Hair Growth Stimulation Effect of Centipeda minima Extract: Identification of Active Compounds and Anagen-Activating Signaling Pathways
Abstract
1. Introduction
2. Materials and Methods
2.1. Antibodies and Reagents
2.2. Plant Materials and Preparation of CMX
2.3. High-Performance Liquid Chromatography (HPLC)
2.4. Cell Culture
2.5. Cell Viability Assay
2.6. RNA Isolation and Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.7. ELISA
2.8. Preparation of Cell Lysates and Immunoblotting
2.9. Immunofluorescence Staining
2.10. Assessment of Pharmacokinetic and Drug-Likeness Properties
2.11. Statistical Analyses
3. Results
3.1. Effect of CMX on the Proliferation of HFDPCs
3.2. CMX Increases the Expression of Genes Related to the WNT/β-Catenin Pathway in HFDPCs
3.3. CMX Enhances the Expression of Growth Factors Related to Hair Regeneration
3.4. CMX Activates Wnt/β-Catenin and ERK/JNK Signaling Pathways in HFDPCs
3.5. CMX Increases β-Catenin Localization in HFDPCs
3.6. Pharmacokinetic and Drug-Likeness Profiles of CMX
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chueh, S.C.; Lin, S.J.; Chen, C.C.; Lei, M.; Wang, L.M.; Widelitz, R. Therapeutic strategy for hair regeneration: Hair cycle activation, niche environment modulation, wound-induced follicle neogenesis, and stem cell engineering. Expert Opin. Biol. Ther. 2013, 13, 377–391. [Google Scholar] [CrossRef] [Scilit]
- Qi, J.; Garza, L.A. An overview of aloplecias. Cold Spring Harb. Perspect. Med. 2014, 4, a013615. [Google Scholar] [CrossRef] [Scilit]
- Courtois, M.; Loussouarn, G.; Hourseau, C.; Grollier, J.F. Hair cycle and alopecia. Skin Pharmacol. 1994, 7, 84–89. [Google Scholar] [CrossRef] [Scilit]
- Andl, T.; Reddy, S.T.; Gaddapara, T.; Millar, S.E. WNT signals are required for the initiation of hair follicle development. Dev. Cell 2002, 2, 643–653. [Google Scholar] [CrossRef] [Scilit]
- Sennett, R.; Rendl, M. Mesenchymal-epithelial interactions during hair follicle morphogenesis and cycling. Semin. Cell Dev. Biol. 2012, 23, 917–927. [Google Scholar] [CrossRef] [Scilit]
- Morgan, B.A. The dermal papilla: An instructive niche for epithelial stem and progenitor cells in development and regeneration of the hair follicle. Cold Spring Harb. Perspect. Med. 2014, 4, a015180. [Google Scholar] [CrossRef] [Scilit]
- Choi, B.Y. Targeting Wnt/β-Catenin Pathway for Developing Therapies for Hair Loss. Int. J. Mol. Sci. 2020, 21, 4915. [Google Scholar] [CrossRef] [Scilit]
- Liang, H.; Bao, F.; Dong, X.; Tan, R.; Zhang, C.; Lu, Q.; Cheng, Y. Antibacterial Thymol Derivatives Isolated from Centipeda Minima. Molecules 2007, 12, 1606–1613. [Google Scholar] [CrossRef] [Scilit]
- Chan, C.O.; Jin, D.P.; Dong, N.P.; Chen, S.B.; Mok, D.K. Qualitative and quantitative analysis of chemical constituents of Centipeda minima by HPLC-QTOF-MS & HPLC-DAD. J. Pharm. Biomed. Anal. 2016, 125, 400–407. [Google Scholar] [PubMed]
- Linh, N.T.T.; Ha, N.T.T.; Tra, N.T.; Anh, L.T.T.; Tuyen, N.V.; Son, N.T. Medicinal Plant Centipeda Minima: A Resource of Bioactive Compounds. Mini Rev. Med. Chem. 2021, 20, 273–287. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, B.H.; Lee, W.-Y.; Trinh, T.A.; Pyo, J.S.; Lee, S.; Kim, C.-E.; Lee, D.H.; Park, E.-S.; Kang, K.S. Hair Growth Effect of Emulsion Extracted Brevilin A, a JAK3 Inhibitor, from Centipeda minima. Processes 2020, 8, 767. [Google Scholar] [CrossRef] [Scilit]
- Rishikaysh, P.; Dev, K.; Diaz, D.; Qureshi, W.M.; Filip, S.; Mokry, J. Signaling involved in hair follicle morphogenesis and development. Int. J. Mol. Sci. 2014, 15, 1647–1670. [Google Scholar] [CrossRef] [Scilit]
- Hong, S.-h.; Hwang, H.-J.; Kim, J.W.; Kim, J.A.; Lee, Y.B.; Roh, E.; Choi, K.M.; Baik, S.H.; Yoo, H.J. Ginsenoside compound-Mc1 attenuates oxidative stress and apoptosis in cardiomyocytes through an AMP-activated protein kinase–dependent mechanism. J. Ginseng Res. 2020, 44, 664–671. [Google Scholar] [CrossRef] [Scilit]
- Hoa, H.T.; Thu, N.T.; Dong, N.T.; Oanh, T.T.; Hien, T.T.; Ha, D.T. Effects of compounds from Physalis angulata on fatty acid synthesis and glucose metabolism in HepG2 cells via the AMP-activated protein kinase pathway. Nat. Prod. Sci. 2020, 26, 200–206. [Google Scholar]
- Ryu, Y.-S.; Hyun, J.-W.; Chung, H.-S. Fucoidan induces apoptosis in A2058 cells through ROS-exposed activation of MAPKs signaling pathway. Nat. Prod. Sci. 2020, 26, 191–199. [Google Scholar]
- Wadood, A.; Ghufran, M.; Hassan, S.F.; Khan, H.; Azam, S.S.; Rashid, U. In silico identification of promiscuous scaffolds as potential inhibitors of 1-deoxy-d-xylulose 5-phosphate reductoisomerase for treatment of Falciparum malaria. Pharm. Biol. 2017, 55, 19–32. [Google Scholar] [CrossRef] [Scilit]
- Dong, L.; Hao, H.; Xia, L.; Liu, J.; Ti, D.; Tong, C.; Hou, Q.; Han, Q.; Zhao, Y.; Liu, H.; et al. Treatment of MSCs with Wnt1a-conditioned medium activates DP cells and promotes hair follicle regrowth. Sci. Rep. 2014, 4, 5432. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mitsul, S.; Ohuchi, A.; Hotta, M.; Tsuboi, R.; Ogawa, H. Genes for a range of growth factors and cyclin-dependent kinase inhibitors are expressed by isolated human hair follicles. Br. J. Dermatol. 1997, 137, 693–698. [Google Scholar] [CrossRef] [Scilit]
- DuCros, D.L. Fibroblast growth factor influences the development and cycling of murine hair follicles. Dev. Biol. 1993, 156, 444–453. [Google Scholar] [CrossRef] [Scilit]
- Kishimoto, J.; Burgeson, R.E.; Morgan, B.A. Wnt signaling maintains the hair-inducing activity of the dermal papilla. Genes Dev. 2000, 14, 1181–1185. [Google Scholar] [PubMed]
- Choi, B.Y. Hair-growth potential of ginseng and its major metabolites: A Review on its molecular mechanisms. Int. J. Mol. Sci. 2018, 19, 2703. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hwang, K.A.; Hwang, Y.L.; Lee, M.H.; Kim, N.R.; Roh, S.S.; Lee, Y.; Kim, C.D.; Lee, J.H.; Choi, K.C. Adenosine stimulates growth of dermal papilla and lengthens the anagen phase by increasing the cysteine level via fibroblast growth factors 2 and 7 in an organ culture of mouse vibrissae hair follicles. Int. J. Mol. Med. 2012, 29, 195–201. [Google Scholar] [PubMed]
- Manning, B.D.; Cantley, L. AKT/PKB Signaling: Navigating Downstream. Cell 2007, 129, 1261–1274. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lachgar, S.; Moukadiri, H.; Jonca, F.; Charveron, M.; Bouhaddioui, N.; Gall, Y.; Bonafe, J.L.; Plouët, J. Vascular endothelial growth factor is an autocrine growth factor for hair dermal papilla cells. J. Investig. Dermatol. 1996, 106, 17–23. [Google Scholar] [CrossRef] [Scilit]
- Millar, S.E. Molecular mechanisms regulating hair follicle development. J. Investig. Dermatol. 2002, 118, 216–225. [Google Scholar] [CrossRef] [Scilit]
- Cotsarelis, G. Epithelial stem cells: A folliculocentric view. J. Investig. Dermatol. 2006, 126, 1459–1468. [Google Scholar] [CrossRef] [Scilit]
- Vistoli, G.; Pedretti, A.; Testa, B. Assessing drug-likeness-what are we missing? Drug Discov. Today 2008, 13, 285–294. [Google Scholar] [CrossRef] [Scilit]
- Ito, M.; Yang, Z.; Andl, T.; Cui, C.; Kim, N.; Millar, S.E.; Cotsarelis, G. Wnt-dependent de novo hair follicle regeneration in adult mouse skin after wounding. Nature 2007, 447, 316–320. [Google Scholar] [CrossRef] [Scilit]
- Hsu, Y.C.; Pasolli, H.A.; Fuchs, E. Dynamics between stem cells, niche, and progeny in the hair follicle. Cell 2011, 144, 92–105. [Google Scholar] [CrossRef] [Scilit]
- Reddy, S.; Andl, T.; Bagasra, A.; Lu, M.M.; Epstein, D.J.; Morrisey, E.E.; Millar, S.E. Characterization of Wnt gene expression in developing and postnatal hair follicles and identification of Wnt5a as a target of Sonic hedgehog in hair follicle morphogenesis. Mech. Dev. 2001, 107, 69–82. [Google Scholar] [CrossRef] [Scilit]
- Lin, K.; Sze, S.C.-W.; Liu, B.; Zhang, Z.; Zhang, Z.; Zhu, P.; Wang, Y.; Deng, Q.; Yung, K.K.-L.; Zhang, S. 20(S)-protopanaxadiol and oleanolic acid ameliorate cognitive deficits in APP/PS1 transgenic mice by enhancing hippocampal neurogenesis. J. Ginseng Res. 2021, 45, 325–333. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Millar, S.E.; Willert, K.; Salinas, P.C.; Roelink, H.; Nusse, R.; Sussman, D.J.; Barsh, G.S. WNT signaling in the control of hair growth and structure. Dev. Biol. 1999, 207, 133–149. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rutberg, S.E.; Kolpak, M.L.; Gourley, J.A.; Tan, G.; Henry, J.P.; Shander, D. Differences in expression of specific biomarkers distinguish human beard from scalp dermal papilla cells. J. Investig. Dermatol. 2006, 126, 2583–2595. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, C.C.; Cotsarelis, G. Review of hair follicle dermal cells. J. Dermatol. Sci. 2010, 57, 2–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsai, S.Y.; Sennett, R.; Rezza, A.; Clavel, C.; Grisanti, L.; Zemla, R.; Najam, S.; Rendl, M. Wnt/β-catenin signaling in dermal condensates is required for hair follicle formation. Dev. Biol. 2014, 385, 179–188. [Google Scholar] [CrossRef] [Scilit]
- Yano, K.; Brown, L.F.; Detmar, M. Control of hair growth and follicle size by VEGF-mediated angiogenesis. J. Clin. Investig. 2001, 107, 409–417. [Google Scholar] [CrossRef] [Scilit]










| Target | Forward Primer | Reverse Primer |
|---|---|---|
| WNT5a | TCCACCTTCCTCTTCACACTGA | CGTGGCCAGCATCACATC |
| LEF1 | CAGTGACGAGCACTTTTCTC | CGTGATGGGATATACAGGCT |
| LRP5 | GCTGTACCCGCCGATCCT | GGCGCCATTCCTCGAAT |
| FZDR1 | CCAAGAGAGGAGCCGAGA | CGGCACAAAGTTCCCAG |
| WNT3a | CCTCAAGGACAAGTACGACA | GGCACCTTGAAGTAGGTGTA |
| VEGF | ATGACGAGGGCCTGGAGTGTA | CCTATGTGCTGGCCTTGGGA |
| GAPDH | GGTGGTCTCCTCTGACTTCAACA | GTTGCTGTAGCCAAATTCGTTGT |
| Arnicolide D | Arnicolide C | Microhelenin C | Brevilin A | |
|---|---|---|---|---|
| Contents (µg/g) | 147.5 | 39.8 | 45.7 | 400.5 |
| Arnicolide C | Arnicolide D | Brevilin A | Microhelenin C | |
|---|---|---|---|---|
| Pharmacokinetics | ||||
| GI absorption | High | High | High | High |
| CYP1A2 inhibitor | No | No | No | No |
| CYP2C19 inhibitor | No | No | No | No |
| CYP2C9 inhibitor | No | No | No | No |
| CYP2D6 inhibitor | No | No | No | No |
| CYP3A4 inhibitor | No | No | No | No |
| Log Kp (cm/s) | −6.81 | −6.86 | −6.78 | −6.78 |
| Drug-likeness | ||||
| Lipinski | 0 | 0 | 0 | 0 |
| Ghose | 0 | 0 | 0 | 0 |
| Veber | 0 | 0 | 0 | 0 |
| Egan | 0 | 0 | 0 | 0 |
| Muegge | 0 | 0 | 0 | 0 |
| Bioavailability score | 0.55 | 0.55 | 0.55 | 0.55 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, B.H.; Lee, M.J.; Lee, W.-Y.; Pyo, J.; Shin, M.-S.; Hwang, G.S.; Shin, D.; Kim, C.E.; Park, E.-S.; Kang, K.S. Hair Growth Stimulation Effect of Centipeda minima Extract: Identification of Active Compounds and Anagen-Activating Signaling Pathways. Biomolecules 2021, 11, 976. https://doi.org/10.3390/biom11070976
Kim BH, Lee MJ, Lee W-Y, Pyo J, Shin M-S, Hwang GS, Shin D, Kim CE, Park E-S, Kang KS. Hair Growth Stimulation Effect of Centipeda minima Extract: Identification of Active Compounds and Anagen-Activating Signaling Pathways. Biomolecules. 2021; 11(7):976. https://doi.org/10.3390/biom11070976
Chicago/Turabian StyleKim, Byoung Ha, Myong Jin Lee, Won-Yung Lee, Jaesung Pyo, Myoung-Sook Shin, Gwi Seo Hwang, Dongchul Shin, Chang Eop Kim, Eun-Seok Park, and Ki Sung Kang. 2021. "Hair Growth Stimulation Effect of Centipeda minima Extract: Identification of Active Compounds and Anagen-Activating Signaling Pathways" Biomolecules 11, no. 7: 976. https://doi.org/10.3390/biom11070976
APA StyleKim, B. H., Lee, M. J., Lee, W.-Y., Pyo, J., Shin, M.-S., Hwang, G. S., Shin, D., Kim, C. E., Park, E.-S., & Kang, K. S. (2021). Hair Growth Stimulation Effect of Centipeda minima Extract: Identification of Active Compounds and Anagen-Activating Signaling Pathways. Biomolecules, 11(7), 976. https://doi.org/10.3390/biom11070976

