Next Article in Journal
Explaining Intricate Morphometric Variability with Environmental Predictors: The Case of Globularia cordifolia Species Complex
Previous Article in Journal
Why Does the Halophyte Mesembryanthemum crystallinum Better Tolerate Ni Toxicity than Brassica juncea: Implication of Antioxidant Defense Systems
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 9
Issue 3
10.3390/plants9030313
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The First Case of Glyphosate Resistance in Johnsongrass (Sorghum halepense (L.) Pers.) in Europe

by
Jose G. Vazquez-Garcia
1,
Candelario Palma-Bautista
1,
Antonia Maria Rojano-Delgado
1,
Rafael De Prado
1 and
Julio Menendez
2,*
1
Agricultural Chemistry and Soil Sciences, University of Córdoba, 14014 Cordoba, Spain
2
Departamento de Ciencias Agroforestales, Escuela Tecnica Superior de Ingenieria, Campus de La Rabida, Universidad de Huelva, Palos de la Frontera, 21819 Huelva, Spain
*
Author to whom correspondence should be addressed.
Plants 2020, 9(3), 313; https://doi.org/10.3390/plants9030313
Submission received: 29 January 2020 / Revised: 20 February 2020 / Accepted: 26 February 2020 / Published: 3 March 2020
Browse Figure
Versions Notes

Abstract

:
Six Johnsongrass populations suspected of being glyphosate resistant were collected from railways and freeways near Cordoba (SW Spain), where glyphosate is the main weed control tool. The 50% reduction in shoot fresh weight (GR50) values obtained for these six populations ranged from 550.4 to 1169 g ae ha−1, which were 4.2 to 9 times greater than the value obtained for the susceptible population. Glyphosate was equally metabolized to the same extent in both resistant and susceptible populations, with no significant differences in either 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) inhibition or basal activity. No amino acid substitutions were observed in any of the resistant populations. Slight but significant differences in glyphosate penetration were observed among some but not all of the resistant populations and for the times of incubation assayed, although these differences were not considered further. The proposed primary mechanism of resistance in these six glyphosate-resistant Johnsongrass populations is reduced herbicide translocation, because the amount of glyphosate that translocated from treated leaves to shoots and roots in the susceptible population was double that observed in the resistant populations. As glyphosate multiple resistance due to more than one mechanism is not uncommon, this is the first time that glyphosate-resistant Johnsongrass populations have been fully described for all known mechanisms.

1. Introduction

Johnsongrass is a C4 perennial and rhizomatous grass weed native to the Mediterranean region with a current range area between 55° N and 45° S, which reproduces by seeds and rhizomes [1]. The vegetative propagation, high fecundity, seed dormancy, and residual seedbank life of Johnsongrass contribute to its weediness (reviewed in [2]), and make it one of the major weeds throughout the world [1], although its preeminence has been drastically downgraded with the use of the systemic herbicide glyphosate as the main weed-control tool for glyphosate-resistant crops [3].
Glyphosate is a broad-spectrum herbicide that exclusively acts via foliar uptake. The target site in plants is the inhibition of the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) (EC 2.5.1.19), which catalyzes the conversion of shikimate-3-phosphate and phosphoenolpyruvate into 5-enolpyruvylshikimate-3-phosphate and inorganic phosphate in the shikimic acid pathway [4]. Inhibiting this enzyme prevents the biosynthesis of the aromatic amino acids phenylalanine, tyrosine, and tryptophan. Glyphosate has, for decades, been the leading and most widely used herbicide in agriculture [5]. The widespread adoption of glyphosate-resistant (GR) crop technology has been claimed to be one of the causes of its increasing use [6], although glyphosate has been extensively used in perennial crops and industrial areas as well. These industrial areas include path borders, railway lines, and recreation areas, where glyphosate has been used worldwide to control weeds [7]. Regardless of the cropping system, persistent reliance on glyphosate treatments as the exclusive weed management system has usually led to the evolution of glyphosate resistance in weeds [2], typically after 10 years of repeated applications [8]. Resistance to glyphosate has been classically ascribed to (a) reduced translocation of the herbicide, probably due to sequestration in the vacuole [9,10], (b) mutations in DNA coding sequences leading to an altered resistant form of EPSPS [11,12,13], (c) overexpression of EPSPS through gene amplification [14], and (d) metabolization of glyphosate into non-toxic compounds [15,16,17]. Other less frequent, but described, resistance factors are (a) reduced foliar retention of the herbicide [18] and (b) reduced absorption of the herbicide [19,20]. These mechanisms are present in the 317 glyphosate-resistant biotypes belonging to forty-nine weed species and subspecies already described. These species include 39 glyphosate-resistant cases in non-crop areas [21]. In addition, five Johnsongrass cases have been reported in Argentina and the USA, all of which are associated with GR crops [21]. Of those five cases, only two American cases have been partially described [20,22]. Therefore, the Argentinian biotypes showed reduced glyphosate translocation and leaf uptake, while the Arkansas biotype only showed limited translocation. However, the Arkansas plants were not EPSPS sequenced, and these two published cases were not tested for glyphosate metabolism and EPSPS overexpression. This is important since glyphosate multiple resistance due to more than one mechanism is not uncommon [15,23,24].
The goal of the present study was to fully describe the resistance to the non-selective herbicide glyphosate in several Johnsongrass weed populations currently infesting different rail and roadways in southern Spain.

2. Results and Discussion

2.1. Whole-Plant Dose-Response Assays

The herbicide rates causing both a 50% mortality (LD50) and 50% reduction in shoot fresh weight (GR50) compared to non-treated controls were calculated. Therefore, the obtained GR50 and LD50 values allow comparisons of the results to those of other resistant Johnsongrass populations, such as the Argentinian glyphosate-resistant Johnsongrass [2] and the glyphosate-resistant Johnsongrass from Arkansas [22]. While the susceptible (S) population showed similar [22] or slightly greater [2] dose-response values than those reported in previously described S populations, all the remaining six glyphosate-resistant populations (GR1 to GR6) tested were significantly resistant to glyphosate relative to the susceptible population in terms of both the effective dose growth reduction and mortality (Table 1). Both GR2 and GR5 were the most resistant populations, exhibiting resistance index (RI) values ranging from 10.96 (GR2, LD50) to 8.18 (GR5, GR50). Although they showed a lower degree of resistance than these two populations, GR1, GR3, GR4, and GR6 also displayed a significant level of resistance compared to S plants, with RI values ranging from 7.94 (GR4, LD50) to 4.23 (GR1, GR50). Under these conditions, we could split the six populations into two groups: the first one included the GR2 and GR5 populations, which were >10-fold (LD50) and >8-fold (GR50), respectively, more resistant compared to the S population. The second group included the rest of the populations, with GR50 and LD50 values lower than the thresholds set but still significantly different from the S values (Table 1).
The levels of resistance of both groups were similar to those of other Johnsongrass populations that have been described as highly resistant to glyphosate, such as the Arkansas [22] and Argentinian [2] populations. These populations are described as having an altered glyphosate translocation pattern [20,22], with this altered glyphosate translocation being responsible for the higher resistance. In addition, one of the Argentinian Johnsongrass populations showed reduced glyphosate leaf uptake [20].

2.2. EPSPS Basal Activity and Inhibition

Glyphosate target-site resistance (TSR) mechanisms have been associated with changes in EPSPS activity. These changes refer to both overexpression of the EPSPS gene associated with increased EPSPS gene amplification, EPSPS transcript levels, EPSPS protein expression, and/or genomic copy number, which increase its activity [14], or a mutation in the amino acidic sequence, which reduces its affinity for glyphosate binding [25]. In our case, there were no significant differences in terms of the EPSPS basal activity between the resistant and susceptible populations, with values ranging from 0.10 to 0.11 µmol phosphate µg total soluble protein (TSP)−1 (Figure 1). No additional data about Sorghum halepense EPSPS activity is available for comparison, but our values were similar to those observed in other glyphosate-susceptible EPSPS enzymes, such as those isolated from several Conyza species [26]. Therefore, even in a polyploidy species such as Johnsongrass, with multiple genes encoding the EPSPS protein, the overexpression of the EPSPS gene leading to multiple functional copies of the EPSPS protein does not seem to be the mechanism of resistance, as EPSPS basal activity remains the same no matter the biotype tested. In addition, there were no significant differences in the 50% inhibition of EPSPS activity (I50) values among all the populations tested, with estimated values ranging from 2.6 (GR6) to 3.4 (GR1) µM (Figure 1), which were even lower than those observed in other weed populations with glyphosate-susceptible EPSPS enzymes [26,27]. Therefore, a change of the sensitivity to glyphosate of the EPSPS enzyme is not the mechanism of resistance in the resistant populations.

2.3. EPSPS Gene Sequencing

TSR in glyphosate-resistant weed biotypes has been associated with amino acid substitutions at both the Thr102 and Pro106 positions of the EPSPS protein [28,29,30]. The partial sequence of the EPSPS2 gene revealed a similar sequence to those observed in glyphosate-resistant Argentinian populations [20], with no amino acid substitution at either the Pro106 or Thr102 positions in the glyphosate-resistant and -susceptible populations of Johnsongrass (Figure S1). These results, in conjunction with the patterns of EPSPS enzyme inhibition and basal activity, discard TSR mechanisms as the source of glyphosate resistance in resistant Johnsongrass populations.

2.4. Glyphosate Metabolism Study

The contribution of herbicide metabolism to non-target site resistance (NTSR) in glyphosate is somehow controversial. While some authors consider that this mechanism plays, at most, a minor role in glyphosate resistance [25,31], others claim this mechanism implies a decrease in the glyphosate concentration around its target site [32] or even changes in the translocation profile of glyphosate and its metabolites [16]. Glyphosate metabolism in plants is carried out by both a glyphosate oxidoreductase (GOX) putatively described as an aldo-keto reductase [17], which degrades the herbicide to glyoxylate and aminomethyl phosphonic acid (AMPA), and a carbon-phosphorus (C-P) lyase, which degrades glyphosate to sarcosine and inorganic phosphate, with formaldehyde present in that route as a reaction intermediate [31,33,34]. These two degradation pathways may be present or not in plants, although studies that include both degradation pathways are difficult and scarce [15,16]. Regardless of the metabolic pathway, glyphosate-tolerant legumes or weed species are characterized by a metabolic profile in which approximately 50% of the absorbed herbicide is degraded to other metabolites as fast as 96–144 h after treatment (HAT) [16,27] or even faster [17]. In our case, only AMPA and glyoxylate metabolites related to the GOX pathway were detected in both the resistant and susceptible Johnsongrass plants (Table 2).
This result does not mean there is a lack of C-P lyase activity, because this metabolic pathway is slower than the GOX one and sarcosine is usually detected only at very long incubation times [16,27]. In any case, the tissular glyphosate levels at 120 HAT were quite similar and high in all of the populations assayed, with the AMPA levels also not significantly different (Table 2). The fact that the glyoxylate levels in the susceptible population were lower than those observed in some of the resistant ones (GR1, GR2, GR4, and GR5) does not seem relevant, because the differences are too small compared to those observed in metabolism-based NTSR cases. Because non-metabolized glyphosate accounted for 89.6 (GR3) to 91.3% (GR5) of the total glyphosate and its metabolites, our data discard metabolism as the mechanism of resistance.

2.5. Absorption and Translocation of 14C-Glyphosate

Unlike other susceptible and resistant Johnsongrass populations studied, in which glyphosate leaf absorption becomes asymptotic at only 24 HAT [20,22], glyphosate absorption in Spanish glyphosate-resistant and -susceptible plants was slower and more gradual, with the penetration percentages ranging from approximately 20% (24 HAT) to 80% (96 HAT and following) and the radioactivity recovered accounting for more than 90% of the applied 14C-glyphosate (Table 3). In these terms, there were differences in leaf absorption between the S biotype and five of the six resistant biotypes studied, although these differences were only statistically significant 24 and 48 HAT. No differences among populations were found at both 72 and 120 HAT, while only GR5 plants absorbed more glyphosate than S ones at 96 HAT (Table 3). Therefore, when comparing the two most extreme cases, even though susceptible plants absorbed 75.1% more glyphosate than the GR5 biotype 24 HAT, these differences were downgraded to 63.6% at 48 HAT and to non-significance with 22.8% and 11.8% 72 HAT and 120 HAT, respectively. Differences in glyphosate absorption as a source of herbicide resistance have been previously described in both glyphosate-resistant grass and broadleaved weeds, including one Argentinian glyphosate-resistant Johnsongrass biotype [20]. In our case, all the resistant biotypes had lower penetration values up to 72 HAT (Table 3), so a lower glyphosate leaf penetration as the mechanism of resistance would be plausible. However, we should consider these percentages carefully because differences in herbicide penetration do not always lead to resistance. In our case, although it is true that there were significant differences between the susceptible and resistant biotypes, it was also true that these differences faded over time, with all biotypes accumulating more than 74% of the recovered glyphosate 120 HAT. Whether the greater differences observed over shorter times of incubation or the subtle but significant differences observed at longer times made any difference in terms of glyphosate resistance is unknown because more than three-quarters of the glyphosate applied was present in all plants at the end of the experiment. Therefore, although it was very likely that glyphosate penetration played a role in the NTSR observed in our populations, the extent of this effect in the resistant response was not clear.
Likewise, there were clear differences in terms of glyphosate translocation between the susceptible and six resistant populations. The percentage of glyphosate remaining in the treated leaf 120 HAT ranged from 57.4% (GR2) to 70.4% (GR5) in resistant populations and decreased to 29.9% in the susceptible population (Table 4). This loss of herbicide in the susceptible treated leaves was found in both susceptible shoots and roots, with an accumulation of glyphosate that doubled, in most cases, that observed in resistant tissues (Table 4).
Thus, reduced glyphosate translocation to non-treated shoots and roots was the primary mechanism of resistance in our six glyphosate-resistant Johnsongrass populations. Altered translocation has been described as the main source of glyphosate NTSR in many broadleaved and grass weed biotypes, including the two American glyphosate-resistant Johnsongrass cases [20,22]. This mechanism seems to be associated with the glyphosate accumulation in the vacuole that led to reduced translocation [10]. In these terms, the activation in resistant (R)plants of two genes (M10 and M11) encoding two ATP-binding cassette transporters has been described as a putative explanation for low glyphosate transport in glyphosate-NTSR Conyza Canadensis (revised in [25]). The development of similar mechanisms of glyphosate resistance in three distant Johnsongrass locations raises interesting questions. When TSR both fails to provide an adequate level of resistance and increases the fitness penalty [35,36], as in the case of glyphosate, NTSR genes tend to accumulate until the fitness penalties associated with them make individuals unviable [37]. This pattern seems to be the case for cross-pollinated grass weeds, such as rigid ryegrass (Lolium rigidum), in which more than one different mechanism of resistance has often been described [35]. However, Johnsongrass has usually been described as a rather homozygous species with a natural tendency for clonal rhizome dispersion and self-pollination [38]. Although the percentage of outcrossing in Johnsongrass is being revised [39], the high degree of asexual reproduction may imply lower levels of genetic diversity. These lower levels of diversity may explain the presence of only one NTSR mechanism in our populations, a mechanism shared by all the glyphosate-resistant Johnsongrass populations described to date. Whether Johnsongrass is a weed species prone to developing certain mechanisms of resistance over others when exposed to glyphosate-mediated selection pressure or not, is an issue that requires further investigation.

3. Materials and Methods

3.1. Plant Material

A survey was conducted during June–July of 2015 and 2016 on Andalusian railways and roads starting from Cordoba city to other locations in the same region—Cordoba-Seville, Cordoba-Malaga, and Cordoba-Jaen. Next to these railways and roads are fruit and almond orchards, olive groves, and wheat and corn crop fields. Putative resistant (R) Johnsongrass seeds were collected from six different locations (GR1 to GR6 populations) and used for the assays described below. Seeds of a susceptible (S) Johnsongrass population were collected from a channel border that had not previously received glyphosate treatments near the laboratory facilities (Table S1).
All seeds were germinated in Petri dishes with filter paper moistened with distilled water and placed in a growth chamber at 28/18 °C (day/night) under a 16-h photoperiod, 850 µmol m−2 s−1 photosynthetic photon flux, and 80% relative humidity. Seedlings of the R and S populations were transplanted into pots containing sand and peat in a 1:1 (v/v) ratio and placed in a growth chamber under the environmental conditions described above.

3.2. Whole-Plant Dose-Response Assays

Glyphosate treatments were applied at the 3–4-leaf growth stage. Herbicide was applied within a laboratory spray chamber (SBS-060 De Vries Manufacturing, Hollandale, MN, USA) equipped with 8002 flat fan nozzles delivering 200 L ha−1 at 250 KPa at a height of 50 cm. The glyphosate (Roundup Energy® SL, 450 g ae L−1, Monsanto Agricultura España, Madrid, Spain) rates ranged from 31.25 to 4000 g ae ha−1. After spraying, plants were maintained for 21 days in growth chambers under the previously described conditions. Afterward, R and S plants were cut at ground level, and growth was evaluated by plant mortality and aboveground fresh weight. The LD50 and GR50 rates were calculated for each experiment. The experiment was repeated twice and was arranged in a completely randomized design using five replicates (pots, four plants per pot) per rate.

3.3. EPSPS Inhibition and Basal Activity Study

EPSPS enzyme activity was studied according to Amaro-Blanco et al. [26]. Samples of 5 g of leaf tissue (three- to four-leaf growth stage) from each population were used for EPSPS extraction. The specific EPSPS activity in plants of each population was estimated in the presence and absence (basal activity) of glyphosate. EPSPS activity was determined using an EnzCheck Phosphate Assay Kit (Invitrogen, Carlsbad, CA, USA). The glyphosate concentrations used were 0, 0.1, 1, 10, 50, 100, 200, 500, and 1000 µM. Three replicates at each glyphosate concentration were used, and the experiment was repeated twice. The release of phosphate on the bottom level was measured over 10 min at 360 nm in a spectrophotometer (DU-640, Beckman Coulter, Inc., Fullerton, CA, USA). EPSPS enzyme activity was expressed as the percentage of enzyme activity in the presence of glyphosate with respect to the control (without glyphosate).

3.4. EPSPS Gene Sequencing

Total RNA was isolated from leaves using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. RNA was then treated with TURBO DNase (RNase-Free; Ambion, Warrington, UK) to eliminate any DNA contamination and stored at −80 °C. cDNA synthesis was carried out from 2 μg of total RNA using the Moloney Murine Leukemia Virus (M-MLV) Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA) in combination with oligo (dT)12–18 and random nonamers (Amersham Biosciences, Amersham, UK) according to the manufacturer’s instructions. To amplify the EPSPS gene, primers previously designed by Perez-Jones et al. [30] (forward: 5′ AGCTGTAGTCGTTGGCTGTG 3′; reverse: 5′ GCCAAGAAATAGCTCGCACT 3′) were used. These primers amplify a 543-bp fragment of the EPSPS gene that contains the mutation site that has been described to confer resistance to glyphosate in Lolium spp. [12,13]. Polymerase Chain Reaction (PCR) was carried out using cDNA from 50 ng of total RNA, 1.5 mM MgCl2, 0.2 mMdNTP, 0.2 μM of each primer, 1x buffer, and 0.625 units of a 100:1 enzyme mixture of non-proofreading (Thermusthermophilus) and proofreading (Pyrococcusfuriosus) polymerases (BIOTOOLS, Madrid, Spain) in a final volume of 25 µL. All PCR reactions were performed in duplicate, and the cycling conditions were 94 °C, 3 min; 35 cycles of 94 °C, 30 s; 55 °C, 30 s; and 72 °C, 1 min; and a final extension cycle of 72 °C, 10 min. An aliquot of the PCR product was loaded onto a 1% agarose gel to check for correct band amplification. The rest of the PCR products were purified using ExoSAP-IT® for PCR Product Cleanup (USB, Ohio, OH, USA) as indicated by the manufacturers. Five purified PCR products per biotype were sequenced (STAB VIDA, Caparica, Portugal). Finally, the EPSPS DNA and the predicted peptide sequences were searched in the GenBank database using basic local alignment search tool (BLAST) on the website (http://www.ncbi.nlm.nih.gov/BLAST.cgi). The EPSPS sequences used for comparison were Argentinian glyphosate-resistant (HQ436352.1) and -susceptible (HQ436354.1) Johnsongrass accessions and glyphosate-resistant Lolium rigidum (ACB05442).

3.5. Metabolism Study

Johnsongrass plants at the 3- to 4-leaf stage were treated at a glyphosate rate of 300 g ae ha−1 as described in the dose-response assays section, and other plants were kept without treatment as non-treated controls. At 120 h after treatment, following the methodology described by Rojano-Delgado et al. [40], leaf tissues were washed with distilled water, flash-frozen in liquid nitrogen, and stored at −40 °C until use. Glyphosate and its metabolites, i.e., AMPA, glyoxylate, sarcosine, and formaldehyde, were determined by reversed-polarity capillary electrophoresis using a 3D Capillary Electrophoresis Agilent G1600A instrument equipped with a diode array detector (wavelength range 190–600 nm). The aqueous background electrolyte consisted of 10 mM potassium phthalate, 0.5 mM hexadecyltrimethylammonium bromide, and 10% acetonitrile at pH 7.5. The calibration equations were established from non-treated plants and known concentrations of glyphosate and its metabolites. The experiment was performed in a completely randomized design with six repetitions per biotype.

3.6. Absorption and Translocation of 14C-Glyphosate

To obtain the wetting agents and additives needed for absorption, 14C-glyphosate (American Radiolabeled Chemicals, Inc., Saint Louis, MO, USA) was added to the commercial herbicide to prepare a solution with a specific activity of 0.834 kBq µL−1. The final glyphosate concentration corresponded to 300 g ae ha−1 applied in 200 L ha−1. One 1 µL droplet was deposited by means of a micropipette (HTL LabMate) onto the adaxial surface of the second leaf of plants at the 3-leaf stage (0.834 kBq/plant). Preliminary assays with the populations studied here revealed that glyphosate absorption levelled off at 120 h after droplet application (results not shown). Three repetitions (considering every plant as a repetition) from each population were harvested at 24, 48, 72, 96, and 120 HAT. Treated leaves from each plant were carefully washed with 3 mL of a water‒acetone (1:1 v/v) solution to remove the unabsorbed 14C-glyphosate. The rinsate was analyzed by liquid scintillation spectrometry (LSS) on a Beckman LS 6500 scintillation counter. The remainder of the plant was carefully removed from the pot, and its roots were carefully washed with distilled water. Plants for penetration studies were kept undivided, while plants for translocation studies were divided into treated leaves, remaining shoot tissue, and roots. The plant parts obtained were dried at 60 °C for 96 h and combusted in a Packard Tri Carb 307 biological sample oxidizer. Evolved 14CO2 was trapped and counted by LSS in an 18 mL mixture of Carbo-Sorb E and Permafluor E+ (1:1 v/v) (Perkin-Elmer, Packard Bioscience BV). Foliar absorption (%) was calculated as (radioactivity recovered from plant parts)/(total radioactivity recovered) × 100. Translocation (%) was calculated as (total radioactivity in treated leaf, shoot or root)/(total radioactivity in all tissues) × 100. The amount of radiolabel deposited was determined by washing a treated leaf excised immediately after deposition (three replicates). The mean (SE) radioactivity recoveries ranged from 92% (6.3) to 94% (2.7) for resistant and susceptible Johnsongrass populations, respectively.

3.7. Statistical Analysis

Dose-response and EPSPS enzyme activity data were subjected to non-linear regression analysis using a three-parameter log-logistic model (Equation (1)) to determine the glyphosate dose that resulted in a 50% reduction in growth (GR50), 50% reduction in mortality (LD50), or 50% inhibition of EPSPS activity (I50).
Y = d/[1 + (x/g)b]
where Y is the reduction of aboveground fresh weight, survival, or enzyme activity, expressed as the percentage of that of the non-treated control; d is the coefficient corresponding to the upper asymptote; b is the slope around the inflection point; g is the herbicide rate at the halfway inflection point (GR50, LD50, I50); and x (independent variable) is the herbicide rate.
Regression analysis was conducted using the statistical freeware program R 3.2.4 with the drc package [41]. Resistance indexes (RI) were calculated as R-to-S GR50, LD50, or I50, values. The values of GR, LD, and I were considered significantly different when their respective RI ratios differed from 1 at α = 0.05. Data from shikimate, basal enzyme activity, metabolism, penetration, and translocation studies were subjected to analysis of variance (ANOVA), and the Tukey honestly significant difference test was used to separate population means when needed. For cases of replicated whole experiments, ANOVA was conducted according to a generalized randomized block design, with each run of the experiment representing a block. In neither case did the interaction terms include block significance, and thus, they were not included in the final ANOVA models. Model assumptions of a normal distribution of errors and homogeneity of variance were checked by visual inspection of the residual plots. When required, data were square-root transformed. In those few cases, the non-transformed values are presented for clarity.

Supplementary Materials

The following are available online at https://www.mdpi.com/2223-7747/9/3/313/s1: Figure S1: Partial sequences in the conservative region of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) DNA isolated from both glyphosate-resistant (GR1 to GR6) and -susceptible (GRS) Johnsongrass populations; The EPSPS sequences used for comparison were glyphosate-resistant Sorghum halepense (HQ436352.1), susceptible Sorghum halepense (HQ436354.1), and glyphosate-resistant Lolium rigidum (ACB05442); Table S1: Herbicide records and locations of the different Johnsongrass populations.

Author Contributions

Conceptualization and supervision, R.D.P.; investigation (dose-response assays, shikimate tests), J.G.V.-G.; investigation (EPSPS assays and gene sequencing), C.P.-B.; investigation (metabolism studies), A.M.R.-D.; investigation (penetration/translocation studies) and writing—original draft preparation, J.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Spanish Ministry of Economy and Competitiveness (AGL2016-78944-R) and the Asociación de Agroquímicos y Medioambiente.

Acknowledgments

We are grateful to Daniel Camacho-Calero for technical assistance in the completion of this research.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Holm, L.G.; Plucknett, D.L.; Pancho, J.V.; Herberger, J.P. The World’s Worst Weeds: Distribution and Biology, 1st ed.; The University of Hawaii Press: Honolulu, HI, USA, 1977. [Google Scholar]
  2. Vila-Aiub, M.M.; Balbi, M.C.; Gundel, P.E.; Ghersa, C.M.; Powles, S.B. Evolution of glyphosate-resistant Johnsongrass (Sorghum halepense) in glyphosate-resistant soybean. Weed Sci. 2007, 55, 566–571. [Google Scholar] [CrossRef]
  3. Webster, T.M.; Nichols, R. Changes in the prevalence of weed species in the major agronomic crops of the southern United States: 1994/1995 to 2008/2009. Weed Sci. 2012, 60, 145–157. [Google Scholar] [CrossRef]
  4. Steinrücken, H.C.; Amrhein, N. The herbicide glyphosate is a potent inhibitor of 5-enolpyruvyl-shikimic acid-3-phosphate synthase. Biochem. Biophys. Res. Commun. 1980, 94, 1207–1212. [Google Scholar] [CrossRef]
  5. Duke, S.O.; Powles, S.B.; Sammons, R.D. Glyphosate-how it became a once in a hundred year herbicide and its future. OPMUB8 2018, 29, 247–251. [Google Scholar] [CrossRef]
  6. James, C. Global Status of Commercialized Biotech/GM Crops: 2010; International Service for the Acquisition of the Agri-Biotech Applications Briefs: Ithaca, NY, USA, 2010; Volume 42, pp. 1–15. [Google Scholar]
  7. Powles, S.B. Evolved glyphosate-resistant weeds around the world: Lessons to be learnt. Pest Manag. Sci. 2008, 64, 360–365. [Google Scholar] [CrossRef]
  8. Owen, M.D.K. World maize/soybean and herbicide resistance. In Herbicide Resistance and World Grains, 1st ed.; Powles, S.B., Shaner, D.L., Eds.; CRC Press: Boca Raton, FL, USA, 2001; pp. 101–163. [Google Scholar]
  9. Ge, X.; André d’Avignon, D.; Ackerman, J.J.H.; Sammons, R.D. Rapid vacuolar sequestration: The horseweed glyphosate resistance mechanism. Pest Manag. Sci. 2010, 66, 345–348. [Google Scholar] [CrossRef] [Green Version]
  10. Ge, X.; André d’Avignon, D.; Ackerman, J.J.H.; Sammons, R.D. In Vivo 31P-Nuclear Magnetic Resonance Studies of Glyphosate Uptake, Vacuolar Sequestration, and Tonoplast Pump Activity in Glyphosate-Resistant Horseweed. Plant Physiol. 2014, 166, 1255–1268. [Google Scholar] [CrossRef] [Green Version]
  11. Powles, S.B.; Yu, Q. Evolution in action: Plants resistant to herbicides. Annu. Rev. Plant Biol. 2010, 61, 317–347. [Google Scholar] [CrossRef] [Green Version]
  12. Fernández-Moreno, P.T.; Alcantara-de la Cruz, R.; Smeda, R.J.; De Prado, R. Differential Resistance Mechanisms to Glyphosate Result in Fitness Cost for Lolium perenne and L. multiflorum. Front. Plant Sci. 2017, 8, 1796. [Google Scholar] [CrossRef] [Green Version]
  13. Fernández-Moreno, P.T.; Bastida, F.; De Prado, R. Evidence, mechanism and alternative chemical seedbank-level control of glyphosate resistance of a rigid ryegrass (Lolium rigidum) biotype from southern Spain. Front. Plant Sci. 2017, 8, 450. [Google Scholar] [CrossRef] [Green Version]
  14. Gaines, T.A.; Zhang, W.; Wang, D.; Bukun, B.; Chisholm, S.T. Gene amplification confers glyphosate resistance in Amaranthus palmeri. Proc. Natl. Acad. Sci. USA 2010, 107, 1029–1034. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. De Carvalho, L.B.; Alves, P.L.D.C.A.; González-Torralva, F.; Cruz-Hipolito, H.E.; Rojano-Delgado, A.M. Pool of resistance mechanisms to glyphosate in Digitaria insularis. J. Agric. Food Chem. 2012, 60, 615–622. [Google Scholar] [CrossRef] [PubMed]
  16. Rojano-Delgado, A.M.; Cruz-Hipolito, H.; De Prado, R.; Luque-de Castro, M.D.; Rodriguez-Franco, A. Limited uptake, translocation and enhanced metabolic degradation contribute to glyphosate tolerance in Mucuna pruriens var. utilis plants. Phytochemistry 2012, 73, 34–41. [Google Scholar] [CrossRef] [PubMed]
  17. Pan, L.; Yu, Q.; Han, H.; Mao, L.; Nyporko, A.; Fan, L.; Bai, L.; Powles, S.B. Aldo-keto reductase metabolizes glyphosate and confers glyphosate resistance in Echinochloa colona. Plant Physiol. Preview 2019. [Google Scholar] [CrossRef] [PubMed]
  18. González-Torralva, F.; Cruz-Hipolito, H.; Bastida, F.; Mülleder, N.; Smeda, R.J. Differential susceptibility to glyphosate among the Conyza weed species in Spain. J. Agric. Food Chem. 2010, 58, 4361–4366. [Google Scholar] [CrossRef]
  19. Michitte, P.; De Prado, R.; Espinoza, N.; Ruiz-Santaella, J.P.; Gauvrit, C. Mechanisms of resistance to glyphosate in a ryegrass (Lolium multiflorum) biotype from Chile. Weed Sci. 2007, 55, 435–440. [Google Scholar] [CrossRef]
  20. Vila-Aiub, M.M.; Balbi, M.C.; Distefano, A.J.; Fernandez, L.; Hopp, E.; Yu, Q.; Powles, S.B. Glyphosate resistance in perennial Sorghum halepense (Johnsongrass), endowed by reduced glyphosate translocation and leaf uptake. Pest Manag. Sci. 2011, 68, 430–436. [Google Scholar] [CrossRef]
  21. Heap, I. The International Survey of Herbicide Resistant Weeds. Available online: http://www.weedscience.com (accessed on 29 January 2020).
  22. Riar, D.S.; Norsworthy, J.K.; Johnson, D.B.; Scott, R.C.; Bagavathiannan, M. Glyphosate resistance in Johnsongrass (Sorghum halepense) biotype from Arkansas. Weed Sci. 2011, 59, 299–304. [Google Scholar] [CrossRef] [Green Version]
  23. Bostamam, Y.; Malone, J.M.; Dolman, F.C.; Boutsalis, P.; Preston, C. Rigid ryegrass (Lolium rigidum) populations containing a target site mutation in EPSPS and reduced glyphosate translocation are more resistant to glyphosate. Weed Sci. 2012, 60, 474–479. [Google Scholar] [CrossRef]
  24. Nandula, V.K.; Ray, J.D.; Ribeiro, D.N.; Pan, Z.; Reddy, K.N. Glyphosate resistance in tall waterhemp (Amaranthus tuberculatus) from Mississippi is due to both altered target-site and nontarget-site mechanisms. Weed Sci. 2013, 61, 374–383. [Google Scholar] [CrossRef]
  25. Sammons, R.D.; Gaines, T.A. Glyphosate resistance: State of knowledge. Pest Manag. Sci. 2014, 70, 1367–1377. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Amaro-Blanco, I.; Fernandez-Moreno, P.T.; Osuna-Ruiz, M.D.; Bastida, F.; De Prado, R. Mechanisms of glyphosate resistance and response to alternative herbicide-based management in populations of the three Conyza species introduced in southern Spain. Pest Manag. Sci. 2018, 74, 1925–1937. [Google Scholar] [CrossRef] [PubMed]
  27. Fernandez-Moreno, P.T.; Alcantara-de la Cruz, R.; Cruz-Hipolito, H.E.; Rojano-Delgado, A.M.; Travlos, I.; De Prado, R. Non-target site tolerance mechanisms describe tolerance to glyphosate in Avena sterilis. Front. Plant Sci. 2016, 7, 1220. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Baerson, S.R.; Rodriguez, D.J.; Tran, M.; Feng, Y.; Biest, N.A.; Dill, G.M. Glyphosate-resistant goosegrass. Identification of a mutation in the target enzyme 5-enolpyruvylshikimate-3-phosphate synthase. Plant Physiol. 2002, 129, 1265–1275. [Google Scholar] [CrossRef] [Green Version]
  29. Wakelin, A.M.; Preston, C. A target-site mutation is present in a glyphosate-resistant Lolium rigidum population. Weed Res. 2006, 46, 432–440. [Google Scholar] [CrossRef]
  30. Perez-Jones, A.; Park, K.W.; Polge, N.; Colquhoun, J.; Mallory-Smith, C.A. Investigating the mechanisms of glyphosate resistance in Lolium multiflorum. Planta 2007, 226, 395–404. [Google Scholar] [CrossRef]
  31. Duke, S.O. Glyphosate metabolism in plants. In Glyphosate Uso Sustentável, 1st ed.; Velini, E., Carbonari, C.A., Meschede, D.K., Bueno-Trindade, M.L., Eds.; PEPAF: Botucatu, Brazil, 2012; pp. 17–38. [Google Scholar]
  32. Alcantara-de la Cruz, R.; Fernandez-Moreno, P.T.; Ozuna, C.V.; Rojano-Delgado, A.M.; Cruz-Hipolito, H.E.; Dominguez-Valenzuela, J.A.; Barro, F.; De Prado, R. Target and non-target site mechanisms developed by glyphosate-resistant hairy beggarticks (Bidens pilosa L.) populations from Mexico. Front. Plant. Sci. 2016, 7, 1492. [Google Scholar] [CrossRef] [Green Version]
  33. Komoba, D.; Gennity, I.; Sanderman, H. Plant metabolism of herbicides with C-P bonds: Glyphosate. Pestic. Biochem. Physiol. 1992, 43, 85–94. [Google Scholar] [CrossRef]
  34. Saroha, M.K.; Sridhar, P.; Malik, V. Glyphosate-tolerant crops: Genes and enzymes. J. Plant Biochem. Biotechnol. 1998, 7, 65–72. [Google Scholar] [CrossRef]
  35. Preston, C.; Wakelin, A.M.; Dolman, F.C.; Bostaman, Y.; Boutsalis, P. A Decade of Glyphosate-Resistant Lolium around the World: Mechanisms, Genes, Fitness, and Agronomic Management. Weed Sci. 2009, 57, 435–441. [Google Scholar] [CrossRef]
  36. Shaner, D.L.; Lindenmeyer, R.B.; Ostlie, M.H. What have the mechanisms of resistance to glyphosate taught us? Pest Manag. Sci. 2011, 68, 3–9. [Google Scholar] [CrossRef] [PubMed]
  37. Menendez, J.; Rojano, M.A.; De Prado, R. Differences in Herbicide Uptake, Translocation, and Distribution as Sources of Herbicide Resistance in Weeds. In Retention, Uptake and Translocation of Agrochemical in Plants, 1st ed.; Myung, K., Satchivi, N.M., Kingston, C.K., Eds.; American Chemical Society: Washington, DC, USA, 2014; pp. 141–158. [Google Scholar]
  38. Ohadi, S.; Hodnett, G.; Rooney, W.; Bagavathiannan, M. Gene flow and its consequences in Sorghum spp. CRC Crit. Rev. Plant Sci. 2017, 36, 367–385. [Google Scholar] [CrossRef] [Green Version]
  39. Fernandez, L.; De Haro, L.A.; Distefano, A.J.; Martinez, M.C.; Lia, V.; Papa, J.C.; Olea, I.; Tosto, D.; Hopp, H.E. Population genetics structure of glyphosate-resistant Johnsongrass (Sorghum halepense L. Pers) does not support a single origin of the resistance. Ecol. Evol. 2013, 3, 3388–3400. [Google Scholar] [CrossRef] [PubMed]
  40. Rojano-Delgado, A.M.; Ruiz-Jiménez, J.; De Castro, M.D.L.; De Prado, R. Determination of glyphosate and its metabolites in plant material by reversed-polarity CE with indirect absorptiometric detection. Electrophoresis 2010, 31, 1423–1430. [Google Scholar] [CrossRef]
  41. Ritz, C.; Baty, F.; Streibig, J.C.; Gerhard, D. Dose-response analysis using R. PLoS ONE 2015, 10, e0146021. [Google Scholar] [CrossRef] [Green Version]
Plants 09 00313 g001 550
Figure 1. (a) 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) enzyme activity expressed as a percentage of the untreated control in leaf extracts of plants from resistant (GR) and susceptible (GS) populations of Johnsongrass. (b) Basal EPSPS activity, where histograms represent the treatment means (estimated in the absence of glyphosate) as vertical bars ± standard error (n = 6). No significant differences between resistant (R) and susceptible (S) populations were observed in both sets of data at α = 0.05.
Figure 1. (a) 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) enzyme activity expressed as a percentage of the untreated control in leaf extracts of plants from resistant (GR) and susceptible (GS) populations of Johnsongrass. (b) Basal EPSPS activity, where histograms represent the treatment means (estimated in the absence of glyphosate) as vertical bars ± standard error (n = 6). No significant differences between resistant (R) and susceptible (S) populations were observed in both sets of data at α = 0.05.
Plants 09 00313 g001
Table
Table 1. Parameters of the log-logistic equations used to calculate the glyphosate rates required for 50% reductions in fresh weight (GR50) and percent survival (LD50) expressed as the percentage of the mean untreated control of the Johnsongrass populations.
Table 1. Parameters of the log-logistic equations used to calculate the glyphosate rates required for 50% reductions in fresh weight (GR50) and percent survival (LD50) expressed as the percentage of the mean untreated control of the Johnsongrass populations.
Survival (%)Fresh Weight Reduction (%)
PopulationdbLD50 (g ae ha−1) aRI bpdbGR50 (g ae ha−1) aRI bp
GR197.313.181588.95 ± 101.127.69<0.0001102.091.12550.36 ± 43.854.23<0.0001
GR299.833.192265.54 ± 56.6310.96<0.0001102.531.531169.25 ± 57.498.99<0.0001
GR3100.912.641410.91 ± 68.256.83<0.0001101.151.48959.02 ± 60.357.37<0.0001
GR4100.102.091640.36 ± 40.137.94<0.0001100.881.33933.46 ± 24.177.17<0.0001
GR5100.732.492121.83 ± 120.0610.27<0.0001101.811.591064.00 ± 113.538.18<0.0001
GR699.972.411448.68 ± 62.047.01<0.0001100.071.11751.30 ± 59.755.77<0.0001
GS100.074.45206.55 ± 2.85- 102.731.53130.02 ± 13.59-
a Mean values (n = 10) ± S.E. LD50: glyphosate rate needed to increase mortality by 50%, GR50: glyphosate rate needed to reduce fresh weight by 50%, b RI (Resistance Index): GR50 or LD50 (R)/GR50 or LD50 (S).
Table
Table 2. Metabolism of glyphosate at 120 h after treatment in glyphosate-resistant (GR1 to GR6) and -susceptible (GS) Johnsongrass populations. Plants were treated with 300 g ae ha−1 glyphosate at the 3–4 leaf stage.
Table 2. Metabolism of glyphosate at 120 h after treatment in glyphosate-resistant (GR1 to GR6) and -susceptible (GS) Johnsongrass populations. Plants were treated with 300 g ae ha−1 glyphosate at the 3–4 leaf stage.
% Recovered Metabolites a
PopulationGlyphosateAMPAGlyoxylate
GR189.7 ± 3.98.2 ± 1.3ab2.1 ± 0.8a
GR290.5 ± 2.37.5 ± 2.6ab2.0 ± 0.4a
GR389.6 ± 4.29.1 ± 2.2a1.3 ± 0.7bc
GR490.2 ± 2.48.0 ± 0.9ab1.8 ± 0.3ab
GR591.3 ± 3.26.4 ± 2.1b2.3 ± 0.4a
GR690.0 ± 3.98.6 ± 1.8a1.4 ± 0.3bc
GS91.1 ± 2.77.9 ± 0.9ab1.0 ± 0.3c
p-value0.12390.00890.0001
a Data are the means of six repetitions ± S.E. Means with the same letters within a column are not significantly different at α = 0.05 based on Duncan’s post hoc test. AMPA: aminomethyl phosphonic acid.
Table
Table 3. 14C glyphosate uptake in resistant (GR1 to GR6) and susceptible (GS) Johnsongrass populations at different hours after treatment (HAT).
Table 3. 14C glyphosate uptake in resistant (GR1 to GR6) and susceptible (GS) Johnsongrass populations at different hours after treatment (HAT).
% of Applied Label a
Population24 HAT48 HAT72 HAT96 HAT120 HAT
GR118.3 ± 1.5a39.8 ± 3.0a72.4 ± 4.5a80.1 ± 6.9ab84.2 ± 5.0a
GR220.8 ± 4.0a40.3 ± 3.2a70.3 ± 6.1a80.4 ± 4.1ab78.9 ± 1.7a
GR317.4 ± 2.8a42.6 ± 4.9a71.8 ± 5.5a78.9 ± 5.9ab85.3 ± 3.8a
GR422.7 ± 2.5ab50.1 ± 5.4ab70.3 ± 4.2a81.6 ± 4.1ab82.4 ± 3.0a
GR517.3 ± 1.7a36.8 ± 3.8a62.6 ± 3.1a70.3 ± 3.1a74.8 ± 4.1a
GR621.2 ± 2.7a40.4 ± 5.1a68.4 ± 3.9a78.7 ± 2.9ab82.6 ± 4.8a
GS30.3 ± 2.5b60.2 ± 6.7b76.9 ± 3.9a86.4 ± 4.8b83.6 ± 5.3a
a Data are the means of six repetitions ± S.E. Means with the same letters within a column are not significantly different at α = 0.05 based on Duncan’s post hoc test.
Table
Table 4. 14C glyphosate translocation in the resistant (GR1 to GR6) and susceptible (GS) Johnsongrass populations at 120 h after treatment.
Table 4. 14C glyphosate translocation in the resistant (GR1 to GR6) and susceptible (GS) Johnsongrass populations at 120 h after treatment.
% of Absorbed Label a
PopulationTreated LeafShootRoot
GR160.8 ± 4.2c24.6 ± 4.1b14.6 ± 2.9d
GR257.4 ± 8.2c23.1 ± 2.9b19.5 ± 4.1b
GR362.8 ± 6.3bc20.8 ± 3.2c16.4 ± 1.8cd
GR470.1 ± 2.9a15.8 ± 3.2d14.1 ± 2.4d
GR570.4 ± 6.9a15.8 ± 2.7d13.8 ± 4.5d
GR667.9 ± 4.7ab13.4 ± 2.2e18.7 ± 3.6bc
GS29.9 ± 2.8d34.1 ± 2.1a36.0 ± 3.9a
a Data are the means of six repetitions ± S.E. Means with the same letters within a column are not significantly different at α = 0.05 based on Duncan’s post hoc test.

Share and Cite

MDPI and ACS Style

Vazquez-Garcia, J.G.; Palma-Bautista, C.; Rojano-Delgado, A.M.; De Prado, R.; Menendez, J. The First Case of Glyphosate Resistance in Johnsongrass (Sorghum halepense (L.) Pers.) in Europe. Plants 2020, 9, 313. https://doi.org/10.3390/plants9030313

AMA Style

Vazquez-Garcia JG, Palma-Bautista C, Rojano-Delgado AM, De Prado R, Menendez J. The First Case of Glyphosate Resistance in Johnsongrass (Sorghum halepense (L.) Pers.) in Europe. Plants. 2020; 9(3):313. https://doi.org/10.3390/plants9030313

Chicago/Turabian Style

Vazquez-Garcia, Jose G., Candelario Palma-Bautista, Antonia Maria Rojano-Delgado, Rafael De Prado, and Julio Menendez. 2020. "The First Case of Glyphosate Resistance in Johnsongrass (Sorghum halepense (L.) Pers.) in Europe" Plants 9, no. 3: 313. https://doi.org/10.3390/plants9030313

APA Style

Vazquez-Garcia, J. G., Palma-Bautista, C., Rojano-Delgado, A. M., De Prado, R., & Menendez, J. (2020). The First Case of Glyphosate Resistance in Johnsongrass (Sorghum halepense (L.) Pers.) in Europe. Plants, 9(3), 313. https://doi.org/10.3390/plants9030313

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop