Melatonin Application Improves Salt Tolerance of Alfalfa (Medicago sativa L.) by Enhancing Antioxidant Capacity
Abstract
1. Introduction
2. Results
2.1. Melatonin Promotes Seed Germination and Seedling Growth under Salt Stress
2.2. Melatonin Reduces Salt Injury of Alfalfa Seedlings under Salt Stress
2.3. Melatonin Application Improves Salt Tolerance of Alfalfa Plants
2.4. Melatonin Application Induces the Expression of Genes Related to Melatonin and Antioxidants Biosynthesis
3. Discussion
4. Materials and Methods
4.1. Plant Materials and Regents
4.2. Germination Tests
4.3. Melatonin Application and Salinity Treatment of Alfalfa Plants
4.4. Measurement of Electrolyte Leakage and Malondialdehyde (MDA) Content
4.5. Measurement of Activities of Antioxidant Enzymes
4.6. Measurement of Na+ and K+ Content
4.7. Extraction of Total RNA and Quantitative Real-Time PCR Analyses
4.8. Statistical Analysis
Author Contributions
Funding
Conflicts of Interest
References
- Shi, S.; Nan, L.; Smith, K. The current status, problems, and prospects of alfalfa (Medicago sativa L.) breeding in China. Agronomy 2017, 7, 1. [Google Scholar] [CrossRef]
- Yang, Q.C.; Kang, J.M.; Zhang, T.J.; Liu, F.Q.; Long, R.C.; Sun, Y. Distribution, breeding and utilization of alfalfa germplasm resources. Chin. Sci. Bull. 2016, 61, 261–270. (In Chinese) [Google Scholar]
- Li, X.; Wei, Y.; Moore, K.J. Association mapping of biomass yield and stem composition in a tetraploid alfalfa breeding population. Plant Genome 2011, 4, 24–35. [Google Scholar] [CrossRef]
- Zhu, J.K. Salt and drought stress signal transduction in plants. Annu. Rev. Plant Biol. 2002, 53, 247–273. [Google Scholar] [CrossRef]
- Litalien, A.; Zeeb, B. Curing the earth: A review of anthropogenic soil salinization and plant-based strategies for sustainable mitigation. Sci. Total Environ. 2020, 698, 134235. [Google Scholar] [CrossRef]
- Foyer, C.H.; Noctor, G. Oxidant and antioxidant signaling in plants: A re-evaluation of the concept of oxidative stress in a physiological context. Plant Cell Environ. 2005, 28, 1056–1071. [Google Scholar] [CrossRef]
- Roy, S.J.; Negrao, S.; Tester, M. Salt resistant crop plants. Curr. Opin. Biotechnol. 2014, 26, 115–124. [Google Scholar] [CrossRef]
- FAO. Saline Soils and Their Management. Food and Agricultural Organization of the United Nations. Available online: http://www.fao.org/3/x5871e/x5871e04.htm (accessed on 1 December 2019).
- Munns, R.; Tester, M. Mechanisms of salinity tolerance. Annu. Rev. Plant Biol. 2008, 59, 651–681. [Google Scholar] [CrossRef]
- Zhang, W.J.; Wang, T. Enhanced salt tolerance of alfalfa (Medicago sativa) by rstB gene transformation. Plant Sci. 2015, 234, 110–118. [Google Scholar] [CrossRef]
- Wang, Y.; Jiang, L.; Chen, J.; Tao, L.; An, Y.; Cai, H.; Guo, C. Overexpression of the alfalfa WRKY11 gene enhances salt tolerance in soybean. PLoS ONE 2018, 13, e0192382. [Google Scholar] [CrossRef]
- Gou, J.; Debnath, S.; Sun, L.; Flanagan, A.; Tang, Y.; Jiang, Q.; Wen, J.; Wang, Z. From model to crop: Functional characterization of SPL8 in M. truncatula led to genetic improvement of biomass yield and abiotic stress tolerance in alfalfa. Plant Biotechnol. J. 2018, 16, 951–962. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.P.; Hawkins, C.; Peel, M.D.; Yu, L.X. Genetic loci associated with salt tolerance in advanced breeding populations of tetraploid alfalfa using genome-wide association studies. Plant Genome 2019, 12, 180026. [Google Scholar] [CrossRef] [PubMed]
- Sarwar, M.; Saleem, M.F.; Ullah, N.; Rizwan, M.; Ali, S.; Shahid, M.R.; Alamri, S.A.; Alyemeni, M.N.; Ahmad, P. Exogenously applied growth regulators protect the cotton crop from heat-induced injury by modulating plant defense mechanism. Sci. Rep. 2018, 8, 17086. [Google Scholar] [CrossRef] [PubMed]
- Verma, V.; Ravindran, P.; Kumar, P.P. Plant hormone-mediated regulation of stress responses. BMC Plant Biol. 2016, 16, 86. [Google Scholar] [CrossRef]
- Bielach, A.; Hrtyan, M.; Tognetti, V.B. Plants under stress: Involvement of auxin and cytokinin. Int. J. Mol. Sci. 2017, 18, 1427. [Google Scholar] [CrossRef]
- Arora, D.; Jain, P.; Singh, N.; Kaur, H.; Bhatla, S.C. Mechanisms of nitric oxide crosstalk with reactive oxygen species scavenging enzymes during abiotic stress tolerance in plants. Free Radic. Res. 2016, 50, 291–303. [Google Scholar] [CrossRef]
- Samea-Andabjadid, S.; Ghassemi-Golezani, K.; Nasrollahzadeh, S.; Najafi, N. Exogenous salicylic acid and cytokinin alter sugar accumulation, antioxidants and membrane stability of faba bean. Acta Biol. Hung. 2018, 69, 86–96. [Google Scholar] [CrossRef]
- Guo, Z.; Yang, N.; Zhu, C.; Gan, L. Exogenously applied poly-γ-glutamic acid alleviates salt stress in wheat seedlings by modulating ion balance and the antioxidant system. Environ. Sci. Pollut. Res. Int. 2017, 24, 6592–6598. [Google Scholar] [CrossRef]
- Shu, S.; Chen, L.; Lu, W.; Sun, J.; Guo, S.; Yuan, Y.; Li, J. Effects of exogenous spermidine on photosynthetic capacity and expression of Calvin cycle genes in salt-stressed cucumber seedlings. J. Plant Res. 2014, 127, 763–773. [Google Scholar] [CrossRef]
- Galano, A.; Tan, D.X.; Reiter, R.J. Melatonin as a natural ally against oxidative stress: A physicochemical examination. J. Pineal Res. 2011, 51, 1–16. [Google Scholar] [CrossRef]
- Calvo, J.R.; Gonzalez-Yanes, C.; Maldonado, M.D. The role of melatnonin in the cells of the innate immunity: A review. J. Pineal Res. 2013, 55, 103–120. [Google Scholar] [CrossRef] [PubMed]
- Hattori, A.; Migitaka, H.; Iigo, M.; Itoh, M.; Yamamoto, K.; Ohtani-Kaneko, R.; Hara, M.; Suzuki, T.; Reiter, R.J. Identification of melatonin in plants and its effects on plasma melatonin levels and binding to melatonin receptors in vertebrates. Biochem. Mol. Biol. Int. 1995, 35, 627–634. [Google Scholar] [PubMed]
- Reiter, R.J.; Tan, D.X.; Manchester, L.C.; Simopoulos, A.P.; Maldonado, M.D.; Flores, L.J.; Terron, M.P. Melatonin in edible plants (phytomelatonin): Identification, concentrations, bioavailability and proposed functions. World Rev. Nutr. Diet. 2007, 97, 211–230. [Google Scholar] [PubMed]
- Chen, G.; Huo, Y.; Tan, D.X.; Liang, Z.; Zhang, W.; Zhang, Y. Melatonin in Chinese medicinal herbs. Life Sci. 2003, 73, 19–26. [Google Scholar] [CrossRef]
- Arnao, M.B.; Hernández-Ruiz, J. Functions of melatonin in plants: A review. J. Pineal Res. 2015, 59, 133–150. [Google Scholar] [CrossRef]
- Cao, Q.; Li, G.; Cui, Z.; Yang, F.; Jiang, X.; Diallo, L.; Kong, F. Seed priming with melatonin improves the seed germination of waxy maize under chilling stress via promoting the antioxidant system and starch metabolism. Sci. Rep. 2019, 9, 15044. [Google Scholar] [CrossRef]
- Zhang, Z.; Hu, Q.; Liu, Y.; Cheng, P.; Cheng, H.; Liu, W.; Xing, X.; Guan, Z.; Fang, W.; Chen, S.; et al. Strigolactone represses the synthesis of melatonin, thereby inducing floral transition in Arabidopsis thaliana in an FLC-dependent manner. J. Pineal Res. 2019, 67, e12582. [Google Scholar] [CrossRef]
- Tan, X.L.; Fan, Z.Q.; Kuang, J.F.; Lu, W.J.; Reiter, R.J.; Lakshmanan, P.; Su, X.G.; Zhou, J.; Chen, J.Y.; Shan, W. Melatonin delays leaf senescence of Chinese flowering cabbage by suppressing ABFs-mediated abscisic acid biosynthesis and chlorophyll degradation. J. Pineal Res. 2019, 67, e12570. [Google Scholar] [CrossRef]
- Huang, Y.H.; Liu, S.J.; Yuan, S.; Guan, C.; Tian, D.Y.; Cui, X.; Zhang, Y.W.; Yang, F.Y. Overexpression of ovine AANAT and HIOMT genes in switchgrass leads to improved growth performance and salt-tolerance. Sci. Rep. 2017, 7, 12212. [Google Scholar] [CrossRef]
- Tan, D.X.; Hardeland, R.; Back, K.; Manchester, L.C.; Alatorre-Jimenez, M.A.; Reiter, R.J. On the significance of an alternate pathway of melatonin synthesis via 5-methoxyltryptamine: Comparisons across species. J. Pineal Res. 2016, 61, 426–437. [Google Scholar] [CrossRef]
- Reiter, R.J.; Tan, D.X. Melatonin: An antioxidant in edible plants. Ann. N. Y. Acad. Sci. 2002, 957, 341–344. [Google Scholar] [CrossRef] [PubMed]
- Arnao, M.B.; Hernández-Ruiz, J. Melatonin: A new plant hormone and/or a plant master regulator? Trends Plant Sci. 2019, 24, 38–48. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Liu, J.; Zhu, T.; Zhao, C.; Li, L.; Chen, M. The role of melatonin in salt stress responses. Int. J. Mol. Sci. 2019, 20, 1735. [Google Scholar] [CrossRef] [PubMed]
- Tan, D.X.; Manchester, L.C.; Esteban-Zubero, E.; Zhou, Z.; Reiter, R.J. Melatonin as a potent and inducible endogenous antioxidant: Synthesis and metabolism. Molecules 2015, 20, 18886–18906. [Google Scholar] [CrossRef]
- Wang, Y.; Reiter, R.J.; Chan, Z. Phytomelatonin: A universal abiotic stress regulator. J. Exp. Bot. 2018, 69, 963–974. [Google Scholar] [CrossRef]
- Han, Q.H.; Huang, B.; Ding, C.B.; Zhang, Z.W.; Chen, Y.E.; Hu, C.; Zhou, L.J.; Huang, Y.; Liao, J.Q.; Yuan, S.; et al. Effects of melatonin on anti-oxidative systems and photosystem II in cold-stressed rice seedlings. Front. Plant Sci. 2017, 8, 785. [Google Scholar] [CrossRef]
- Ke, Q.; Ye, J.; Wang, B.; Ren, J.; Yin, L.; Deng, X.; Wang, S. Melatonin mitigates salt stress in wheat seedlings by modulating polyamine metabolism. Front. Plant Sci. 2018, 9, 914. [Google Scholar] [CrossRef]
- Li, X.; Tan, D.X.; Jiang, D.; Liu, F. Melatonin enhances cold tolerance in drought-primed wild-type and abscisic acid-deficient mutant barley. J. Pineal Res. 2016, 61, 328–339. [Google Scholar] [CrossRef]
- Zhang, R.; Sun, Y.; Liu, Z.; Jin, W.; Sun, Y. Effects of melatonin on seedling growth, mineral nutrition, and nitrogen metabolism in cucumber under nitrate stress. J. Pineal Res. 2017, 62, e12403. [Google Scholar] [CrossRef]
- Wei, W.; Li, Q.T.; Chu, Y.N.; Reiter, R.J.; Yu, X.M.; Zhu, D.H.; Zhang, W.K.; Ma, B.; Lin, Q.; Zhang, J.S.; et al. Melatonin enhances plant growth and abiotic stress tolerance in soybean plants. J. Exp. Bot. 2015, 66, 695–707. [Google Scholar] [CrossRef]
- Zhang, J.; Li, H.; Xu, B.; Li, J.; Huang, B. Exogenous melatonin suppresses dark-induced leaf senescence by activating the superoxide dismutase-catalase antioxidant pathway and down-regulating chlorophyll degradation in excised leaves of perennial ryegrass (L.). Front. Plant Sci. 2016, 7, 1500. [Google Scholar] [CrossRef] [PubMed]
- Antoniou, C.; Chatzimichail, G.; Xenofontos, R.; Pavlou, J.J.; Panagiotou, E.; Christou, A.; Fotopoulos, V. Melatonin systemically ameliorates drought stress-induced damage in Medicago sativa plants by modulating nitro-oxidative homeostasis and proline metabolism. J. Pineal Res. 2017, 62, e12401. [Google Scholar] [CrossRef] [PubMed]
- Xu, L.; Xiang, G.; Sun, Q.; Ni, Y.; Jin, Z.; Gao, S.; Yao, Y. Melatonin enhances salt tolerance by promoting MYB108A-mediated ethylene biosynthesis in grapevines. Hortic. Res. 2019, 6, 114. [Google Scholar] [CrossRef] [PubMed]
- Arora, D.; Bhatla, S.C. Melatonin and nitric oxide regulate sunflower seedling growth under salt stress accompanying differential expression of Cu/Zn SOD and Mn SOD. Free Radic. Biol. Med. 2017, 106, 315–328. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.J.; Zhang, N.; Yang, R.C.; Wang, L.; Sun, Q.Q.; Li, D.B.; Cao, Y.Y.; Weeda, S.; Zhao, B.; Ren, S.; et al. Melatonin promotes seed germination under high salinity by regulating antioxidant systems, ABA and GA4 interaction in cucumber (Cucumis sativus L.). J. Pineal Res. 2014, 57, 269–279. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Wang, P.; Wei, Z.; Liang, D.; Liu, C.; Yin, L.; Jia, D.; Fu, M.; Ma, F. The mitigation effects of exogenous melatonin on salinity-induced stress in Malus hupehensis. J. Pineal Res. 2012, 53, 298–306. [Google Scholar] [CrossRef]
- Zhang, Q.; Liu, X.; Zhang, Z.; Liu, N.; Li, D.; Hu, L. Melatonin improved waterlogging tolerance in alfalfa (Medicago sativa) by reprogramming polyamine and ethylene metabolism. Front. Plant Sci. 2019, 10, 44. [Google Scholar] [CrossRef]
- He, Q.; Wang, X.; He, L.; Yang, L.; Wang, S.; Bi, Y. Alternative respiration pathway is involved in the response of highland barley to salt stress. Plant Cell Rep. 2019, 38, 295–309. [Google Scholar] [CrossRef]
- Zhan, H.; Nie, X.; Zhang, T.; Li, S.; Wang, X.; Du, X.; Tong, W.; Song, W. Melatonin: A small molecule but important for salt stress tolerance in plants. Int. J. Mol. Sci. 2019, 20, 709. [Google Scholar] [CrossRef]
- Li, H.; Chang, J.; Chen, H.; Wang, Z.; Gu, X.; Wei, C.; Zhang, Y.; Ma, J.; Yang, J.; Zhang, X. Exogenous melatonin confers salt stress tolerance to watermelon by improving photosynthesis and redox homeostasis. Front. Plant Sci. 2017, 8, 295. [Google Scholar] [CrossRef]
- Zhang, H.; Wang, L.; Shi, K.; Shan, D.; Zhu, Y.; Wang, C.; Bai, Y.; Yan, T.; Zheng, X.; Kong, J. Apple tree flowering is mediated by low level of melatonin under the regulation of seasonal light signal. J. Pineal Res. 2019, 66, e12551. [Google Scholar] [CrossRef] [PubMed]
- Abogadallah, G.M. Antioxidative defense under salt stress. Plant Signal Behav. 2010, 5, 369–374. [Google Scholar] [CrossRef] [PubMed]
- Bowler, C.; Montagu, M.V.; Inze, D. Superoxide dismutases and stress tolerance. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1992, 43, 83–116. [Google Scholar] [CrossRef]
- Yu, G.B.; Zhang, Y.; Ahammed, G.J.; Xia, X.J.; Mao, W.H.; Shi, K.; Zhou, Y.H.; Yu, J.Q. Glutathione biosynthesis and regeneration play an important role in the metabolism of chlorothalonil in tomato. Chemosphere 2013, 90, 2563–2570. [Google Scholar] [CrossRef]
- Yan, Y.; Sun, S.; Zhao, N.; Yang, W.; Shi, Q.; Gong, B. COMT1 overexpression resulting in increased melatonin biosynthesis contributes to the alleviation of carbendazim phytotoxicity and residues in tomato plants. Environ. Pollut. 2019, 252, 51–61. [Google Scholar] [CrossRef]
- Siddiqui, M.H.; Alamri, S.; Al-Khaishany, M.Y.; Khan, M.N.; Al-Amri, A.; Ali, H.M.; Alaraidh, I.A.; Alsahli, A.A. Exogenous melatonin counteracts NaCl-induced damage by regulating the antioxidant system. Proline and carbohydrates metabolism in tomato seedlings. Int. J. Mol. Sci. 2019, 20, 353. [Google Scholar] [CrossRef]
- Chen, Y.E.; Mao, J.J.; Sun, L.Q.; Huang, B.; Ding, C.B.; Gu, Y.; Liao, J.Q.; Hu, C.; Zhang, Z.W.; Yuan, S.; et al. Exogenous melatonin enhances salt stress tolerance in maize seedlings by improving antioxidant and photosynthetic capacity. Physiol. Plant 2018, 164, 349–363. [Google Scholar] [CrossRef]
- Back, K.; Tan, D.X.; Reiter, R.J. Melatonin biosynthesis in plants: Multiple pathways catalyze tryptophan to melatonin in the cytoplasm or chloroplasts. J. Pineal Res. 2016, 61, 426–437. [Google Scholar] [CrossRef]
- Wei, J.; Li, D.X.; Zhang, J.R.; Shan, C.; Rengel, Z.; Song, Z.B.; Chen, Q. Phytomelatonin receptor PMTR1-mediated signaling regulates stomatal closure in Arabidopsis thaliana. J. Pineal Res. 2018, 65, e12500. [Google Scholar] [CrossRef]
- Cen, H.; Ye, W.; Liu, Y.; Li, D.; Wang, K.; Zhang, W. Overexpression of a chimeric gene, OsDST-SRDX, improved salt tolerance of perennial ryegrass. Sci. Rep. 2016, 6, 27320. [Google Scholar] [CrossRef]
- Castonguay, Y.; Michaud, J.; Dubé, M.P. Reference genes for RT-qPCR analysis of environmentally and developmentally regulated gene expression in alfalfa. Am. J. Plant Sci. 2015, 6, 132–143. [Google Scholar] [CrossRef]






| Primer Name | Primer Sequences (5′-3′) |
|---|---|
| TDC-F | CTCGCAGGATCTTGTCACGG |
| TDC-R | AGGCACTCCTTCTGCCTCAT |
| SNAT-F | GTCAGAGGGGAATGAACAAAA |
| SNAT-R | TTCCACGACTTTACTATCTGCG |
| ASMT-F | ATTTCTTCACTACCAATCCACCC |
| ASMT-R | CCACACTCATTGGATTGTTCTAAA |
| Cu/Zn-SOD-F | TCCACTGGTCCTCACTTCAATC |
| Cu/Zn-SOD-R | GACAGCCCTTCCGAGTATGG |
| CAT-F | TGAAGACCCCTCCCTACGAA |
| CAT-R | GAACTCAGGTGAAGGATTGCC |
| APX-F | AACGAAACAAAATGGCAGACC |
| APX-R | AATTGAGCGAGGAAACGGA |
| Actin-F | CAAAAGATGGCAGATGCTGAGGAT |
| Actin-R | CATGACACCAGTATGACGAGGTCG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cen, H.; Wang, T.; Liu, H.; Tian, D.; Zhang, Y. Melatonin Application Improves Salt Tolerance of Alfalfa (Medicago sativa L.) by Enhancing Antioxidant Capacity. Plants 2020, 9, 220. https://doi.org/10.3390/plants9020220
Cen H, Wang T, Liu H, Tian D, Zhang Y. Melatonin Application Improves Salt Tolerance of Alfalfa (Medicago sativa L.) by Enhancing Antioxidant Capacity. Plants. 2020; 9(2):220. https://doi.org/10.3390/plants9020220
Chicago/Turabian StyleCen, Huifang, Tingting Wang, Huayue Liu, Danyang Tian, and Yunwei Zhang. 2020. "Melatonin Application Improves Salt Tolerance of Alfalfa (Medicago sativa L.) by Enhancing Antioxidant Capacity" Plants 9, no. 2: 220. https://doi.org/10.3390/plants9020220
APA StyleCen, H., Wang, T., Liu, H., Tian, D., & Zhang, Y. (2020). Melatonin Application Improves Salt Tolerance of Alfalfa (Medicago sativa L.) by Enhancing Antioxidant Capacity. Plants, 9(2), 220. https://doi.org/10.3390/plants9020220

