Next Article in Journal
Melatonin-Mediated Modulation of Metabolic Pathways Enhances Cold Tolerance in Alfalfa (Medicago sativa L.)
Previous Article in Journal
Integrated Multi-Omics Analysis Revealed the Synergistic Regulatory Mechanisms of Salt Tolerance in Soybean (Kefeng 1)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 15
Issue 4
10.3390/plants15040556
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Evaluation Profile of Sicilian Oenanthe aquatica (L.) Poir., O. fistulosa L. and O. pimpinelloides L. Essential Oils Under LPS-Induced Cellular Stress

by
Alessandro Vaglica
1,
Alessandra Russo
2,
Vincenzo Ilardi
1,
Rosanna Avola
3,*,
Maurizio Bruno
1,4,* and
Natale Badalamenti
1,4
1
Department of Biological, Chemical and Pharmaceutical Sciences and Technologies (STEBICEF), Università degli Studi di Palermo, Viale delle Scienze, Ed. 17, 90128 Palermo, Italy
2
Department of Drug and Health Sciences, Università di Catania, Via Valdisavoia, 5, 95123 Catania, Italy
3
Department of Medicine and Surgery, Kore University Enna, 94100 Enna, Italy
4
NBFC, National Biodiversity Future Center, 90133 Palermo, Italy
*
Authors to whom correspondence should be addressed.
Plants 2026, 15(4), 556; https://doi.org/10.3390/plants15040556
Submission received: 17 December 2025 / Revised: 29 January 2026 / Accepted: 5 February 2026 / Published: 10 February 2026
(This article belongs to the Section Phytochemistry)
Browse Figures
Versions Notes

Abstract

The genus Oenanthe L. (Apiaceae) comprises aquatic and semi-aquatic species widely distributed across the Northern Hemisphere, some of which are traditionally used as food or in folk medicine. Despite this ethnobotanical relevance and toxicological notoriety, phytochemical and pharmacological data on the genus remain limited, especially regarding their essential oils (EOs). Essential oils, extracted by hydrodistillation from aerial parts of Sicilian Oenanthe fistulosa L. (OF), Oenanthe aquatica (L.) Poir (OA), and Oenanthe pimpinelloides L. (OP), were analyzed by GC–MS. The EO of O. fistulosa was dominated by monoterpene hydrocarbons (59.8%), with β-cis-ocimene (21.6%), sabinene (9.3%), and β-trans-ocimene (8.4%) as the main metabolites. O. pimpinelloides also exhibited a monoterpene-rich profile (60.3%), characterized by β-cis-ocimene (15.5%), sylvestrene (12.8%), and β-trans-ocimene (10.3%) but distinguished by a high apiol content (21.0%), indicating a mixed monoterpene/phenylpropanoid chemotype. In contrast, O. aquatica revealed a markedly different profile dominated by phenylpropanoids (57.2%), particularly dill apiol (53.5%), alongside α-pinene (17.2%) and sabinene (6.5%), representing an uncommon chemotype within the genus. This study aimed to evaluate whether these chemo-diverse Sicilian Oenanthe EOs (dill-apio OA 53.5%; ocimene OF 59.9%; apiol OP 21%) differentially modulated LPS-induced epithelial redox stress in Caco-2. Caco-2 cells were treated for 24 h with lipopolysaccharide (LPS) and co-treated with two concentrations (12.5 and 25 µg/mL) of EOs from three different species of Oenanthe. Assessment of proliferating cell nuclear antigen (PCNA) and the stress response of enzyme heme oxygenase-1 (HO-1) expression was performed using Western blot and reverse transcriptase-polymerase chain reaction (RT-PCR). EOs showed species- and concentration-dependent effects on LPS-induced stress in Caco-2 cells. O. aquatica and O. fistulosa EOs exerted cytoprotective and antioxidant activity at low concentrations (12.5 and 25 μg/mL), reducing 8-hydroxy-2′ -deoxyguanosine (8-OHdG) DNA damage and moderately upregulating HO-1. In contrast, O. pimpinelloides EO (apiol-rich) induced dose-dependent cytotoxicity, elevated 8-OHdG despite strong HO-1 induction, and lacked protection at higher doses. PCNA expression was reduced by LPS across all treatments, with no preservation of proliferation by any EOs. These findings reveal chemotype-specific modulation of oxidative stress and epithelial integrity.

1. Introduction

The genus Oenanthe L. (Apiaceae) comprises perennial aquatic or semi-aquatic plants, predominantly hemicryptophytes and occasionally helophytes, typically reaching 30–100 cm in height. Approximately 40 species have been described, mainly distributed across the temperate regions of the Northern Hemisphere, particularly in Europe, Western Asia, India, and North Africa [1]. The genus name derives from the Greek words οἶνος (wine) and ἄνθος (flowers), a reference to its reputed intoxicating effects, an observation that historically contributed to its notoriety. Among Oenanthe species, Oenanthe crocata L. is the most infamous due to its extreme toxicity. Widespread in the Mediterranean area, especially in Sardinia, O. crocata contains highly neurotoxic toxins in all plant parts, including roots and seeds, capable of inducing convulsions, muscle spasms, and the characteristic risus sardonicus [2,3,4,5,6,7,8]. Its resemblance to edible Apiaceae species such as celery or parsley heightens the risk of accidental poisoning, particularly in rural environments [9]. Despite the toxic reputation of certain members, the genus Oenanthe remains poorly investigated phytochemically and pharmacologically.
Only limited reports are available on their essential oils (EOs) profiles. The volatile components of Oenanthe pimpinelloides L., Oenanthe divaricata (Simon) A.W.Hill, and Oenanthe crocata L. have been recorded [10,11,12], revealing diverse chemical signatures and promising biological activities. For instance, O. pimpinelloides EO demonstrated larvicidal effects against Culex pipiens L. [11], while O. crocata EO has shown antiviral, antimicrobial, and anti-HIV-1 activities [10,13]. More recently, O. crocata EO was shown to exert antioxidant and anti-inflammatory effects in macrophages by reducing nitric oxide production and iNOS expression upon LPS stimulation [14].
Other Oenanthe species are traditionally consumed or used in folk medicine, such as Oenanthe javanica (Blume) DC., widely cultivated in Asia as a culinary vegetable [15]. It exhibits antimutagenic activity against aflatoxin B1, heavy-metal-chelating properties, and has been used to treat inflammatory conditions and pneumonia in traditional remedies [16,17,18]. Its EO is rich in limonene, pulegone, germacrene D, and β-pinene and contributes to its distinctive aromatic profile [19,20]. Historical records also report medicinal applications of Oenanthe aquatica (L.) Poir., particularly its fruits and EO, which were used for dyspepsia, intermittent fever, chronic respiratory disorders, and ulcers [21,22]. Despite this traditional relevance, toxic effects such as vertigo and narcotic symptoms at high doses highlight the importance of controlled investigation and safety assessment [21,22]. Other species are utilized as food or in popular medicine. The roots and the young stem, raw or cooked, of Oenanthe sarmentosa C. Presl. are eaten, and in WN America, it has been used as a tea or tincture for medicinal purposes, possessing antiseptic, diuretic, and laxative properties [23]. In Turkey, the leaves of Oenanthe silaifolia M.Bieb. are traditionally eaten raw as a salad or boiled and cooked with rice [24], whereas O. pimpinelloides is used as fodder in Italian sites, where it is thought to heal swollen stomachs in poultry [25].
EOs from Apiaceae plants are recognized as valuable sources of bioactive compounds, including monoterpenes, sesquiterpenes, and phenylpropanoids, with antioxidant, antimicrobial, and anti-inflammatory activities [26,27,28,29]. However, many Oenanthe species remain largely unexplored, and their mechanisms of action and therapeutic potential have yet to be fully elucidated. This study was designed to test whether these three chemo-diverse Sicilian Oenanthe EOs could differentially modulate LPS-induced epithelial redox stress in Caco-2 cells. Specifically, the working hypothesis was that the OA/OF chemotypes exerted a protective effect, while the OP chemotype induced a pro-oxidant and cytotoxic response.
In this context, the use of LPS-treated Caco-2 cell monolayers as a model of the intestinal barrier disfunction allowed us to test the idea that the chemotypic composition of the essential oil represents an independent variable capable of predicting distinct biological outcomes, assessed through indicators of oxidative DNA damage and cellular response to stress.

2. Results

2.1. Chemical Analysis of EOs

To deepen and expand current knowledge on the genus Oenanthe, the volatile fraction of Oenanthe aquatica, O. fistulosa, and O. pimpinelloides were investigated through GC-MS analysis. Hydrodistillation of the aerial parts of O. fistulosa collected in Bosco Ficuzza (Sicily) yielded a yellow essential oil (OF). Overall, twenty-eight compounds were identified by GC-MS, representing 98.3% of the total OF composition, calculated as the sum of the relative area of identified compounds with respect to the total area of all detected signals. These constituents, reported in Table 1 according to their retention indices on a DB-5 MS non-polar column, were grouped into five chemical classes.
Monoterpene hydrocarbons represented the most abundant class (59.9%), with β-cis-ocimene (21.6%), sabinene (9.3%), β-trans-ocimene (8.4%), and β-phellandrene (8.2%) as the major metabolites. Sesquiterpene hydrocarbons were the second most represented class (26.3%), mainly characterized by β-elemene (7.9%), cis-β-guaiene (5.7%), and allo-aromadendrene (3.9%). Myristicin (6.1%) and apiole (3.9%) dominated the “other compounds” group (10.0%), whereas the remaining classes accounted for less than 2% of the total composition.
The EO obtained from the aerial parts of O. aquatica (OA) showed a markedly different phytochemical profile (Table 1) compared to O. fistulosa. GC-MS analysis revealed a total of 96.6% identified constituents, distributed across five chemical classes. OA was characterized by a strong prevalence of “other compounds” (57.3%), mainly dominated by dill apiole (53.5%), which represented the primary metabolite of the profile. Monoterpene hydrocarbons constituted the second most represented class (36.1%), with α-pinene (17.2%), sabinene (6.5%), and limonene (6.3%) as the major components. Minor monoterpenes included β-myrcene (2.3%), β-pinene (2.5%), and γ-terpinene (0.8%). Sesquiterpene hydrocarbons accounted for only 1.4% of the total composition, whereas oxygenated monoterpenes and oxygenated sesquiterpenes were present in trace amounts. Myristicin (3.4%) also contributed to the characteristic phenylpropanoid fraction. Overall, the marked dominance of dill apiol sets O. aquatica EO apart from the other species investigated, suggesting a distinct biosynthetic pathway within the genus and potential specific biological activities associated with phenylpropanoid-rich EOs.
The volatile fraction of O. pimpinelloides L. (OP) revealed a chemical profile quantitatively like that of OF (Table 1), with 96.8% of the total composition identified. Monoterpene hydrocarbons represented the largest class (60.6%), with β-cis-ocimene (15.5), β-phellandrene (12.8%), β-trans-ocimene (10.3%), and sylvestrene (5.8%) as the most abundant constituents. Additional representative monoterpenes included γ-terpinene (4.8%), β-myrcene (3.0%), and α-terpinene (5.5%). Sesquiterpene hydrocarbons accounted for 12.6%, mainly represented by germacrene B (6.4%), β-caryophyllene (3.0%), and γ-elemene (1.1%). The other compounds class (22.6%) included apiol3 as the predominant metabolite (21.0%), accompanied by minor amounts of myristicin (1.2%). Oxygenated monoterpenes and sesquiterpenes contributed only minimally (0.8% and 0.2%, respectively). This composition highlights O. pimpinelloides as an ocimene-/apiole-rich EO, bridging the chemotypic characteristics of both O. fistulosa and O. aquatica but showing a unique balance between monoterpenes and phenylpropanoids.

2.2. Biological Evaluation

To assess the chemotype- and concentration-dependent effects of Oenanthe EOs on LPS-induced epithelial stress, four complementary biomarkers were evaluated in the Caco-2 barrier cell model: cell survival via mitochondrial function (MTT assay), oxidative DNA damage (8-OHdG), Nrf2-mediated redox adaptation (HO-1 expression), and epithelial proliferation under inflammatory conditions (PCNA, Section 4.8). This integrated approach enables the assessment of antioxidant capacity, mitochondrial protection, redox homeostasis, and the epithelial response to stress.

2.3. Cell Viability

The viability of Caco-2 cells after 24 and 48 h of treatment with lipopolysaccharide (LPS) at various concentrations (0, 1, 5, 10, 50, and 100 μg/mL) is shown in Figure 1a,b. Cell viability decreased in a dose-dependent manner upon LPS treatment, with a more pronounced effect observed at 48 h compared to 24 h.
Based on dose–response data (Figure 1a), 5 μg/mL LPS for 24 h was selected for subsequent experiments as it induced a reproducible 36% viability reduction, establishing significant cellular stress while maintaining >60% viability. This is the optimal dynamic range for detecting EO cytoprotective effects without floor/ceiling artifacts. To assess the effects of OA, OF, and OP on Caco-2 cell viability and to determine appropriate experimental concentrations, cells were treated with a range of EO doses (12.5, 25, 50, and 100 μg/mL) for 24 h. The MTT assay demonstrated (Figure 2) that at 12.5 and 25 μg/mL, OF and OP showed significant effects on cell viability, while OA had minimal impact.
In contrast, higher concentrations (≥50 μg/mL) reduced cell viability, with product OP showing the strongest cytotoxic effect and product OA having minimal impact even at the highest dose. Based on these dose–response findings, the two lowest concentrations (12.5 and 25 μg/mL) of OA, OF, and OP, together with 5 μg/mL LPS for 24 h, were selected for subsequent functional assays.
The cytoprotective effects of OA, OF, and OP on Caco-2 cells exposed to LPS were evaluated after 24 h. As shown in Figure 3, LPS treatment alone markedly reduced cell viability to approximately 64% of the untreated control, confirming the cytotoxic effect of LPS on intestinal epithelial cells.
Co-treatment with the Oenanthe EOs revealed product- and concentration-dependent effects on cell survival. At 12.5 μg/mL OF showed significantly higher cell viability than OA and OP at the same concentration against the cytotoxicity induced by LPS treatment of Caco-2 cells (p < 0.05 vs. LPS).
With an increase in concentration to 25 μg/mL, OA and OF, although the improvement was less pronounced, continued to improve viability, suggesting a likely plateau in their protective capacity. OP at 25 μg/mL further reduced cell viability compared to treatment with LPS alone, supporting the hypothesis of a dose-dependent cytotoxicity profile.

2.4. Oxidative DNA Damage (8-OHdG)

To assess whether LPS-induced oxidative stress leads to DNA damage, 8-hydroxy-2′ -deoxyguanosine (8-OHdG), a well-established biomarker of oxidative DNA lesions, was quantified. LPS treatment caused a significant increase in 8-OHdG levels (Figure 4), confirming the occurrence of oxidative stress and DNA damage in experimental models. Co-treatment with OA or OF and LPS moderately reduced 8-OHdG levels compared to LPS alone, indicating a protective effect against oxidative DNA damage, likely mediated by antioxidant activity. Despite the substantial HO-1 induction shown with this EO, co-treatment with OP significantly increased 8-OHdG levels above those reported with LPS alone (Figure 4), indicating a pro-oxidant action that exacerbates oxidative DNA damage.

2.5. Stress Response and Proliferative Capacity

To investigate the impact of Oenanthe EOs on redox-regulated stress responses, HO-1 expression was assessed at both the gene and protein levels in Caco-2 cells exposed to LPS. As shown in Figure 5a,b co-treatment with OA and OF induced moderate HO-1 upregulation, reflecting the activation of an adaptive antioxidant response.
This effect paralleled the reduction in 8-OHdG levels observed with the same treatments (Figure 4), indicating enhanced protection against oxidative DNA damage. In contrast, OP induced the strongest HO-1 upregulation at both gene (Figure 5a) and protein (Figure 5b) levels, particularly at the concentration of 25 μg/mL. OP co-treatment resulted in the highest 8-OHdG levels (Figure 4) and lowest cell viability (Figure 3), despite maximal HO-1 expression. LPS treatment of Caco-2 cells resulted in a reduction in PCNA gene and protein expression compared to untreated controls, indicating a decreased proliferative capacity of Caco-2 cells under inflammatory stress (Figure 6b). Concomitant treatment with all three Sicilian Oenanthe EOs, at all tested concentrations, did not restore PCNA expression to the levels of untreated controls (Figure 6a,b), indicating that proliferative capacity was not preserved under LPS-induced inflammatory stress.

3. Discussion

The chemical profiles of the three Oenanthe EOs investigated in this study (OA, OF, and OP) display marked differences that reflect the broad chemo-diversity already documented within the genus [10,30,31]. OA was phenylpropanoid-dominated, with dill apiol accounting for more than half of the oil composition; this chemotype is clearly distinct from the monoterpene-rich EOs reported for many other Oenanthe taxa and suggests a specialized biosynthetic allocation toward methylenedioxyphenyl derivatives in this Sicilian accession [10,21,30,31,32,33]. Phenylpropanoid-rich EOs have been rarely reported in Oenanthe, making OA an interesting chemotype for further genetic study.
By contrast, OF and OP conform more closely to monoterpene-dominated chemotypes described in the literature, but with important differences. OF is strongly ocimene/phellandrene-type, with β-cis- and trans-ocimene as main components; this pattern resembles the ocimene-rich accessions of O. crocata reported from Portugal and Sardinia, where trans-β-ocimene and cis-β-ocimene represented large proportions of the total composition [13,14].
This peculiarity indicates that ocimene chemotypes occur across different Oenanthe species and geographic areas, possibly reflecting conserved monoterpene biosynthetic pathways within ecotypes [13,14]. OP, while broadly monoterpene-rich chemotypes like OF showed a notable co-occurrence of a high apiole content (21.0%), which makes it intermediate between classic monoterpene chemotypes and the phenylpropanoid-rich profile observed in OA. Apiole-dominated fractions are well known in some Apiaceae EO’s species and can impart distinct biological activities; the presence of substantial apiole in OP therefore differentiates it from the γ-terpinene/p-cymene chemotype reported for O. pimpinelloides from Greece, where γ-terpinene and p-cymene predominated [11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,34]. This suggests that O. pimpinelloides may present multiple, geographically structured chemotypes.
Several previously reported Oenanthe EOs highlighted the genus’ compositional plasticity. For example, O. javanica accession displays a wide range of major constituents, from incensole and α-copaene in a Malaysian sample to γ-terpinene and limonene-type in Korean and Indian oil extract, demonstrating strong geographic and possibly genotypic effects on volatile profiles [30,35,36]. Similarly, O. divaricata from Madeira was dominated by sesquiterpenes such as β-bisabolene and β-caryophyllene, again markedly different from OA and OF profiles [12]. These examples underscore that both intrageneric and intraspecific variability are common in Oenanthe and that chemotypes cannot be inferred reliably from species name alone.
Finally, the resemblance between OF and Portuguese and Sardinian O. crocata accessions [13,14] is particularly noteworthy: all display high relative abundances of ocimene derivatives and sabinene, although relative proportions differ among populations. Such quantitative shifts (e.g., higher sabinene in some O. crocata accessions versus higher ocimene in OF) can influence both aroma and bioactivity and likely reflect local environmental pressures, developmental stage at harvest, or genetic differences.
From a chemotaxonomic and applied perspective, these compositional differences have direct implications for biological activity and potential uses. Phenylpropanoid-rich OA (dill apiol dominant) may be expected to exhibit different antifungal, insecticidal or enzyme-modulating activities compared with monoterpene-rich OF and OP; similarly, apiole-rich OP could present specific bioactivities (e.g., modulation of inflammatory pathways) distinct from γ-terpinene or ocimene chemotypes [28,29]. Therefore, assigning biological effects to a species without considering chemotype (and locality) risks oversimplification.
The investigation of the four biomarkers was chosen to test the LPS-treated Caco-2 cell monolayers model as a model of the intestinal barrier dysfunction, which is based on a direct assessment of ROS and cellular function [36,37,38,39,40,41,42] rather than on the immunomodulatory analysis of NF-κB/cytokines, which are less relevant in this epithelial context.
This approach allows a more functionally relevant evaluation of epithelial barrier impairment.
The findings show distinct and extensive chemotype-dependent effects: OA/OF play a protective role, as evidenced by the decrease in 8-OHdG (Figure 4) and the preservation of mitochondrial function (Figure 3), associated with moderate HO-1 activation (Figure 5). On the other hand, OP fails to counteract LPS-induced proliferative suppression (decrease in PCNA, Figure 6), mitochondrial function (decrease in cell viability, Figure 3), and pro-oxidant toxicity (increase in 8-OHdG despite maximal HO-1 induction, Figure 4 and Figure 5).
The use of LPS-stimulated Caco-2 monolayers provides a well-established in vitro model for evaluating epithelial integrity and inflammatory injury [37,38]. Indeed, consistent with the literature, LPS treatment alone significantly reduced cell viability to approximately 64% compared to the untreated control. Although Caco-2 cells express low basal levels of TLR4, high-dose LPS (5 µg/mL) induces reproducible oxidative stress, barrier disruption, and inflammatory responses, making this system a validated model of epithelial dysfunction rather than acute immune activation [36]. Caco-2 cells exhibited low basal levels of TLR4 and MD-2 expression, rendering them poorly responsive to physiological LPS concentrations (1–100 ng/mL) [39]. However, supra-physiological LPS doses (≥5 μg/mL) overcome this limitation, inducing robust oxidative stress, tight junction disruption, and ROS production—features that closely mimic the early epithelial dysfunction observed in inflammatory bowel disorders [36,37,38,39,40,41,42]. These phenomena occur primarily through TLR4-independent lipid raft-mediated endocytosis and intracellular signaling rather than the canonical activation of the TLR4/MD-2/CD14 complex typical of myeloid cells [40,41], supporting the suitability of this model for epithelial rather than immune injury [41].
The recovery of viability observed with OA and OF at low concentrations therefore reflects not only cytoprotection but also a potential barrier-preserving effect, consistent with findings demonstrating that phytochemicals with antioxidant and anti-inflammatory activity can stabilize epithelial junctions and mitigate LPS-induced barrier damage [43,44].
OF exhibited the strongest cytoprotection at 12.5 μg/mL (Figure 3), and both OA and OF, enriched in monoterpenes and phenylpropanoids, showed low inherent cytotoxicity and reproducible protection against LPS-induced damage. In contrast, OP displayed a biphasic response, with cytoprotection at 12.5 μg/mL but toxicity at 25 μg/mL (Figure 3), highlighting a concentration-dependent effect linked to chemotype composition. Their moderate enhancement of viability, particularly at 12.5 μg/mL, is consistent with the well-documented anti-inflammatory and antioxidant activities of monoterpenes and phenylpropanoids reported in other experimental models [45,46].
In our LPS-driven model of epithelial injury, this functional protection correlates with reduced oxidative DNA damage (lower 8-OHdG), preserved metabolic activity, and moderate HO-1 induction, reflecting an adaptive redox response.
In contrast, OP displayed dose-dependent cytotoxic, with protective effects only at the lowest concentration (12.5 μg/mL) and clear toxicity at 25 μg/mL. This pattern aligns with its high apiole content, as apiole-related compounds have been shown to trigger ROS-mediated damage and apoptosis [47]. The loss of protection and decrease in viability at 25 μg/mL likely reflects the transition from mild stress adaptation to overt oxidative and apoptotic injury—conditions known to further compromise epithelial barrier stability. The reduction in 8-OHdG levels by OA and OF reflects their antioxidant and ROS-scavenging capacity, consistent with their content of monoterpenes and phenylpropanoids [48,49,50]. This protective effect supports the idea that these EOs can maintain genomic integrity under inflammatory stress, potentially contributing to epithelial resilience.
Conversely, the increased 8-OHdG observed with OP indicates a pro-oxidant effect, likely driven by its high apiole content, often associated with oxidative stress and genotoxicity in similar cellular systems [51]. Although Caco-2 cells are non-metastatic adenocarcinoma cells and retain wild-type p53, they possess intact DNA damage response pathways, making them responsive to apiole-induced cellular stress.
The marked elevation of 8-OHdG in OP + LPS-treated cells (Figure 4) suggests a synergistic amplification of oxidative and genotoxic stress, consistent with previous reports showing that structurally related allylbenzenes, such as estragole and anethole, undergo CYP450-mediated bioactivation to electrophilic intermediates, which can form DNA and hemoglobin adducts, indicative of potential genotoxicity [52]. Collectively, these data suggest that OA and OF foster a cellular environment conducive to ROS scavenging and DNA protection, whereas OP exerts a pro-oxidant action that exacerbates LPS-induced oxidative and genotoxic damage.
In the presence of LPS, this effect appears synergistic, intensifying oxidative and genotoxic stress even in Caco-2 cells with intact p53 and DNA repair pathways.
HO-1 was examined as a central marker of epithelial redox adaptation because it plays a pivotal role in ROS detoxification, inflammatory resolution, and maintenance of barrier integrity. HO-1 induction can indicate whether cells activate protective antioxidant pathways or shift toward maladaptive stress responses. Integrating HO-1 with viability and 8-OHdG measurements allowed us to delineate whether the EOs promoted epithelial resilience or exacerbated damage. The moderate HO-1 upregulation induced by OA and OF aligns well with the protective profile previously observed in viability assays and oxidative DNA damage analysis. This range of induction is characteristic of adaptive Nrf2 signaling, which enhances ROS scavenging and limits oxidative injury without imposing metabolic overload [50]. The parallel reduction in 8-OHdG suggests that HO-1 activation here contributes to restored redox equilibrium, supporting epithelial stability.
Instead, the simultaneous increase in HO-1 and 8-OHdG indicates overwhelming oxidative insult, consistent with redox-driven degeneration and ferroptosis-like pathways described in epithelial models [53,54,55]. This pattern suggests that HO-1, when excessively induced, becomes a marker of stress saturation rather than a mediator of repair, reflecting a breakdown in compensatory redox mechanisms. The inability of OP-treated cells to restrain oxidative DNA damage reinforces this interpretation and aligns with pro-oxidants of OP and the apiole-driven profile of OP observed in other assays.
Co-treatment with EOs from Oenanthe spp. did not restore PCNA levels, despite the upregulation of the cytoprotective enzyme HO-1, suggesting that these treatments primarily exert protective, rather than proliferative, effects. This outcome aligns with the well-documented multifunctional role of PCNA, which extends beyond its canonical function as a replication clamp during DNA synthesis to include DNA repair, cell cycle regulation, and coordination of stress responses [56]. Under conditions of oxidative or genotoxic stress, PCNA recruitment may primarily reflect engagement in repair and survival pathways rather than active proliferation [57], and its expression can be modulated by checkpoint regulators such as p21, which can inhibit DNA replication while allowing repair to continue. These considerations underscore the ambiguity of interpreting PCNA as a sole proliferation marker in inflammatory contexts. These findings suggest that in LPS-challenged epithelial cells, the reduction in PCNA may indicate a protective cell cycle pause, preventing replication under stress conditions while cellular defenses are activated. The inability of EOs to restore PCNA levels indicates that their primary role is not to drive proliferation but to support cellular resilience, likely through redox regulation and mitigation of inflammatory damage.
Collectively, these data suggest that these Oenanthe EOs favor maintenance of epithelial integrity and functional homeostasis through chemotype-specific protective adaptation rather than uncontrolled cell division under inflammatory conditions.
Given the well-documented toxicity of the genus Oenanthe, particularly the polyacetylene neurotoxins of O. crocata responsible for fatal human poisonings [9,58,59,60,61,62,63,64], these chemotype-specific findings have important pharmacological implications. O. aquatica and O. fistulosa show protective effects up to 25 μg/mL, identifying a safe therapeutic window of ≤25 μg/mL, while O. pimpinelloides (21% apiol) requires dosages ≤12.5 μg/mL to avoid pro-oxidant toxicity via CYP450 bioactivation [62]. This chemotypic distinction represents an original contribution to the safe valorization of Sicilian Oenanthe species, underlining the crucial importance of chemical characterization for therapeutic applications, which allows not only a precise selection of the chemotype but, above all, the identification of the optimal dose to maximize cytoprotection and minimize toxicological risks.

4. Materials and Methods

4.1. Plants Materials

Aerial parts from several individuals of Oenanthe aquatica (L.) Poir. (Figure 7), at the full flowering stage, were collected at Bosco della Ficuzza, Corleone, Palermo, Sicily, Italy, at about 781 m a.s.l., 37°53′10′′ longitude N and 13°23′45′′ latitude E, in May 2024. One of the samples, identified by Prof. Vincenzo Ilardi, has been stored in the University of Palermo Herbarium (No. 108982).
Aerial parts from several individuals of Oenanthe fistulosa L. (Figure 8), at the full flowering stage, were collected at Gorgo Lungo, Godrano, Palermo, Sicily, Italy, at about 864 m a.s.l., 37°54′04′′ longitude N and 13°24′44′′ latitude E, in May 2024. One of the samples, identified by Prof. Vincenzo Ilardi, has been stored in the University of Palermo Herbarium (No. 109798).
Aerial parts from several individuals of Oenanthe pimpinelloides L. (Figure 9), at the full flowering stage, were collected at Bosco della Ficuzza, Corleone, Palermo, Sicily, Italy, at about 692 m a.s.l., 37°53′07′′ longitude N and 13°23′19′′ latitude E, in May 2024. One of the samples, identified by Prof. Vincenzo Ilardi, has been stored in the University of Palermo Herbarium (No. 108983).

4.2. Isolation of EO

Fresh aerial parts of OA (1040 g), OF (400 g) and OP (437 g) were hand-cut into small fragments and then subjected to hydrodistillation for 3 h, according to the standard procedure described in European Pharmacopoeia (2020) [65]. Samples yielded 0.004%, 0.016%, and 0.011%, for OA, OF, and OP EOs, respectively.

4.3. Chemical Analysis

Analysis of EOs was performed according to the procedure reported by Vaglica et al. [66]. Gas chromatography coupled with mass spectrometry (GC-MS) analyses were performed using a Shimadzu QP 2010 plus equipped with an AOC-20i autoinjector (Shimadzu, Kyoto, Japan) gas chromatograph equipped with a non-polar capillary column (DB-5 MS) 30 m × 0.25 mm i.d., film thickness 0.25 μm, and a data processor. The oven program was as follows: temperature was maintained at 40 °C for 5 min, then increased at a rate of 2 °C/min up to 260 °C, finally remaining isothermal for 20 min. Helium was used as carrier gas (1 mL min−1). The injector and detector temperatures were set at 250 °C and 290 °C, respectively. An amount of 1 μL of EO solution (3% EO/hexane v/v) was injected with split mode 1.0; MS range 40–600. In Table 1, the relative percentage composition of each component was calculated by area normalization, expressing the area of each GC peak as a percentage of the total area of all detected signals. The settings were as follows: ionization voltage, 70 eV; electron multiplier energy, 2000 V; transfer line temperature, 295 °C; solvent delay, 4 min. Kovats Indices (KIs) were calculated by using retention times of n-alkanes (C8–C40), and the peaks were identified by comparison with mass spectra and by comparison of their relative retention indices with WILEY275, NIST 17, ADAMS, and FFNSC2 libraries.

4.4. Cell Culture

Caco-2 cells (obtained by The European Collection of Authenticated Cell Cultures ECACC) were grown in Minimum Essential Medium (MEM, Sigma-Aldrich, Milan, Italy), supplemented with 10% fetal bovine serum (FBS), 1% of streptomycin, 1% of penicillin, and incubated in controlled conditions at 37 °C in a humidified, 95% air 5% CO2 atmosphere. The culture medium was changed every 2–3 days [67].
For experiments, 24 h before, the cells were trypsinized, counted, and plated in 96 (1.5 × 104) plates or T-75 flask. Twenty-four hours after, the culture medium was discarded, and cells were washed with phosphate-buffered saline (PBS). Experimental Caco-2 cells were stimulated or not (untreated controls) with LPS at various concentrations (1, 5, 10, 50, and 100 μg/mL) for 24 and 48 h concentration and at different concentrations of OA, OF, and OP (12.5, 25, 50, and 100 μg/mL for MTT assay and 12.5 and 25 μg/mL for other experiments). After 24 and 48 h, respectively, each sample was tested for the experiments described below.

4.5. Cell Viability Assay

OEs toxicity was assessed using the mitochondrial-respiration-dependent 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT) reduction method [68,69]. Caco-2 cells line were plated in 96 multi-wells and incubated with different concentrations of OA, OF, and OP for 24 and 48 h at 37 °C in 5% CO2. After treatment, 20 μL of MTT (Sigma-Aldrich, Milan, Italy) in PBS at a final concentration of 5 μg/mL were added. After 3 h, PBS was removed and the formazan crystals formed were solubilized with 100 μL of dimethylsulphoxide (DMSO). The absorbance of each well was measured by a microplate spectrophotometer reader (Titertek Multiskan, DAS, Milan, Italy). The optical density of formazan formed in control cells was taken as 100% viability, and the data were averaged (three experiments in triplicate) and represented as percentage of viability with respect to untreated controls.

4.6. Determination of 8-hydroxy-2′ -deoxyguanosine (8-OHdG)

The measurement of 8-OHdG production was used to determine the extent of DNA damage [48]. LPS (5 μg/mL) and OA, OF, and OP (12.5 and 25 μg/mL) were applied to Caco-2 cells (1.5 × 104 cell/well) that were sown on 24-well plates. Following a 24 h period, the cells were fixed for two hours at 4 °C using 4% paraformaldehyde in PBS.
The cells were then treated for five minutes on ice with 0.05 M HCl, cleaned with PBS, and then incubated for one hour at 37 °C with 300 μL of RNAse (100 μg/mL dissolved in 150 mM NaCl and 15 mM sodium citrate). Following this, Caco-2 cells underwent dehydration using a graded series of alcohol (35%, 50%, and 75% ethanol), were washed with PBS, and were incubated with 300 μL of 0.15 M NaOH in 70% ethanol for 4 min to facilitate in situ DNA denaturation. A mixture of 70% ethanol with 4% formaldehyde was used to neutralize the alkaline solution. Following that, 50% and 35% ethanol and PBS were applied to the cells. The cells were then incubated for 10 min at 37 °C after 300 μL of proteinase K (5 μg/mL in 20 mM Tris and 1 mM EDTA) at pH 7.5 was added. The samples were blocked with 5% BSA for one hour at room temperature in order to stop non-specific binding. After that, the cells were exposed to a primary antibody direct against anti-8-OHdG (sc-393870; Santa Cruz Biotechnology, Santa Cruz, CA, USA; 1:200 dilution) for an entire night at 4 °C. The next day, cells were cleaned with PBS and exposed to a fluorescein isothiocyanate conjugated goat anti-mouse (12–506, FITC; Millipore, Milan, Italy; 1:400 dilution) antibody for one hour at room temperature. Following a PBS wash, a Hitachi F-2000 spectrofluorimeter (Hitachi, Tokyo, Japan) was used to measure the binding level at excitation/emission wavelengths of λ = 488/519 nm. All experimental cultures were incubated with 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Invitrogen, Milan, Italy; 1:10,000 dilution) for 10 min at room temperature, and the fluorescence intensity (λ = 346/460 nm) was measured to determine the cell density. Fold change in comparison to the untreated control was used to express the results of three tests conducted in triplicate.

4.7. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) and Gene Expression Quantification

RT-PCR assay was performed and analyzed as previously described in Albouchi et al. [70]. Total RNA from Caco-2 treated and not treated was isolated using 1 mL Qiazol Reagent (Qiagen, Milan, Italy), 0.2 mL chloroform, and 0.5 mL isopropanol. Pellet was washed with 75% ethanol, dried with air, and re-suspended in RNAse-free water. Total RNA was purified using the Qiagen RNeasy Mini Kit (Qiagen, Milan, Italy). The complementary DNA (cDNA) were synthesized from the total RNA samples by using the QuantiTect Reverse Transcription Kit (Qiagen, Milan, Italy) according to the manufacturer’s protocol. Aliquots of cDNA were amplified using specific primers sequences reported in Table 2.
RT-PCR analysis was performed by Rotor-gene Q (Qiagen, Milan, Italy). Specifically, cDNA template (100 ng/reaction) was added to the reaction mix containing 1x Rotor-Gene SYBR Green PCR Master Mix (Qiagen, Milan, Italy), 1 μΜ of each primer (forward and reverse) (Table 2) and RNase-free water to a final reaction volume of 25 μL. RT-PCR was performed using the following program: initial activation step 95 °C 10 min, denaturation 95 °C 10 s, annealing 60 °C 30 s, extension 72 °C 30 s (40 cycles), final extension 72 °C 10 min. RT-PCR was followed by melting curve analysis to confirm PCR specificity. Each reaction was repeated three times, and threshold cycle average was used for data analysis by Rotor-gene Q software version 2.1.0. Target genes were normalized against GAPDH. Each amplification was carried out in three independent experiments, each performed in triplicate. The 2−ΔΔCT method was used to calculate the difference in CT value between the OA, OF, or OP EOs-treated samples and untreated controls. Results were then normalized to an endogenous reference gene (GAPDH) whose expression is constant in all groups.
ΔΔCT = (CTTarget − CTReference gene)treated − (CTTarget − CTReference gene)untreated
The results were reported as fold change in LPS-treated cells vs. untreated control.

4.8. Western Blot Analysis

The protein expression of biomarkers was evaluated by Western blot using the methods reported on Graziano et al. [71]. Briefly, after lysing the Caco-2 cell line with buffer mammalian Protein Extraction Reagent (M-PER), (Pierce, Fisher Scientific, Milan, Italy), the cells were vortexed on ice for 30 min. Centrifugation at 15,000 × g for 15 min at 4 °C was used to remove the insoluble debris. The bicinchoninic acid assay (BCA assay) (Pierce, Fisher Scientific, Milan, Italy) was used to quantify the proteins. Equal amounts of proteins were separated using 4–12% bolt gel (Invitrogen, Milan, Italy) and electrophoretically transferred to nitrocellulose membranes (Invitrogen, Milan, Italy) in a wet system (Invitrogen, Milan, Italy). The nitrocellulose membranes were stained with Ponceau S to confirm the protein transfer. For 30 min at room temperature, membranes were blocked in 10 milliliters of iBind flex solution (Thermo Fisher Scientific, Milan, Italy). The primary antibodies, listed in Table 3, and the corresponding HRP-conjugated secondary antibodies (goat anti-rabbit, 1:5000 dilution; goat anti-mouse, 1:1000 dilution, both Santa Cruz Biotechnology, DBA, Milan, Italy) were diluted in iBind flex solution and incubated on the membranes overnight at room temperature using the iBindTM Flex Western System (Thermo Fisher Scientific, Milan, Italy). After rinsing the blots in distilled water, the particular antibodies were identified using chemiluminescent solution (Pierce, Fisher Scientific, Milan, Italy) and analyzed using the Uvitec Alliance LD9 gel imaging system (Uvitec, Cambridge, UK). Bands were measured densitometrically, and their relative density was calculated based on the density of the GAPDH bands in each sample. Values of arbitrary densitometric units (A.D.U.) (three experiments in triplicate) corresponding to signal intensity were expressed as fold of change with respect to untreated control.

4.9. Statistical Analysis

Comparisons between groups were made using Student’s t-test or analysis of variance (ANOVA) followed by appropriate post hoc tests as needed. All statistical analyses were made using the statistical software package SYSTAT, version 11 (Systat Inc., Evanston, IL, USA). Differences were considered statistically significant at p < 0.05.

5. Conclusions

This study provides the first phytochemical characterization and biological evaluation of essential oils from Sicilian Oenanthe aquatica, O. fistulosa, and O. pimpinelloides in the LPS-stimulated Caco-2 cell line. Specifically, Oenanthe aquatica (rich in dill apiol, equal to 53.5%) and O. fistulosa (which higher percentage of ocimene, equal to 59.9%), at concentrations of 12.5–25 μg/mL, showed cytoprotective effects that consist in a moderate reduction in oxidative DNA damage (8-OHdG) and upregulation of HO-1. In contrast, O. pimpinelloides (predominant apiol continent, equal to 21.0%) exhibits dose-dependent cytotoxicity and pro-oxidant activity, significantly increasing 8-OHdG levels above those observed with LPS alone despite maximal HO-1 induction. These chemotype-specific effects suggest a potential therapeutic application of essential oils from Oenanthe aquatica and O. fistulosa in the treatment of intestinal damage. This finding also provides a starting point for further research in animal models aimed at defining safe therapeutic thresholds for clinical applications. The targeted selection of biomarkers—cell viability (MTT), oxidative DNA damage (8-OHdG), redox adaptation (HO-1), and PCNA as an indicator of DNA repair and cell cycle regulation—was designed to test whether the chemical composition of the oils predicts divergent biological outcomes under conditions of epithelial oxidative stress. This integrated approach allowed for clear risk stratification based on chemotype, paving the way for future studies that will include analysis of the Nrf2/NF-κB pathways, direct imaging of reactive oxygen species (ROS), assessment of epithelial barrier integrity (e.g., TEER and ZO-1), and validation of therapeutic thresholds in animal models.

Author Contributions

Conceptualization, N.B., V.I. and M.B.; methodology, M.B., N.B. and A.R.; software, A.V., N.B. and R.A.; validation, V.I., N.B. and A.R.; formal analysis, R.A. and A.V.; investigation, A.V., A.R. and R.A.; resources, N.B. and M.B.; data curation, N.B., M.B. and A.R.; writing—original draft preparation, A.V. and R.A.; writing—review and editing, N.B., A.R. and R.A.; visualization, N.B., A.R. and R.A.; supervision, N.B., M.B., A.R. and R.A. All authors have read and agreed to the published version of the manuscript.

Funding

Project funded under the National Recovery and Resilience Plan (NRRP), Mission 4 Component 2 Investment 1.4—Call for tender No. 3138 of 16 December 2021, rectified by Decree n.3175 of 18 December 2021 of Italian Ministry of University and Research funded by the European Union—NextGenerationEU; Project code CN_00000033, Concession Decree No. 1034 of 17 June 2022 adopted by the Italian Ministry of University and Research, CUP UNIPA B73C22000790001, Project title “National Biodiversity Future Center—NBFC”. This work was supported by a grant from Progetto Finanziato da Next Generation EU PNRR—Missione 4 “Istruzione e Ricerca”—Componente C2 -investimento 1.1 (PNRR M4.C2.1.1), Fondo per il Programma Nazionale di Ricerca e Progetti di Rilevante Interesse Nazionale (PRIN)—codice P2022CKMPW_002—CUP B53D23025620001. Plants 15 00556 i001

Data Availability Statement

All data and materials are available upon request from the corresponding authors.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Leurquin, J. Étude du Genre Oenanthe (Apiaceae) de la Belgique et des Régions Voisines: Clés de Détermination, Données Morphologiques, Stationnelles et Socio-Écologiques; Lotissement Coputienne: Luxembourg, 2007; Volume 10, 26p. [Google Scholar]
  2. Clarks, E.G.; Kidder, D.E.; Robertson, W.D. The isolation of the toxic principle of Oenanthe crocata. J. Pharm. Pharmacol. 1949, 1, 377–381. [Google Scholar] [CrossRef]
  3. Janot, M.M.; Robineau, C.; Le Men, J. Crocatone, the non-toxic crystalline principle from Oenanthe crocata L. (Umbelliferae). Bull. Soc. Chim. Biol. 1955, 37, 361–364. [Google Scholar]
  4. King, L.A.; Lewis, M.J.; Parry, D.; Twitchett, P.J.; Kilner, E.A. Identification of oenantotoxin and related compounds in hemlock water-dropwort poisoning. Hum. Toxicol. 1985, 4, 355–364. [Google Scholar] [CrossRef]
  5. Kite, G.C.; Stoneham, C.A.; Veitch, N.C.; Stein, B.K.; Whitwell, K.E. Application of LC–MS to the investigation of poisoning by Oenanthe crocata. J. Chromatogr. B 2006, 838, 63–70. [Google Scholar] [CrossRef]
  6. Durand, M.F.; Pommier, P.; Chazalette, A.; de Haro, L. Child poisoning after ingestion of a wild Apiaceae: A case report. Arch. Pediatr. 2008, 15, 139–141. [Google Scholar] [CrossRef]
  7. Jaspersen-Schib, R.; Theus, L.; Guirguis-Oeschger, M.; Gossweiler, B.; Meier-Abt, P.J. Serious plant poisonings in Switzerland 1966–1994. Schweiz. Med. Wochenschr. 1996, 126, 1085–1098. [Google Scholar] [PubMed]
  8. Martínez-Honduvilla, M.P.; Aramburu, E.; Bahlsen, C.; Serranillos, F.M.G. Toxicity of the fruit of Oenanthe crocata L. Arch. Farmacol. Toxicol. 1981, 7, 197–200. [Google Scholar] [PubMed]
  9. Appendino, G.; Pollastro, F.; Verotta, L.; Ballero, M.; Romano, A.; Wyrembek, P.; Szczuraszek, K.; Mozrzymas, J.W.; Taglialatela-Scafati, O. Polyacetylenes from Sardinian Oenanthe fistulosa: A molecular clue to Risus sardonicus. J. Nat. Prod. 2009, 72, 962–965. [Google Scholar] [CrossRef]
  10. Bonsignore, L.; Casu, L.; Loy, G. Analysis of the essential oil of Oenanthe crocata L. and its biological activity. J. Essent. Oil Res. 2004, 16, 266–269. [Google Scholar] [CrossRef]
  11. Evergetis, E.; Michaelakis, E.; Kioulos, E.; Koliopoulos, G.; Haroutounian, S.A. Chemical composition and larvicidal activity of essential oils from six Apiaceae taxa against Culex pipiens. Parasitol. Res. 2009, 105, 117–124. [Google Scholar] [CrossRef]
  12. Pino, J.A.; Fernandez, P.; Rosado, R.A.; Fontiha, S.S. Leaf oils of Helichrysum melaleucum, Oenanthe divaricata, and Persea indica from Madeira. J. Essent. Oil Res. 2004, 16, 487–489. [Google Scholar]
  13. Bicchi, C.; Rubiolo, P.; Ballero, M.; Sana, C.; Matteodo, M.; Esposito, F.; Zinzula, L.; Tramontano, E. HIV-1-inhibiting activity of the essential oil of Ridolfia segetum and Oenanthe crocata. Planta Med. 2009, 75, 1331–1335. [Google Scholar] [CrossRef]
  14. Valente, J.; Zuzarte, M.; Gonçalves, M.J.; Lopes, M.C.; Cavaleiro, C.; Salgueiro, L.; Cruz, M.T. Antifungal, antioxidant and anti-inflammatory activities of Oenanthe crocata L. essential oil. Food Chem. Toxicol. 2013, 62, 349–354. [Google Scholar] [CrossRef] [PubMed]
  15. Park, J.C.; Ha, J.O.; Park, K.Y. Antimutagenic effect of flavonoids isolated from Oenanthe javanica. J. Korean Soc. Food Nutr. 1996, 25, 588–592. [Google Scholar]
  16. Rhee, H.J.; Koh, M.S.; Choi, O.J. Volatile constituents of Oenanthe javanica according to extraction and heating methods. Korean J. Soc. Food Sci. 1995, 11, 386–395. [Google Scholar]
  17. Seo, W.H.; Hyung, H.B. Identification of aroma-active compounds from Oenanthe javanica. J. Agric. Food Chem. 2005, 53, 6766–6770. [Google Scholar] [CrossRef] [PubMed]
  18. Han, X.; Guo, J.; Deng, W.; Zang, C.; Du, P.; Shi, T.; Ma, D. High-throughput cell-based screening reveals ZNF131 as a repressor of ERα signaling. BMC Genom. 2008, 9, 476. [Google Scholar] [CrossRef]
  19. Huolopalathi, R.; Linko, R.R. Aroma compounds in dill (Anethum graveolens) at three growth stages. J. Agric. Food Chem. 1983, 31, 331–333. [Google Scholar]
  20. Song, G.S.; Kwon, Y.J. Volatile constituents of Oenanthe stolonifera DC. J. Korean Soc. Food Sci. Nutr. 1990, 19, 311–314. [Google Scholar]
  21. Guenther, E. The Essential Oils; Van Nostrand Co.: New York, NY, USA, 1965; Volume 6, p. 666. [Google Scholar]
  22. Grieve, M. A Modern Herbal; Leyel, C.F., Ed.; Hafner Publishing: New York, NY, USA, 1967; Volume 1, p. 264. [Google Scholar]
  23. Moerman, D. Native American Ethnobotany; Timber Press: Portland, OR, USA, 1998. [Google Scholar]
  24. Facciola, S. Cornucopia—A Source Book of Edible Plants; Kampong Publications: Vista, CA, USA, 1990. [Google Scholar]
  25. Pieroni, A.; Giusti, M.E.; de Pasquale, C.; Lenzarini, C.; Censorii, E.; Gonzáles-Tejero, M.R.; Sánchez-Rojas, C.P.; Ramiro-Gutiérrez, J.M.; Skoula, M.; Johnson, C.; et al. Circum-Mediterranean cultural heritage and medicinal plant uses in traditional animal healthcare: A field survey in eight selected areas within the RUBIA project. J. Ethnobiol. Ethnomed. 2006, 2, 16. [Google Scholar] [CrossRef]
  26. Hammer, K.; Carson, C.F.; Riley, T.V. In vitro activities of antifungal agents and Melaleuca alternifolia oil against Malassezia spp. Antimicrob. Agents Chemother. 2000, 44, 467–469. [Google Scholar] [CrossRef] [PubMed]
  27. Figueiredo, A.C.; Barroso, J.; Pedro, L.; Salgueiro, L.; Miguel, M.G.; Faleiro, M.L. Portuguese Thymbra and Thymus species volatiles: Chemical composition and biological activities. Curr. Pharm. Des. 2008, 14, 3120–3140. [Google Scholar] [CrossRef]
  28. Tavares, A.C.; Gonçalves, M.J.; Cruz, M.T.; Cavaleiro, C.; Lopes, M.C.; Canhoto, J.; Salgueiro, L.R. Essential oils from Distichoselinum tenuifolium: Cytotoxic, antifungal and anti-inflammatory properties. J. Ethnopharmacol. 2010, 130, 593. [Google Scholar] [CrossRef]
  29. Zuzarte, M.; Gonçalves, M.J.; Cruz, M.T.; Cavaleiro, C.; Canhoto, J.; Vaz, S.; Pinto, E.; Salgueiro, L. Lavandula luisieri as a source of antifungal drugs. Food Chem. 2012, 135, 1505–1510. [Google Scholar] [CrossRef]
  30. Pattiram, P.D.; Lasekan, O.; Tan, C.P.; Zaidul, I.S.M. Identification of the aroma-active constituents of the essential oils of Water Dropwort (Oenanthe javanica) and ‘Kacip Fatimah’ (Labisia pumila). Int. Food Res. J. 2011, 18, 1021–1026. [Google Scholar]
  31. Souilah, N.; Bendif, H.; Harir, M.; Benslama, A.; Harrar, A.; Djarti, L.; Akkal, S.; Medjroubi, K. Chemical composition of essential oil of the species Oenanthe fistulosa L. growing in Algeria. J. Complement. Med. Res. 2020, 11, 22–28. [Google Scholar] [CrossRef]
  32. Świątek, Ł.; Sieniawska, E.; Mahomoodally, M.F.; Sadeer, N.B.; Wojtanowski, K.K.; Rajtar, B.; Polz-Dacewicz, M.; Paksoy, M.Y.; Zengin, G. Phytochemical profile and biological activities of the extracts from two Oenanthe species (O. aquatica and O. silaifolia). Pharmaceuticals 2021, 15, 50. [Google Scholar] [CrossRef] [PubMed]
  33. Thuyen, N.T.B.; Thien, D.V.H.; Hoa, N.V.N.; Hang, P.T.; Luan, N.Q. Study on morphology, biological activities, and chemical compositions of Oenanthe javanica (Blume) DC. essential oil. Chem. Pap. 2025, 79, 437–445. [Google Scholar] [CrossRef]
  34. Evergetis, E.; Haroutounian, S.A. Exploitation of apiaceae family plants as valuable renewable source of essential oils containing crops for the production of fine chemicals. Ind. Crops Prod. 2014, 54, 70–77. [Google Scholar] [CrossRef]
  35. Kumar, R.; Singh, P. Assessment of antibacterial, antioxidant, cytotoxic properties and chemical composition of Oenanthe javanica (Blume) DC. essential oil. J. Herb. Med. 2025, 49, 100982. [Google Scholar] [CrossRef]
  36. Guo, S.; Nighot, M.; Al-Sadi, R.; Alhmoud, T.; Nighot, P.; Ma, T.Y. Lipopolysaccharide regulation of intestinal tight junction permeability is mediated by TLR4-dependent activation of FAK and MyD88. J. Immunol. 2015, 195, 4999–5010. [Google Scholar] [CrossRef] [PubMed]
  37. Dey, P. Targeting gut barrier dysfunction with phytotherapies: Effective strategy against chronic diseases. Pharmacol. Res. 2020, 161, 105135. [Google Scholar] [CrossRef] [PubMed]
  38. Ulluwishewa, D.; Anderson, R.C.; McNabb, W.C.; Moughan, P.J.; Wells, J.M.; Roy, N.C. Regulation of tight junction permeability by intestinal bacteria and dietary components. J. Nutr. 2011, 141, 769–776. [Google Scholar] [CrossRef] [PubMed]
  39. Abreu, M.T.; Vora, P.; Faure, E.; Thomas, L.S.; Knight, L.S.; Arditi, M. Decreased expression of Toll-like receptor-4 and MD-2 correlates with intestinal epithelial cell protection against dysregulated proinflammatory gene expression in response to bacterial lipopolysaccharide. J. Immunol. 2001, 167, 1609–1616. [Google Scholar] [CrossRef]
  40. Hornef, M.W.; Frisan, T.; Vandewalle, A.; Normark, S.; Richter-Dahlfors, A. Toll-like receptor 4 resides in the Golgi apparatus and colocalizes with internalized lipopolysaccharide in intestinal epithelial cells. J. Exp. Med. 2002, 195, 559–570. [Google Scholar] [CrossRef]
  41. Fukata, M.; Chen, A.; Vamadevan, A.S.; Zhu, J.; Krishnareddy, S.; Thomas, L.S.; Maiguel, R.; Simmons, R.K.; Hoffman, R.M.; Abreu, M.T. Toll-like receptor-4 promotes the development of colitis-associated colorectal tumors. Gastroenterology 2007, 133, 1869–1881. [Google Scholar] [CrossRef]
  42. Bakshi, J.; Mishra, K.P. Sodium butyrate prevents LPS-induced inflammation and restores tight junction protein expression in human epithelial Caco-2 cells. Cell. Immunol. 2025, 408, 104912. [Google Scholar] [CrossRef]
  43. Wei, C.X.; Wu, J.-H.; Huang, Y.-H.; Wang, X.-Z.; Li, J.-Y. Lactobacillus plantarum protects against LPS-induced damage in Caco-2 cells via NF-κB inhibition. PLoS ONE 2022, 17, e0267831. [Google Scholar] [CrossRef]
  44. Zhang, S.; Zhou, Q.; Li, Y.; Zhang, Y.; Wu, Y. MitoQ modulates LPS-induced intestinal barrier dysfunction via Nrf2 signaling. Mediat. Inflamm. 2020, 2020, 3276148. [Google Scholar] [CrossRef]
  45. Thapa, D.; Richardson, A.J.; Zweifel, B.; Wallace, R.J.; Gratz, S.W. Genoprotective effects of essential oil compounds against oxidative and methylated DNA damage in human colon cancer cells. J. Food Sci. 2019, 84, 1979–1985. [Google Scholar] [CrossRef]
  46. Raka, R.N.; Zhiqian, D.; Yue, Y.; Luchang, Q.; Suyeon, P.; Junsong, X.; Hua, W. Pingyin rose essential oil alleviates LPS-induced inflammation in RAW264.7 cells via the NF-κB pathway. BMC Complement. Med. Ther. 2022, 22, 272. [Google Scholar] [CrossRef]
  47. Russo, R.; Corasaniti, M.T.; Bagetta, G.; Morrone, L.A. Exploitation of cytotoxicity of essential oils for translation in cancer therapy. Evid. Based Complement. Alternat. Med. 2015, 2015, 397821. [Google Scholar] [CrossRef]
  48. Avola, R.; Granata, G.; Geraci, C.; Napoli, E.; Graziano, A.C.E.; Cardile, V. Oregano (Origanum vulgare L.) essential oil provides anti-inflammatory activity and facilitates wound healing in a human keratinocytes cell model. Food Chem. Toxicol. 2020, 141, 111586. [Google Scholar] [CrossRef]
  49. Avola, R.; Graziano, A.C.E.; Pannuzzo, G.; Bonina, F.; Cardile, V. Hydroxytyrosol prevents blue-light-induced damage in human keratinocytes and fibroblasts. J. Cell. Physiol. 2019, 234, 27584. [Google Scholar] [CrossRef]
  50. Coêlho, M.L.; Islam, M.T.; Laylson da Silva Oliveira, G.; Oliveira Barros de Alencar, M.V.; Victor de Oliveira Santos, J.; Campinho Dos Reis, A.; Oliveira Ferreira da Mata, A.M.; Correia Jardim Paz, M.F.; Docea, A.O.; Calina, D.; et al. Cytotoxic and Antioxidant Properties of Natural Bioactive Monoterpenes Nerol, Estragole, and 3,7-Dimethyl-1-Octanol. Adv. Pharmacol. Pharm. Sci. 2022, 23, 8002766. [Google Scholar] [CrossRef] [PubMed]
  51. Wei, P.-L.; Tu, S.-H.; Lien, H.-M.; Chen, L.-C.; Chen, C.-S.; Wu, C.-H.; Huang, C.-S.; Chang, H.-W.; Chang, C.-H.; Tseng, H.; et al. The in vivo antitumor effects on human COLO 205 cancer cells of the 4,7-dimethoxy-5-(2-propen-1-yl)-1,3-benzodioxole (apiole) derivative of 5-substituted 4,7-dimethoxy-5-methyl-1,3-benzodioxole (SY-1) isolated from the fruiting body of Antrodia camphorata. J. Cancer Res. Ther. 2013, 9, 9–16. [Google Scholar]
  52. Bergau, N.; Herfurth, U.M.; Sachse, B.; Abraham, K.; Monien, B.H. Bioactivation of estragole and anethole leads to common adducts in DNA and hemoglobin. Food Chem. Toxicol. 2021, 153, 112253. [Google Scholar] [CrossRef] [PubMed]
  53. Cioffi, F.; Adam, R.H.I.; Bansal, R.; Broersen, K. A Review of Oxidative Stress Products and Related Genes in Early Alzheimer’s Disease. J. Alzheimers Dis. 2021, 83, 977–1001. [Google Scholar] [CrossRef]
  54. Farhangkhoee, H.; Khan, Z.A.; Mukherjee, S.; Cukiernik, M.; Barbin, Y.P.; Karmazyn, M.; Chakrabarti, S. Heme oxygenase in diabetes-induced oxidative stress in the heart. J. Mol. Cell. Cardiol. 2003, 35, 1439–1448. [Google Scholar] [CrossRef]
  55. Liu, S.; Liu, J.; Wang, Y.; Deng, F.; Deng, Z. Oxidative Stress: Signaling Pathways, Biological Functions, and Disease. MedComm 2025, 6, e70268. [Google Scholar] [CrossRef]
  56. Strzalka, W.; Ziemienowicz, A. Proliferating cell nuclear antigen (PCNA): A key factor in DNA replication and cell cycle regulation. Acta Biochim. Pol. 2011, 58, 479–487. [Google Scholar] [CrossRef] [PubMed]
  57. Waga, S.; Stillman, B. The DNA replication fork in eukaryotic cells. Annu. Rev. Biochem. 1998, 67, 721–751. [Google Scholar] [CrossRef]
  58. Christensen, L.P.; Brandt, K. Bioactive polyacetylenes in food plants of the Apiaceae family: Occurrence, bioactivity and analysis. J. Pharm. Biomed. Anal. 2006, 41, 683–693. [Google Scholar] [CrossRef] [PubMed]
  59. Christensen, L.P. Aliphatic C17-polyacetylenes of the falcarinol type as potential health promoting compounds in food plants of the Apiaceae family. Recent Pat. Food Nutr. Agric. 2011, 3, 64–77. [Google Scholar] [CrossRef] [PubMed]
  60. Wyrembek, P.; Negri, R.; Appendino, G.; Mozrzymas, J.W. Inhibitory effects of oenanthotoxin analogues on GABAergic currents depend on polyacetylenes’ polarity. Eur. J. Pharmacol. 2012, 681, 22–29. [Google Scholar]
  61. Lee, M.R.; Dukan, E.; Milne, I. Three poisonous plants (Oenanthe, Cicuta and Anamirta) that antagonise the effect of γ-aminobutyric acid. J. R. Coll. Physicians Edinb. 2020, 50, 80–86. [Google Scholar] [CrossRef]
  62. Henry, F.J.; Cadiet, J.; Javaudin, F.; Rozec, B. Oenanthe crocata: A case report of multiple poisoning with fatal outcome. J. Emerg. Med. 2020, 59, e9–e11. [Google Scholar] [CrossRef]
  63. Zidorn, C.; Jöhrer, K.; Ganzera, M.; Schubert, B.; Sigmund, E.M.; Mader, J.; Greil, R.; Ellmerer, E.P.; Stuppner, H. Polyacetylenes from the Apiaceae vegetables carrot, celery, fennel, parsley, and parsnip and their cytotoxic activities. J. Agric. Food Chem. 2005, 53, 2518–2523. [Google Scholar] [CrossRef]
  64. Cătunescu, G.M.; Bodea, I.M.; David, A.P.; Pop, C.R.; Rotar, A.M. Essential oils from Apiaceae family (parsley, lovage, and dill). In Essential Oils: Extraction, Characterization and Applications; Academic Press: Cambridge, MA, USA, 2023; pp. 241–308. [Google Scholar]
  65. European Pharmacopoeia. 2.8.12. Determination of Essential Oils in Herbal Drugs. 307. 10 March 2020. Available online: https://file.wuxuwang.com/yaopinbz/EP7/EP7.0_01__208.pdf (accessed on 10 October 2024).
  66. Vaglica, A.; Maggio, A.; Badalamenti, N.; Bruno, M.; Lauricella, M.; D’Anneo, A. Seseli bocconei Guss. and S. tortuosum subsp. maritimum Guss. essential oils inhibit colon cancer cell viability. Fitoterapia 2023, 170, 105672. [Google Scholar] [CrossRef]
  67. Russo, A.; Cardile, V.; Lombardo, L.; Vanella, L.; Vanella, A.; Garbarino, J.A. Antioxidant activity and antiproliferative action of methanolic extract of Geum quellyon Sweet roots in human tumor cell lines. J. Ethnopharmacol. 2005, 100, 323–332. [Google Scholar] [CrossRef]
  68. Madrid, A.; Avola, R.; Graziano, A.C.E.; Cardile, V.; Russo, A. Fabiana imbricata essential oil: ROS-dependent pro-apoptotic activity in prostate cancer cells. J. Ethnopharmacol. 2025, 352, 120162. [Google Scholar] [CrossRef]
  69. Cardile, V.; Avola, R.; Graziano, A.C.E.; Piovano, M.; Russo, A. Cytotoxicity of demalonylthyrsiflorin A, a labdane-derived diterpenoid, in melanoma cells. Toxicol. In Vitro 2018, 47, 274–280. [Google Scholar] [CrossRef] [PubMed]
  70. Albouchi, F.; Avola, R.; Dico, G.M.L.; Calabrese, V.; Graziano, A.C.E.; Abderrabba, M.; Cardile, V. Melaleuca styphelioides Sm. Polyphenols Modulate Interferon Gamma/Histamine-Induced Inflammation in Human NCTC 2544 Keratinocytes. Molecules 2018, 23, 2526. [Google Scholar] [CrossRef] [PubMed]
  71. Graziano, A.C.E.; Avola, R.; Pannuzzo, G.; Cardile, V. Aquaporin-1 and aquaporin-3 modulation during chondrogenic differentiation of human MSCs. J. Cell. Physiol. 2018, 233, 26100. [Google Scholar] [CrossRef] [PubMed]
Plants 15 00556 g001
Figure 1. Cell viability was assessed by mitochondrial-respiration-dependent 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT) assay in Caco-2 cells treated with lipopolysaccharide (LPS) at concentrations of 0, 1, 5, 10, 50, and 100 μg/mL for 24 (a) and 48 h (b). Optical density values measured at λ = 550 nm are expressed as percentages relative to untreated control cells, which were considered 100% viable. Each data point represents the mean ± standard deviation (SD) of three independent experiments, each performed in triplicate. * Significant versus untreated control; p < 0.05.
Figure 1. Cell viability was assessed by mitochondrial-respiration-dependent 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT) assay in Caco-2 cells treated with lipopolysaccharide (LPS) at concentrations of 0, 1, 5, 10, 50, and 100 μg/mL for 24 (a) and 48 h (b). Optical density values measured at λ = 550 nm are expressed as percentages relative to untreated control cells, which were considered 100% viable. Each data point represents the mean ± standard deviation (SD) of three independent experiments, each performed in triplicate. * Significant versus untreated control; p < 0.05.
Plants 15 00556 g001
Plants 15 00556 g002
Figure 2. Cell viability (%) was assessed by mitochondrial-respiration-dependent 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT) assay in Caco-2 cells treated with Oenanthe aquatica (OA), Oenanthe fistulosa (OF) or Oenanthe pimpinelloides (OP) at concentrations of 0, 12.5, 25, 50, and 100 μg/mL for 24 h. Optical density values measured at λ = 550 nm are expressed as percentages relative to untreated control cells, which were considered 100% viable. Each data point represents the mean ± standard deviation (SD) of three independent experiments, each performed in triplicate. * Significant versus untreated control; p < 0.05.
Figure 2. Cell viability (%) was assessed by mitochondrial-respiration-dependent 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT) assay in Caco-2 cells treated with Oenanthe aquatica (OA), Oenanthe fistulosa (OF) or Oenanthe pimpinelloides (OP) at concentrations of 0, 12.5, 25, 50, and 100 μg/mL for 24 h. Optical density values measured at λ = 550 nm are expressed as percentages relative to untreated control cells, which were considered 100% viable. Each data point represents the mean ± standard deviation (SD) of three independent experiments, each performed in triplicate. * Significant versus untreated control; p < 0.05.
Plants 15 00556 g002
Plants 15 00556 g003
Figure 3. Cell viability assessed by mitochondrial-respiration-dependent 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT) assay in Caco-2 cells untreated (control) or treated with lipopolysaccharide (LPS, 5 μg/mL) alone or in association with OA, OF, or OP at concentrations of 12.5 and 25 μg/mL for 24 h. Optical density values measured at λ = 550 nm are expressed as percentages relative to untreated control cells, which were considered 100% viable. Each data point represents the mean ± standard deviation (SD) of three independent experiments, each performed in triplicate. * Significant versus untreated control; ° significant versus lipopolysaccharide (LPS); p < 0.05.
Figure 3. Cell viability assessed by mitochondrial-respiration-dependent 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT) assay in Caco-2 cells untreated (control) or treated with lipopolysaccharide (LPS, 5 μg/mL) alone or in association with OA, OF, or OP at concentrations of 12.5 and 25 μg/mL for 24 h. Optical density values measured at λ = 550 nm are expressed as percentages relative to untreated control cells, which were considered 100% viable. Each data point represents the mean ± standard deviation (SD) of three independent experiments, each performed in triplicate. * Significant versus untreated control; ° significant versus lipopolysaccharide (LPS); p < 0.05.
Plants 15 00556 g003
Plants 15 00556 g004
Figure 4. Determination of 8-hydroxy-2′ -deoxyguanosine (8-OHdG) in Caco-2 cells untreated (control) or treated with lipopolysaccharide (LPS, 5 μg/mL) alone or in association with OA, OF or OP at concentrations of 12.5 and 25 μg/mL for 24 h measured spectrofluorometrically. The cell density was assayed by incubation with 40, 6-diamidino-2-phenylindole dihydrochloride (DAPI). Values are expressed as fold change versus untreated control of means ± standard deviation (SD) of relative fluorescence units of three separate experiments performed in triplicate. Each data point represents the mean ± standard deviation (SD) of three independent experiments, each performed in triplicate. * Significant versus untreated control; ° significant versus lipopolysaccharide (LPS); p < 0.05.
Figure 4. Determination of 8-hydroxy-2′ -deoxyguanosine (8-OHdG) in Caco-2 cells untreated (control) or treated with lipopolysaccharide (LPS, 5 μg/mL) alone or in association with OA, OF or OP at concentrations of 12.5 and 25 μg/mL for 24 h measured spectrofluorometrically. The cell density was assayed by incubation with 40, 6-diamidino-2-phenylindole dihydrochloride (DAPI). Values are expressed as fold change versus untreated control of means ± standard deviation (SD) of relative fluorescence units of three separate experiments performed in triplicate. Each data point represents the mean ± standard deviation (SD) of three independent experiments, each performed in triplicate. * Significant versus untreated control; ° significant versus lipopolysaccharide (LPS); p < 0.05.
Plants 15 00556 g004
Plants 15 00556 g005
Figure 5. Determination by reverse transcriptase-polymerase chain reaction (RT-PCR) (a) and Western blot (b) of heme oxygenase-1 (HO-1) Caco-2 cells untreated (control) or treated with lipopolysaccharide (LPS, 5 μg/mL) alone or in association with at OA, OF or OP concentrations of 12.5 and 25 μg/mL for 24 h expressed as 2−ΔΔCT ± standard deviation (SD) and as arbitrary densitometric units (A.D.U.) ± standard deviation (SD), respectively. Each data point represents the mean ± standard deviation (SD) of three independent experiments, each performed in triplicate. * Significant versus untreated control; ° significant versus lipopolysaccharide (LPS); p < 0.05.
Figure 5. Determination by reverse transcriptase-polymerase chain reaction (RT-PCR) (a) and Western blot (b) of heme oxygenase-1 (HO-1) Caco-2 cells untreated (control) or treated with lipopolysaccharide (LPS, 5 μg/mL) alone or in association with at OA, OF or OP concentrations of 12.5 and 25 μg/mL for 24 h expressed as 2−ΔΔCT ± standard deviation (SD) and as arbitrary densitometric units (A.D.U.) ± standard deviation (SD), respectively. Each data point represents the mean ± standard deviation (SD) of three independent experiments, each performed in triplicate. * Significant versus untreated control; ° significant versus lipopolysaccharide (LPS); p < 0.05.
Plants 15 00556 g005
Plants 15 00556 g006
Figure 6. Determination by reverse transcriptase-polymerase chain reaction (RT-PCR) (a) and Western blot (b) of proliferating cell nuclear antigen (PCNA) Caco-2 cells untreated (control) or treated with lipopolysaccharide (LPS, 5 μg/mL) alone or in association with OA, OF or OP at concentrations of 12.5 and 25 μg/mL for 24 h expressed as 2−ΔΔCT ± standard deviation (SD) and as arbitrary densitometric units (A.D.U.) ± standard deviation (SD), respectively. Each data point represents the mean ± standard deviation (SD) of three independent experiments, each performed in triplicate. * Significant versus untreated control; p < 0.05.
Figure 6. Determination by reverse transcriptase-polymerase chain reaction (RT-PCR) (a) and Western blot (b) of proliferating cell nuclear antigen (PCNA) Caco-2 cells untreated (control) or treated with lipopolysaccharide (LPS, 5 μg/mL) alone or in association with OA, OF or OP at concentrations of 12.5 and 25 μg/mL for 24 h expressed as 2−ΔΔCT ± standard deviation (SD) and as arbitrary densitometric units (A.D.U.) ± standard deviation (SD), respectively. Each data point represents the mean ± standard deviation (SD) of three independent experiments, each performed in triplicate. * Significant versus untreated control; p < 0.05.
Plants 15 00556 g006
Plants 15 00556 g007
Figure 7. Oenanthe aquatica (L.) Poir. collected in Sicily. Photo by Prof. Vincenzo Ilardi.
Figure 7. Oenanthe aquatica (L.) Poir. collected in Sicily. Photo by Prof. Vincenzo Ilardi.
Plants 15 00556 g007
Plants 15 00556 g008
Figure 8. Oenanthe fistulosa (L.) Poir. collected in Sicily. Photo by Prof. Vincenzo Ilardi.
Figure 8. Oenanthe fistulosa (L.) Poir. collected in Sicily. Photo by Prof. Vincenzo Ilardi.
Plants 15 00556 g008
Plants 15 00556 g009
Figure 9. Oenanthe pimpinelloides (L.) collected in Sicily. Photos by Prof. Vincenzo Ilardi.
Figure 9. Oenanthe pimpinelloides (L.) collected in Sicily. Photos by Prof. Vincenzo Ilardi.
Plants 15 00556 g009
Table 1. Chemical composition (%) of O. aquatica (OA), O. fistulosa (OF) and O. pimpinelloides (OP) EOs collected in Sicily, Italy.
Table 1. Chemical composition (%) of O. aquatica (OA), O. fistulosa (OF) and O. pimpinelloides (OP) EOs collected in Sicily, Italy.
No.Compounds aKI bKI cArea (%) d
OAOFOP
1Nonane9009000.1--
2Heptanal906902--0.1
3α-Thujene920924-0.10.1
4α-Pinene93593517.20.1-
5Camphene948954--0.1
6Sabinene9749756.59.3-
7β-Pinene9789842.5-2.1
8β-Myrcene9899902.34.63.0
9Octanal99910020.3--
10α-Phellandrene100310060.20.10.3
11α-Terpinene10111017-0.35.5
12Limonene102810256.3--
13β-Phellandrene10301032-8.212.8
14Sylvestrene10311032--5.8
15β-cis-Ocimene105110510.221.615.5
16β-trans-Ocimene106010610.18.410.3
17γ-Terpinene106510660.85.34.8
18Terpinolene10791086-0.1-
19Linalool10871091--0.2
20p-Cymenene10971098--0.2
21Nonanal11001100--0.1
22trans-Sabinene hydrate110111010.1--
23allo-Ocimene11311132-1.80.1
24trans-2-Nonenal11571162--0.1
254-Terpineol117311741.40.50.2
26α-Terpineol118411860.1-0.1
27Isothymol methyl ether12101212--0.1
28Citronellol122412250.1--
29Thymol methyl ether12301232--0.2
30trans-2-Decenal12601263--0.1
31neo-Isopulegyl acetate12701276t--
32Citronellyl acetate134513500.1--
33α-Copaene13701374--0.1
34β-Elemene13831389-7.9-
35β-Caryophyllene141714201.12.93.0
36γ-Elemene14191423--1.1
37α-trans-Bergamotene14251432-1.2-
38α-Humulene142714310.10.30.2
39β-cis-Farnesene14361442-1.61.0
40β-trans-Farnesene145114560.2--
41allo-Aromadendrene14571460-3.9-
42β-Selinene14821489-0.7-
43cis,trans-α-Farnesene14841483-1.20.8
44cis-β-Guaiene14891492-5.7-
45β-Bisabolene15031507-0.6-
46δ-Cadinene15111513-0.3-
47Myristicin151515193.46.11.2
48Germacrene B15591561--6.4
49Caryophyllene oxide15871589-0.30.2
50Dill apiol1619162253.5--
51α-Acorenol16331635-1.3-
52Apiole16761677-3.921.0
Monoterpene Hydrocarbons 36.159.960.6
Oxygenated Monoterpenes 1.80.50.8
Sesquiterpene Hydrocarbons 1.426.312.6
Oxygenated Sesquiterpenes -1.60.2
Others e 57.310.022.6
Total 96.698.396.8
a Components listed in order of elution on an DB-5 MS column; b experimental Kovats Indices (KIs) on a DB-5 MS non-polar column; c Kovats Indices based on the literature (https://webbook.nist.gov/ accessed on 10 December 2025); d percentage amounts of the separated compounds calculated from integration of single peaks; e this class includes alkanes, aldehydes, and phenylpropanoid compounds; t: traces (<0.05).
Table 2. RT-PCR primers list.
Table 2. RT-PCR primers list.
Primers Forward (5′ 3′) Reverse (5′ 3′)
HO-1CCAGGCAGAGAATGCTGAGTTCAAGACTGGGCTCTCCTTGTTGC
PCNAGTTCTCAAGGCACAGGTCTCGCAGGTCACTTATGTCACTTATC
GAPDHTCAACAGCGACACCCACGGGTCTCTCTCTTCCTCTTGTG
Table 3. Antibodies list.
Table 3. Antibodies list.
AntibodyCodeDilutionProduct
PCNAA300-277AM1:2000Bethyl Laboratories, Bologna, Italy
8-OHdGsc-3938701:200Santa Cruz Biotechnology, DBA, Milan, Italy
HO-1#700811:1000Cell Signaling Technology, Beverly, MA, USA
GAPDHsc-3650621:100Santa Cruz Biotechnology, DBA, Milan, Italy
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Vaglica, A.; Russo, A.; Ilardi, V.; Avola, R.; Bruno, M.; Badalamenti, N. Evaluation Profile of Sicilian Oenanthe aquatica (L.) Poir., O. fistulosa L. and O. pimpinelloides L. Essential Oils Under LPS-Induced Cellular Stress. Plants 2026, 15, 556. https://doi.org/10.3390/plants15040556

AMA Style

Vaglica A, Russo A, Ilardi V, Avola R, Bruno M, Badalamenti N. Evaluation Profile of Sicilian Oenanthe aquatica (L.) Poir., O. fistulosa L. and O. pimpinelloides L. Essential Oils Under LPS-Induced Cellular Stress. Plants. 2026; 15(4):556. https://doi.org/10.3390/plants15040556

Chicago/Turabian Style

Vaglica, Alessandro, Alessandra Russo, Vincenzo Ilardi, Rosanna Avola, Maurizio Bruno, and Natale Badalamenti. 2026. "Evaluation Profile of Sicilian Oenanthe aquatica (L.) Poir., O. fistulosa L. and O. pimpinelloides L. Essential Oils Under LPS-Induced Cellular Stress" Plants 15, no. 4: 556. https://doi.org/10.3390/plants15040556

APA Style

Vaglica, A., Russo, A., Ilardi, V., Avola, R., Bruno, M., & Badalamenti, N. (2026). Evaluation Profile of Sicilian Oenanthe aquatica (L.) Poir., O. fistulosa L. and O. pimpinelloides L. Essential Oils Under LPS-Induced Cellular Stress. Plants, 15(4), 556. https://doi.org/10.3390/plants15040556

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop