]
- Tietge, U.J.F.; Bakillah, A.; Maugeais, C.; Tsukamoto, K.; Hussain, M.; Rader, D.J. Hepatic overexpression of microsomal triglyceride transfer protein (MTP) results in increased in vivo secretion of VLDL triglycerides and apolipoprotein B. J. Lipid Res. 1999, 40, 2134–2139. [Google Scholar] [CrossRef] [PubMed]
- White, D.A.; Bennett, A.J.; Billett, M.A.; Salter, A.M. The assembly of triacylglycerol-rich lipoproteins: An essential role for the microsomal triacylglycerol transfer protein. Br. J. Nutr. 1998, 80, 219–229. [Google Scholar] [CrossRef]
- Kwon, H.C.; Kim, D.H.; Jeong, C.H.; Kim, Y.J.; Han, J.H.; Lim, S.J.; Shin, D.M.; Kim, D.W.; Han, S.G. Tebuconazole fungicide induces lipid accumulation and oxidative stress in HepG2 cells. Foods 2021, 10, 2242. [Google Scholar] [CrossRef] [PubMed]
- Pohl, J.; Ring, A.; Hermann, T.; Stremmel, W. Role of FATP in parenchymal cell fatty acid uptake. Biochim. Biophys. Acta 2004, 1686, 1–6. [Google Scholar] [CrossRef]
- Storch, J.; McDermott, L. Structural and functional analysis of fatty acid-binding proteins. J. Lipid Res. 2009, 50, S126–S131. [Google Scholar] [CrossRef]
- Hotamisligil, G.S.; Bernlohr, D.A. Metabolic functions of FABPs- mechanisms and therapeutic implications. Nat. Rev. Endocrinol. 2015, 11, 592–605. [Google Scholar] [CrossRef]
- Choi, Y.; Goto, S.; Ikeda, I.; Sugano, M. Interaction of dietary protein, cholesterol and age on lipid metabolism of the rat. Br. J. Nutr. 1989, 61, 531–543. [Google Scholar] [CrossRef]
- Cai, J.; Yang, L.; He, H.; Xu, T.; Liu, H.; Wu, Q.; Ma, Y.; Liu, Q.; Nie, M. Antioxidant capacity responsible for a hypocholesterolemia is independent of dietary cholesterol in adult rats fed rice protein. Gene 2014, 533, 57–66. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Chen, J.H.L.; Xu, T.L.; Zhou, A.S.L.; Yang, H.K. Rice protein improves oxidative stress by regulating glutathione metabolism and attenuating oxidative damage to lipids and proteins in rats. Life Sci. 2012, 91, 389–394. [Google Scholar] [CrossRef]
- Liang, M.; Li, H.; Wang, Z.; Cai, L.; Yang, L. Rice protein reduces DNA damage by activating the p53 pathway and stimulating endogenous antioxidant response in growing and adult rats. J. Sci. Food Agric. 2019, 99, 6097–6107. [Google Scholar] [CrossRef]
- Li, H.; He, H.; Wang, Z.; Cai, J.; Sun, B.; Wu, Q.; Zhang, Y.; Zhou, G.; Yang, L. Rice protein suppresses ROS generation and stimulates antioxidant gene expression via Nrf2 activation in adult rats. Gene 2016, 585, 256–264. [Google Scholar] [CrossRef]
- Yang, L.; Chen, J.; Zhang, H.; Qiu, W.; Liu, Q.; Peng, X.; Li, Y.; Yang, H. Alkali treatment affects in vitro digestibility and bile acid binding activity of rice protein due to varying its ratio of arginine to lysine. Food Chem. 2012, 132, 925–930. [Google Scholar] [CrossRef]
- Reeves, P.G.; Nielsen, F.H.; Fahey, G.C. AIN-93 purified diets for laboratory rodents: Final report of the American Institute of Nutrition Ad Hoc Writing Committee on the reformulation of the AIN-76A rodent diet. J. Nutr. 1993, 123, 1939–1951. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Liang, M.; Li, H.; Liu, B.; Yang, L. Rice protein suppresses 4-hydroxy-2-nonenal-induced inflammation owing to methionine availability. Appl. Physiol. Nutr. Metab. 2022, 47, 826–838. [Google Scholar] [CrossRef]
- Wang, Z.; Liang, M.; Li, H.; Liu, B.; Yang, L. L-Methionine inhibits 4-hydroxy-2-nonenal accumulation and suppresses inflammation in growing rats. Nutr. Res. Pract. 2022, 16, 729–744. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Liang, M.; Liu, B.; Yang, L. Methionine strengthens anti-inflammation of rice protein via depressing NF-κB activation and stimulating Msr expression in rats fed cholesterol-enriched diets. Food Sci. Biotechnol. 2022, 31, 745–758. [Google Scholar] [CrossRef]
- Li, H.; Yang, L.; Yang, H.; Sun, S.; Liu, H.; Wu, Q.; Chen, J.; Zhuang, T. Rice protein regulates HDL metabolism-related gene expression and enzyme activity in adult rats. Food Biosci. 2014, 8, 1–7. [Google Scholar] [CrossRef]
- Higuchi, Y.; Hosojima, M.; Kabasawa, H.; Kuwahara, S.; Goto, S.; Toba, K.; Kaseda, R.; Tanaka, T.; Kitamura, N.; Takihara, H.; et al. Rice endosperm protein administration to juvenile mice regulates gut microbiota and suppresses the development of high-fat diet-induced obesity and related disorders in adulthood. Nutrients 2019, 11, 2919. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Wang, J.; Liu, Y.; Gong, L.; Sun, B. Rice bran proteins and their hydrolysates modulate cholesterol metabolism in mice on hypercholesterolemic diets. Food Funct. 2016, 7, 2747–2753. [Google Scholar] [CrossRef]
- Li, F.; Wu, X.; Wu, W. Effects of oxidized rice bran protein induced by rancidity on the hepatic function in mice. Food Funct. 2022, 13, 6089–6102. [Google Scholar] [CrossRef]
- Kim, N.; Thomas, S.S.; Hwang, D.; Lee, J.; Kim, K.; Cha, Y. Anti-obesity effects of Morus alba L. and Aronia melanocarpa in a high-fat diet-induced obese C57BL/6J mouse model. Foods 2021, 10, 1914. [Google Scholar] [CrossRef] [PubMed]
- Glatz, J.F.C.; Luiken, J.J.F.P. Dynamic role of the transmembrane glycoprotein CD36 (SR-B2) in cellular fatty acid uptake and utilization. J. Lipid Res. 2018, 59, 1084–1093. [Google Scholar] [CrossRef] [PubMed]
- Campbell, S.E.; Tandon, N.N.; Woldegiorgis, G.; Luiken, J.J.F.P.; Glatz, J.F.C.; Bonen, A. A Novel Function for Fatty Acid Translocase (FAT)/CD36. J. Biol. Chem. 2004, 279, 36235–36241. [Google Scholar] [CrossRef]
- Febbraio, M.; Guy, E.; Coburn, C.; Knapp, F.F., Jr.; Beets, A.L.; Abumrad, N.A.; Silverstein, R.L. The impact of overexpression and deficiency of fatty acid translocase (FAT)/CD36. Mol. Cell Biochem. 2002, 239, 193–197. [Google Scholar] [CrossRef]
- Nassir, F.; Adewole, O.L.; Brunt, E.M.; Abumrad, N.A. CD36 deletion reduces VLDL secretion, modulates liver prostaglandins, and exacerbates hepatic steatosis in ob/ob mice. J. Lipid Res. 2013, 54, 2988–2997. [Google Scholar] [CrossRef]
- Hussain, M.M.; Shi, J.; Dreizen, P. Microsomal triglyceride transfer protein and its role in apoB-lipoprotein assembly. J. Lipid Res. 2003, 44, 22–32. [Google Scholar] [CrossRef] [PubMed]
- Gordon, D.A.; Jamil, H. Progress towards understanding the role of microsomal triglyceride transfer protein in apolipoprotein-B lipoprotein assembly. Biochim. Biophys. Acta 2000, 1486, 72–83. [Google Scholar] [CrossRef]
- Lemieux, C.; Gélinas, Y.; Lalonde, J.; Labrie, F.; Cianflone, K.; Deshaies, Y. Hypolipidemic action of the SERM acolbifene is associated with decreased liver MTP and increased SR-BI and LDL receptors. J. Lipid Res. 2005, 46, 1285–1294. [Google Scholar] [CrossRef]
- Pan, X.; Hussain, M.M. Diurnal Regulation of Microsomal Triglyceride Transfer Protein and Plasma Lipid Levels. J. Biol. Chem. 2007, 282, 24707–24719. [Google Scholar] [CrossRef]
- Furuhashi, M.; Hotamisligil, G.S. Fatty acid-binding proteins: Role in metabolic diseases and potential as drug targets. Nat. Rev. Drug Discov. 2008, 7, 489–503. [Google Scholar] [CrossRef]
- Martin, G.G.; Atshaves, B.P.; Mcintosh, A.L.; Mackie, J.T.; Kier, A.B.; Schroeder, F. Liver fatty-acid-binding protein (L-FABP) gene ablation alters liver bile acid metabolism in male mice. Biochem. J. 2005, 391, 549–560. [Google Scholar] [CrossRef] [PubMed]
- Sawicki, L.R.; Arias, N.M.B.; Scaglia, N.; Lockhart, L.J.F.; Franchini, G.R.; Storch, J.; Córsico, B. FABP1 knockdown in human enterocytes impairs proliferation and alters lipid metabolism. BBA-Mol. Cell Biol. Lipids 2017, 1862, 1587–1594. [Google Scholar] [CrossRef] [PubMed]










| Gene | Forward | Reverse |
|---|---|---|
| GAPDH | ACAGCAACAGGGTGGTGGAC | TTTGAGGGTGCAGCGAACTT |
| CD36 | TGCTGCACGAGGAGGAGAATGG | CACAGCCAGGACAGCACCAATAAC |
| MTP | TTCTGCCTACACTGGCTACG | TCTCCTCTCCCTCATCTGGA |
| FATP-2 | TGTGGCTCTGGCTGGGACTG | GTAGCAGAGACTTGGCACGGATG |
| FABP-1 | CCAGAAAGGGAAGGACATCAAGGG | TGGTCTCCAGTTCGCACTCCTC |
| Nutrient Composition | Content (%) |
|---|---|
| Water | 6.61 |
| Protein | 90.76 |
| Starch | 0.83 |
| Lipid | 0.43 |
| Ash | 0.89 |
| Crude Fiber | 0.48 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, B.; Wang, Z.; Liang, M.; Yang, L. Rice Protein Reduces Triglyceride Levels through Modulating CD36, MTP, FATP, and FABP Expression in Growing and Adult Rats. Foods 2024, 13, 2704. https://doi.org/10.3390/foods13172704
Liu B, Wang Z, Liang M, Yang L. Rice Protein Reduces Triglyceride Levels through Modulating CD36, MTP, FATP, and FABP Expression in Growing and Adult Rats. Foods. 2024; 13(17):2704. https://doi.org/10.3390/foods13172704
Chicago/Turabian StyleLiu, Bingxiao, Zhengxuan Wang, Mingcai Liang, and Lin Yang. 2024. "Rice Protein Reduces Triglyceride Levels through Modulating CD36, MTP, FATP, and FABP Expression in Growing and Adult Rats" Foods 13, no. 17: 2704. https://doi.org/10.3390/foods13172704
APA StyleLiu, B., Wang, Z., Liang, M., & Yang, L. (2024). Rice Protein Reduces Triglyceride Levels through Modulating CD36, MTP, FATP, and FABP Expression in Growing and Adult Rats. Foods, 13(17), 2704. https://doi.org/10.3390/foods13172704

