The Pseudotyped Replication-Deficient VSV with Spike from PEDV Induces Neutralizing Antibody Against PEDV
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Lines, Viruses, and Antibodies
2.2. Plasmid Construction
2.3. Production and Concentration of Lentivirus
2.4. Lentivirus Transduction and Cell Line Establishment
2.5. Indirect Immunofluorescence Assay
2.6. Recovery of rVSVΔG-PEDV-S
2.7. RT-qPCR for rVSVΔG-PEDV-S Titration
2.8. Western Blotting
2.9. Animal Experiments
2.10. Enzyme-Linked Immunosorbent Assay (ELISA)
2.11. Neutralization Assay
2.12. Statistical Analyses
3. Results
3.1. Generation and Characterization of PEDV Spike-Expressing Stable Huh7 Cell Line
3.2. Generation of Replication-Deficient PEDV S Pseudotyped Virus rVSVΔG-PEDV-S
3.3. rVSVΔG-PEDV-S Induces CPE in PEDV Susceptible Cell Lines
3.4. rVSV∆G-PEDV-S Could Replicate in Huh7-PEDV-S Cells
3.5. Vaccination of C57BL/6 Mice with rVSV∆G-PEDV-S Induced Neutralizing Antibodies Against PEDV
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jung, K.; Saif, L.J.; Wang, Q. Porcine epidemic diarrhea virus (PEDV): An update on etiology, transmission, pathogenesis, and prevention and control. Virus Res. 2020, 286, 198045. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Chen, Y.; Han, X.; Yu, Z.; Wei, Y.; Zhang, G. Porcine epidemic diarrhea virus in Asia: An alarming threat to the global pig industry. Infect. Genet. Evol. 2019, 70, 24–26. [Google Scholar] [CrossRef]
- Niu, X.; Wang, Q. Prevention and Control of Porcine Epidemic Diarrhea: The Development of Recombination-Resistant Live Attenuated Vaccines. Viruses 2022, 14, 1317. [Google Scholar] [CrossRef]
- Shirato, K.; Maejima, M.; Matsuyama, S.; Ujike, M.; Miyazaki, A.; Takeyama, N.; Ikeda, H.; Taguchi, F. Mutation in the cytoplasmic retrieval signal of porcine epidemic diarrhea virus spike (S) protein is responsible for enhanced fusion activity. Virus Res. 2011, 161, 188–193. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Van Kuppeveld, F.J.M.; He, Q.; Rottier, P.J.M.; Bosch, B.-J. Cellular entry of the porcine epidemic diarrhea virus. Virus Res. 2016, 226, 117–127. [Google Scholar] [CrossRef]
- Oka, T.; Saif, L.J.; Marthaler, D.; Esseili, M.A.; Meulia, T.; Lin, C.-M.; Vlasova, A.N.; Jung, K.; Zhang, Y.; Wang, Q. Cell culture isolation and sequence analysis of genetically diverse US porcine epidemic diarrhea virus strains including a novel strain with a large deletion in the spike gene. Vet. Microbiol. 2014, 173, 258–269. [Google Scholar] [CrossRef] [PubMed]
- Chen, F.; Zhu, Y.; Wu, M.; Ku, X.; Ye, S.; Li, Z.; Guo, X.; He, Q. Comparative Genomic Analysis of Classical and Variant Virulent Parental/Attenuated Strains of Porcine Epidemic Diarrhea Virus. Viruses 2015, 7, 5525–5538. [Google Scholar] [CrossRef]
- Baek, P.-S.; Choi, H.-W.; Lee, S.; Yoon, I.-J.; Lee, Y.J.; Lee, D.S.; Lee, S.; Lee, C. Efficacy of an inactivated genotype 2b porcine epidemic diarrhea virus vaccine in neonatal piglets. Vet. Immunol. Immunopathol. 2016, 174, 45–49. [Google Scholar] [CrossRef] [PubMed]
- Chang, Y.-C.; Chang, C.-Y.; Tsai, P.-S.; Chiou, H.-Y.; Jeng, C.-R.; Pang, V.F.; Chang, H.-W. Efficacy of heat-labile enterotoxin B subunit-adjuvanted parenteral porcine epidemic diarrhea virus trimeric spike subunit vaccine in piglets. Appl. Microbiol. Biotechnol. 2018, 102, 7499–7507. [Google Scholar] [CrossRef]
- Sato, T.; Takeyama, N.; Katsumata, A.; Tuchiya, K.; Kodama, T.; Kusanagi, K.-I. Mutations in the spike gene of porcine epidemic diarrhea virus associated with growth adaptation in vitro and attenuation of virulence in vivo. Virus Genes 2011, 43, 72–78. [Google Scholar] [CrossRef] [PubMed]
- Song, D.S.; Oh, J.S.; Kang, B.K.; Yang, J.S.; Moon, H.J.; Yoo, H.S.; Jang, Y.S.; Park, B.K. Oral efficacy of Vero cell attenuated porcine epidemic diarrhea virus DR13 strain. Res. Vet. Sci. 2007, 82, 134–140. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Yu, R.; Wang, L.; Zhang, Z.; Lu, Y.; Zhou, P.; Wang, Y.; Guo, H.; Pan, L.; Liu, X. Serial cell culture passaging in vitro led to complete attenuation and changes in the characteristic features of a virulent porcine deltacoronavirus strain. J. Virol. 2024, 98, e0064524. [Google Scholar] [CrossRef]
- Lee, S.; Son, K.Y.; Noh, Y.H.; Lee, S.C.; Choi, H.W.; Yoon, I.J.; Lee, C. Genetic characteristics, pathogenicity, and immunogenicity associated with cell adaptation of a virulent genotype 2b porcine epidemic diarrhea virus. Vet. Microbiol. 2017, 207, 248–258. [Google Scholar] [CrossRef] [PubMed]
- Collin, E.A.; Anbalagan, S.; Okda, F.; Batman, R.; Nelson, E.; Hause, B.M. An inactivated vaccine made from a U.S. field isolate of porcine epidemic disease virus is immunogenic in pigs as demonstrated by a dose-titration. BMC Vet. Res. 2015, 11, 62. [Google Scholar] [CrossRef] [PubMed]
- Park, J.-E. Porcine Epidemic Diarrhea: Insights and Progress on Vaccines. Vaccines 2024, 12, 212. [Google Scholar] [CrossRef] [PubMed]
- Ke, Y.; Yu, D.; Zhang, F.; Gao, J.; Wang, X.; Fang, X.; Wang, H.; Sun, T. Recombinant vesicular stomatitis virus expressing the spike protein of genotype 2b porcine epidemic diarrhea virus: A platform for vaccine development against emerging epidemic isolates. Virology 2019, 533, 77–85. [Google Scholar] [CrossRef]
- Whitt, M.A. Generation of VSV pseudotypes using recombinant DeltaG-VSV for studies on virus entry, identification of entry inhibitors, and immune responses to vaccines. J. Virol. Methods 2010, 169, 365–374. [Google Scholar] [CrossRef] [PubMed]
- Lawson, N.D.; Stillman, E.A.; Whitt, M.A.; Rose, J.K. Recombinant vesicular stomatitis viruses from DNA. Proc. Natl. Acad. Sci. USA 1995, 92, 4477–4481. [Google Scholar] [CrossRef] [PubMed]
- Ao, Z.; Ouyang, M.J.; Olukitibi, T.A.; Warner, B.; Vendramelli, R.; Truong, T.; Meilleur, C.; Zhang, M.; Kung, S.; Fowke, K.R.; et al. A Recombinant VSV-Based Bivalent Vaccine Effectively Protects against Both SARS-CoV-2 and Influenza A Virus Infection. J. Virol. 2022, 96, e01337-22. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Zhang, Z.-R.; Zhang, Y.-N.; Liu, J.; Deng, C.-L.; Shi, P.-Y.; Yuan, Z.-M.; Ye, H.-Q.; Zhang, B. A replication-defective Japanese encephalitis virus (JEV) vaccine candidate with NS1 deletion confers dual protection against JEV and West Nile virus in mice. npj Vaccines 2020, 5, 73. [Google Scholar] [CrossRef]
- Li, N.; Deng, C.-L.; Li, Q.; Chen, X.-L.; Zhang, B.; Ye, H.-Q. A safe replication-defective Zika virus vaccine protects mice from viral infection and vertical transmission. Antivir. Res. 2023, 211, 105549. [Google Scholar] [CrossRef] [PubMed]
- Malherbe, D.C.; Kurup, D.; Wirblich, C.; Ronk, A.J.; Mire, C.; Kuzmina, N.; Shaik, N.; Periasamy, S.; Hyde, M.A.; Williams, J.M.; et al. A single dose of replication-competent VSV-vectored vaccine expressing SARS-CoV-2 S1 protects against virus replication in a hamster model of severe COVID-19. npj Vaccines 2021, 6, 91. [Google Scholar] [CrossRef]
- Suder, E.; Furuyama, W.; Feldmann, H.; Marzi, A.; de Wit, E. The vesicular stomatitis virus-based Ebola virus vaccine: From concept to clinical trials. Hum. Vaccines Immunother. 2018, 14, 2107–2113. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, S.E.; Cross, R.W.; Fenton, K.A.; Bente, D.A.; Mire, C.E.; Geisbert, T.W. Vesicular Stomatitis Virus-Based Vaccine Protects Mice against Crimean-Congo Hemorrhagic Fever. Sci. Rep. 2019, 9, 7755. [Google Scholar] [CrossRef]
- Monath, T.P.; Fast, P.E.; Modjarrad, K.; Clarke, D.K.; Martin, B.K.; Fusco, J.; Nichols, R.; Heppner, D.G.; Simon, J.K.; Dubey, S.; et al. rVSVΔG-ZEBOV-GP (also designated V920) recombinant vesicular stomatitis virus pseudotyped with Ebola Zaire Glycoprotein: Standardized template with key considerations for a risk/benefit assessment. Vaccine X 2019, 1, 100009. [Google Scholar] [CrossRef]
- Li, M.; Pan, Y.; Xi, Y.; Wang, M.; Zeng, Q. Insights and progress on epidemic characteristics, genotyping, and preventive measures of PEDV in China: A review. Microb. Pathog. 2023, 181, 106185. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Fang, L.; Xiao, S. Porcine epidemic diarrhea in China. Virus Res. 2016, 226, 7–13. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Chen, Y.; Zhou, J.; Wang, X.; Ma, L.; Li, J.; Yang, L.; Yuan, H.; Pang, D.; Ouyang, H. Porcine Epidemic Diarrhea Virus: An Updated Overview of Virus Epidemiology, Virulence Variation Patterns and Virus–Host Interactions. Viruses 2022, 14, 2434. [Google Scholar] [CrossRef] [PubMed]
- Niu, X.; Liu, M.; Yang, S.; Xu, J.; Hou, Y.J.; Liu, D.; Tang, Q.; Zhu, H.; Wang, Q. A recombination-resistant genome for live attenuated and stable PEDV vaccines by engineering the transcriptional regulatory sequences. J. Virol. 2023, 97, e0119323. [Google Scholar] [CrossRef]
- Song, S.; Park, G.-N.; Shin, J.; Kim, K.-S.; An, B.-H.; Choe, S.; Kim, S.-Y.; Hyun, B.-H.; An, D.-J. Rescue of a Live-Attenuated Porcine Epidemic Diarrhea Virus HSGP Strain Using a Virulent Strain and a Partially Attenuated Strain. Viruses 2023, 15, 1601. [Google Scholar] [CrossRef]
- Wang, H.; Zhang, L.; Shang, Y.; Tan, R.; Ji, M.; Yue, X.; Wang, N.; Liu, J.; Wang, C.; Li, Y.; et al. Emergence and evolution of highly pathogenic porcine epidemic diarrhea virus by natural recombination of a low pathogenic vaccine isolate and a highly pathogenic strain in the spike gene. Virus Evol. 2020, 6, veaa049. [Google Scholar] [CrossRef] [PubMed]
- Coughlan, L.; Kremer, E.J.; Shayakhmetov, D.M. Adenovirus-based vaccines—A platform for pandemic preparedness against emerging viral pathogens. Mol. Ther. 2022, 30, 1822–1849. [Google Scholar] [CrossRef] [PubMed]
- Larkin, H.D. Progress on Replication-Defective Live Virus Vaccines. JAMA 2022, 328, 1387. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Zhang, Y.; Li, D.; Deng, Y.-Q.; Xu, H.; Zhao, C.; Liu, J.; Wen, D.; Zhao, J.; Li, Y.; et al. Enhanced protective immunity against SARS-CoV-2 elicited by a VSV vector expressing a chimeric spike protein. Signal Transduct. Target. Ther. 2021, 6, 389. [Google Scholar] [CrossRef] [PubMed]
- Qiu, X.; Fernando, L.; Alimonti, J.B.; Melito, P.L.; Feldmann, F.; Dick, D.; Ströher, U.; Feldmann, H.; Jones, S.M. Mucosal Immunization of Cynomolgus Macaques with the VSVΔG/ZEBOVGP Vaccine Stimulates Strong Ebola GP-Specific Immune Responses. PLoS ONE 2009, 4, e5547. [Google Scholar] [CrossRef]
- Dong, F.; Li, D.; Wen, D.; Li, S.; Zhao, C.; Qi, Y.; Jangra, R.K.; Wu, C.; Xia, D.; Zhang, X.; et al. Single dose of a rVSV-based vaccine elicits complete protection against severe fever with thrombocytopenia syndrome virus. npj Vaccines 2019, 4, 5. [Google Scholar] [CrossRef]
- Luo, H.; Lv, L.; Yi, J.; Zhou, Y.; Liu, C. Establishment of Replication Deficient Vesicular Stomatitis Virus for Studies of PEDV Spike-Mediated Cell Entry and Its Inhibition. Microorganisms 2023, 11, 2075. [Google Scholar] [CrossRef]
- Zhang, M.; Lv, L.; Luo, H.; Cai, H.; Yu, L.; Jiang, Y.; Gao, F.; Tong, W.; Li, L.; Li, G.; et al. The CD2v protein of African swine fever virus inhibits macrophage migration and inflammatory cytokines expression by downregulating EGR1 expression through dampening ERK1/2 activity. Vet. Res. 2023, 54, 106. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Banister, C.E.; Weige, C.C.; Altomare, D.; Richardson, J.H.; Contreras, C.M.; Buckhaults, P.J. PRDM1 silences stem cell-related genes and inhibits proliferation of human colon tumor organoids. Proc. Natl. Acad. Sci. USA 2018, 115, E5066–E5075. [Google Scholar] [CrossRef]
- Taddeo, A.; Veiga, I.B.; Devisme, C.; Boss, R.; Plattet, P.; Weigang, S.; Kochs, G.; Thiel, V.; Benarafa, C.; Zimmer, G. Optimized intramuscular immunization with VSV-vectored spike protein triggers a superior immune response to SARS-CoV-2. npj Vaccines 2022, 7, 82. [Google Scholar] [CrossRef]
- Garbutt, M.; Liebscher, R. Properties of Replication-Competent Vesicular Stomatitis Virus Vectors Expressing Glycoproteins of Filoviruses and Arenaviruses. J. Virol. 2004, 78, 5458–5465. [Google Scholar] [CrossRef] [PubMed]
- Van Den Braak, W.J.P.; Monica, B.; Limpens, D.; Rockx-Brouwer, D.; De Boer, M.; Oosterhoff, D. Construction of a Vero Cell Line Expressing Human ICAM1 for the Development of Rhinovirus Vaccines. Viruses 2022, 14, 2235. [Google Scholar] [CrossRef]
- Wang, J.; Hu, R.; Wang, Z.; Guo, Y.; Wang, S.; Zou, H.; Peng, Q.; Jiang, Y. Establishment of Immortalized Yak Ruminal Epithelial Cell Lines by Lentivirus-Mediated SV40T and hTERT Gene Transduction. Oxidative Med. Cell. Longev. 2022, 2022, 8128028. [Google Scholar] [CrossRef] [PubMed]
- Lv, L.; Luo, H.; Yu, L.; Tong, W.; Jiang, Y.; Li, G.; Tong, G.; Li, Y.; Liu, C. Identification and Characterization of Cell Lines HepG2, Hep3B217 and SNU387 as Models for Porcine Epidemic Diarrhea Coronavirus Infection. Viruses 2022, 14, 2754. [Google Scholar] [CrossRef] [PubMed]
- Yahalom-Ronen, Y.; Tamir, H.; Melamed, S.; Politi, B.; Shifman, O.; Achdout, H.; Vitner, E.B.; Israeli, O.; Milrot, E.; Stein, D.; et al. A single dose of recombinant VSV-∆G-spike vaccine provides protection against SARS-CoV-2 challenge. Nat. Commun. 2020, 11, 6402. [Google Scholar] [CrossRef] [PubMed]





| Oligo Name | Sequence (5′-3′) | Purpose |
|---|---|---|
| VSV-EcoRV_F | CATATGAAAAAAACTAACAGA | pVSV∆G |
| VSV-EcoRV_R1 | ACTCGAGCCCGGGACGCGTAGG TGTCAAGGAAACAGATCGAT | pVSV∆G |
| VSV-EcoRV_R2 | GTTCAAACATGAAGAATCTGTTGTGCA GGATTTGAACTCGAGCCCGGGACGCGTA | pVSV∆G |
| VSV-EcoRV_R3 | AAGGCCTCTTTGAGCATGATATCAC AAGTTGATTTGGTTCAAACATGAAGAAT | pVSV∆G |
| qPCR-VSV-N_F | CAAATGATGCTTCCAGGCCA | Virus titer |
| qPCR-VSV-N_R | CAATGTCATCAGGCTGTCGG | Virus titer |
| Group | Inoculum | Routes | Immunization Dose | Immunization Days |
|---|---|---|---|---|
| 1 | rVSV∆G-PEDV-S | IM | 108 TCID50/100 μL | D0, D14 |
| 2 | PBS | IM | 100 μL | D0, D14 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yi, J.; Luo, H.; Zhang, K.; Lv, L.; Li, S.; Jiang, Y.; Zhou, Y.; Wei, Z.; Liu, C. The Pseudotyped Replication-Deficient VSV with Spike from PEDV Induces Neutralizing Antibody Against PEDV. Vaccines 2025, 13, 223. https://doi.org/10.3390/vaccines13030223
Yi J, Luo H, Zhang K, Lv L, Li S, Jiang Y, Zhou Y, Wei Z, Liu C. The Pseudotyped Replication-Deficient VSV with Spike from PEDV Induces Neutralizing Antibody Against PEDV. Vaccines. 2025; 13(3):223. https://doi.org/10.3390/vaccines13030223
Chicago/Turabian StyleYi, Jingxuan, Huaye Luo, Kang Zhang, Lilei Lv, Siqi Li, Yifeng Jiang, Yanjun Zhou, Zuzhang Wei, and Changlong Liu. 2025. "The Pseudotyped Replication-Deficient VSV with Spike from PEDV Induces Neutralizing Antibody Against PEDV" Vaccines 13, no. 3: 223. https://doi.org/10.3390/vaccines13030223
APA StyleYi, J., Luo, H., Zhang, K., Lv, L., Li, S., Jiang, Y., Zhou, Y., Wei, Z., & Liu, C. (2025). The Pseudotyped Replication-Deficient VSV with Spike from PEDV Induces Neutralizing Antibody Against PEDV. Vaccines, 13(3), 223. https://doi.org/10.3390/vaccines13030223

