Next Article in Journal
Alpha-Glucosidase and Alpha-Amylase Inhibitory Activities of Novel Abietane Diterpenes from Salvia africana-lutea
Next Article in Special Issue
The Effects and Mechanisms of Cyanidin-3-Glucoside and Its Phenolic Metabolites in Maintaining Intestinal Integrity
Previous Article in Journal
Phenolic Compounds and Antioxidant Activities of Potato Cultivars with White, Yellow, Red and Purple Flesh
Previous Article in Special Issue
Hormetic and Mitochondria-Related Mechanisms of Antioxidant Action of Phytochemicals
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Combined Treatment with Three Natural Antioxidants Enhances Neuroprotection in a SH-SY5Y 3D Culture Model

by
Pasquale Marrazzo
1,
Cristina Angeloni
2,* and
Silvana Hrelia
2
1
Department for Life Quality Studies, Alma Mater Studiorum, University of Bologna, 47921 Rimini, Italy
2
School of Pharmacy, University of Camerino, 62032 Camerino, Italy
*
Author to whom correspondence should be addressed.
Antioxidants 2019, 8(10), 420; https://doi.org/10.3390/antiox8100420
Submission received: 19 August 2019 / Revised: 11 September 2019 / Accepted: 18 September 2019 / Published: 20 September 2019

Abstract

:
Currently, the majority of cell-based studies on neurodegeneration are carried out on two-dimensional cultured cells that do not represent the cells residing in the complex microenvironment of the brain. Recent evidence has suggested that three-dimensional (3D) in vitro microenvironments may better model key features of brain tissues in order to study molecular mechanisms at the base of neurodegeneration. So far, no drugs have been discovered to prevent or halt the progression of neurodegenerative disorders. New therapeutic interventions can come from phytochemicals that have a broad spectrum of biological activities. On this basis, we evaluated the neuroprotective effect of three phytochemicals (sulforaphane, epigallocatechin gallate, and plumbagin) alone or in combination, focusing on their ability to counteract oxidative stress. The combined treatment was found to be more effective than the single treatments. In particular, the combined treatment increased cell viability and reduced glutathione (GSH) levels, upregulated antioxidant enzymes and insulin-degrading enzymes, and downregulated nicotinamide adenine dinucleotide phosphate (NADPH) oxidase 1 and 2 in respect to peroxide-treated cells. Our data suggest that a combination of different phytochemicals could be more effective than a single compound in counteracting neurodegeneration, probably thanks to a pleiotropic mechanism of action.

1. Introduction

Oxidative stress is strongly involved in the pathogenesis of different neurodegenerative diseases like Alzheimer’s disease, Parkinson’s disease, and amyotrophic lateral sclerosis [1]. Particularly, an excess of reactive oxygen species (ROS) released by cells promotes oxidative stress, which is a cause of tissue injury and results in dysfunction in the nervous system. So far, no drugs have been discovered to prevent or halt the progression of these widely spread neurological disorders, and the treatments available only manage the symptoms. Therefore, there is an urgent need for new treatments for these diseases, since the World Health Organization (WHO) predicts that by 2040, neurodegenerative diseases will become the second-most prevalent cause of death [2]. New therapeutic approaches can derive from phytochemicals, a huge source of compounds that have been widely investigated in the last years [3]. Sulforaphane (SF) (Figure 1a) is an isothiocyanate derived from Brassicae vegetables and has consistent support in the literature for its preventive role against oxidative stress [4], in addition to its well-known role in chemoprevention [5]. Epigallocatechin gallate (EGCG) (Figure 1b), the major catechin found in green tea [6] with diverse medical potential [7] has been demonstrated to promote neuroprotection in numerous studies [8]. Plumbagin (PB) (Figure 1c), a naphthoquinone isolated from the Plumbaginacae family, has mainly been studied in respect to its anti-inflammatory [9,10,11] and antimicrobial activities [12], even though it was also shown to modulate oxidative stress response [13] and precisely target NADPH oxidase 4 (NOX4) [14]. Importantly, the treatment of undifferentiated SH-SY5Y cells with a specific concentration of SF [15], EGCG [16], and PB [17] has been reported to decrease oxidative stress at different levels. On this basis, we hypothesized that a proper combination of such bioactive compounds could possess a higher effect in counteracting oxidative stress-induced neurodegeneration. Within organs, there are various concentration gradients for oxygen as well as for effector molecules, i.e., internal metabolites or exogenous compounds/drugs. Since the human brain cannot be modelled adequately in animals [18], reductionist humanized cellular systems are used and increasingly requested according to the 3Rs (Replacement, Reduction and Refinement) rule.
Currently, the majority of cell-based studies on neurodegeneration have been carried out on cultured cells propagated in two dimensions on plastic surfaces. However, cells cultured in these non-physiological conditions do not represent the cells residing in the complex microenvironment of the brain. With respect to this, recent evidence has suggested that three-dimensional (3D) in vitro microenvironments may better model key features of brain tissues in order to study the molecular mechanisms at the base of neurodegeneration and neurorepair [19,20]. Numerous in vitro approaches have been carried out to mimic human neuronal features, based on neuronal-like cells such as the neuroblastoma line SH-SY5Y. SH-SY5Y is a human cell line that divides quickly and has the ability to differentiate in post-mitotic neurons, thus it is considered a convenient model to study Parkinson’s [21] and Alzheimer’s diseases [22]. Unlike traditional two-dimensional (2D) cultures, the different availability of oxygen and growth factors in a 3D cell culture should expectantly favor a more in vivo-like morphology and growth of these cells. Indeed, several 3D culture models have been developed with SH-SY5Y cells, in terms of cell aggregates [23], spheroids [24,25], or including different scaffolds [26,27,28]. To support 3D cultures of SH-SY5Y or neuronal cell lines, collagen has also been used, like collagen hydrogel [29] or porous collagen-based scaffolds [26,30]. To the best of our knowledge, none of the previous models has been used to investigate the ability of natural bioactive molecules to confer resistance to oxidative stress. The aim of this study was to evaluate the neuroprotective effect of a combination of SF, EGCG, and PB in preventing cell damage derived from oxidative stress in a 3D cell culture based on a collagen porous scaffold.

2. Materials and Methods

2.1. Cell Culture and Treatment

The SH-SY5Y human neuroblastoma cell line was obtained from Sigma-Aldrich (cat. n° 94030304) (St. Louis, MO, USA). Cells were expanded in a growth culture medium composed of high glucose Dulbecco’s Modified Eagle’s medium (DMEM), supplemented with 10% fetal bovine serum (FBS), 2 mM glutamine, 50 U/mL of penicillin, and 50 μg/mL of streptomycin, and cultured at 37 °C with 5% CO2 as previously reported [31]. Cell differentiation was induced by reducing serum levels of the medium to 1% with 10 µM retinoic acid (RA) for seven days prior to treatments [32]. SF (LKT Laboratories, Minneapolis, MN, USA), EGCG and PB (Sigma-Aldrich, St. Louis, MO, USA) were dissolved in DMSO, and 10 mM stocks were kept at −20 °C until use. Differentiated SH-SY5Y cells were treated with 1 μM SF, 2.5 μM EGCG, and 0.5 μM PB and SEP (1 μM SF + 2.5 μM EGCG + 0.5 μM PB,) for 24 h or 6 h according to the different experiments. Oxidative stress was induced, as previously reported [33], by exposing cells to 700 µM H2O2 in 1% FBS DMEM.

2.2. 3D Model Preparation

To obtain the scaffolds for 3D cultures of SH-SY5Y cells, sterile heterologous native lyophilized collagen type I sponge (BIOPAD™, Angelini Pharma Inc., Gaithersburg, USA) was cut using a sterile scalpel into pieces with squared dimensions able to fit 96-multiwell culture plates. Each piece was divided by subjecting it to a second longitudinal cut, performed in order to present a similar top surface as the cells. The pieces with approximately 1 cm2 of surface area were inserted into a 24-multiwell plate and constituted the scaffolds for the cell culture. To establish the 3D SH-SY5Y culture, 50 μL of cell suspension in DMEM with 10% FBS was seeded atop of each scaffold. Different cell numbers per scaffold (50 × 103–100 × 103–200 × 103) were seeded to compare cell viability along the culture (1–6 days) and optimize cell seeding for differentiation. To differentiate 3D SH-SY5Y culture, a concentration of 4 × 106 cells/mL equivalent to 200 × 103 cells in 50 uL was used. After 45 min of incubation at 37 °C, 5% CO2, DMEM with 1% FBS, and 10 µM RA were added to the 3D culture in order to induce cell differentiation. The medium was changed every two days.

2.3. MTT Assay

Before adding 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT), 3D cultures were transferred to clean cell culture wells. MTT 0.5 mg/mL was prepared in a cell medium and added to the 3D cultures. To measure the percentage of cells that did not attach to the scaffold, MTT was also added to the wells where cells were initially seeded (Figure S1). The MTT solution was incubated for 2 h at 37 °C, 5% CO2. After removing the MTT solution, DMSO was added and the absorbance of formazan was measured at 595 nm using a microplate spectrophotometer VICTOR3 V Multilabel plate-reader (PerkinElmer, Wellesley USA). The sum of the two respective absorbance values, the first deriving from the primary wells used during the seeding and the second deriving from the scaffolds, were considered as 100%.

2.4. Prestoblue Assay

A Prestoblue® working solution was prepared in a growth culture medium without phenol red according to the manufacturer’s instructions. Briefly, the culture medium was removed from cell culture wells and a Prestoblue working solution was added and incubated at 37 °C, 5% CO2. After 3 h, the well volumes were collected in a new 96-well plate and the absorbance was read at λ = 570 nm (experimental) and λ = 600 nm (reference wavelength for normalization) using a Victor Multilabel plate-reader (Perkin-Elmer, Wellesley USA).

2.5. Reduced Glutathione (GSH) Level Measurement

A monochlorobimane (MCB) fluorescent probe (Sigma-Aldrich, St. Louis, MO, USA) was used to determine relative intracellular GSH levels as previously reported [34] with some modifications. After 24 h of treatment, the cell culture medium was removed from 3D samples and the scaffolds were transferred to 1.5 mL tubes. The cells were incubated for 15 min in DMEM with 1% FBS containing 50 μM MCB, and for a further 15 min in DMEM with 0.5 mg/mL collagenase I and 50 μM MCB (Sigma-Aldrich). Cells collected by digestion of the scaffold were centrifuged at 250× g. Cells were resuspended in phosphate-buffered saline (PBS) and plated on black 96-well plates. The fluorescence was measured at 355 nm (excitation) and 460 nm (emission) using a Victor Multilabel plate-reader (Perkin-Elmer, Wellesley USA). GSH levels were normalized on the base of the Crystal Violet (CV) assay.

2.6. Crystal Violet Assay

Crystal Violet (CV) staining was performed as follows: Cells were fixed in 50% MeOH-PBS for 3 h at 4 °C. For 15 min at room temperature, a 0.1% (m/v) CV, 5% MeOH staining solution was incubated. The staining solution was removed and the stained cells were washed with distilled water. The plate was left to dry for 5 min under a chemical hood. The bound dye was eluted with MeOH 100% for 30 min at 4 °C. The optical density of each well was measured at 570 nm using a Victor Multilabel plate-reader (Perkin-Elmer, Wellesley USA).

2.7. RNA Extraction and Real-Time PCR

Prior to RNA extraction, cell retrieval was performed by digesting the collagen scaffold in collagenase solution. Collagenase type I (Sigma-Aldrich) was dissolved in DMEM without FBS at a concentration of 0.5 mg/mL. Samples were incubated in collagenase solution for 10 min at 37 °C. Cells suspension was pelleted, and RNA was extracted with an RNeasy® mini kit (Qiagen) following the manufacturer’s instruction. A total of 500 ng of RNA was used to obtain cDNA using an iScript™ cDNA Synthesis Kit (BioRad). Real-time PCR was performed using SsoAdvanced Universal SYBR Green Supermix (BioRad), and normalized expression levels were calculated relative to control cells according to the 2−ΔΔCT method. Primers were purchased from Sigma-Aldrich. The sequences are listed in Table 1.

3. Results

3.1. Development and Characterization of the 3D SH-SY5Y Culture System

To fully assess biocompatibility between the collagen scaffold and SH-SY5Y cells, we evaluated cellular retention to the scaffold and cellular metabolism during 3D culture. The ability of SH-SY5Y cells to attach to the scaffold was evaluated by an MTT viability assay (Figure 2a). This assay was chosen because cells convert MTT to blue formazan that is retained by the cells and, for this reason, it makes it possible to distinguish cells attached to the scaffold from those released from the scaffold (see Figure S1). As reported in Figure 2a, about 95% of the total viable cells were able to attach after the switch from 2D to 3D culture conditions, while only 5% of the cells grew outside of the scaffold. To check the proliferation of SH-SY5Y cells, we used a Prestoblue assay as it makes it possible to monitor the metabolic activity of the same cell culture over time (Figure 2b). Cells were seeded at different concentrations, and cell viability was evaluated after 1 and 6 days. As expected, cell viability increased with an increasing numbers of cells per scaffold at both time points. Interestingly, the metabolic activity of the 3D culture after 6 days was comparable to that measured after 1 day at all tested seeding densities. Because the scaffold did not allow us to observe the cells under a microscope during growth, to verify that RA-treated SH-SY5Y cells were able to differentiate, we evaluated the mRNA level of the mature neural protein marker MAP2 as well as the secretable neurotrophin BDNF in 3D RA-treated cells (Figure 2c). Interestingly, both markers were upregulated in 3D RA-treated cells in respect to the 3D RA-untreated control, showing their ability to differentiate under 3D culture conditions. Figure S4 reports the macroscopic and microscopic appearance of the 3D SH-SY5Y culture.

3.2. SF, EGCG and PB Protect 3D SH-SY5Y Cells from Oxidative-Induced Injury

Before studying the neuroprotective effect of SF, EGCG, and PB, we exposed 3D differentiated SH-SY5Y cells to 1 μM SF, 2.5 μM EGCG, 0.5 μM PB, or to a combination of the three compounds at the same concentrations (SEP) (Figure 3). These concentrations were chosen according to previous reports where these concentrations were not very effective against oxidative stress [15,16,17]. Our results showed that all the tested concentrations—1 μM SF, 2.5 μM EGCG, and 0.5 μM PB—were not toxic.
We then investigated the potential protective effect of the single treatments or a combination of them against H2O2-induced oxidative stress (Figure 4). As expected, incubation with 700 µM H2O2 for 2 h induced a significant reduction of cell viability compared to the control cells (Figure S2). Only 0.5 µM PB, 1 µM SF, and the co-treatment (1 µM SF, 2.5 µM EGCG, and 0.5 µM PB) were able to protect the cells against H2O2-induced damage. Of note, SEP co-treatment was the most effective treatment as it significantly increased cell viability compared to the other treatments.

3.3. SEP Co-Treatment Enhances Antioxidant Defenses

As our results showed a higher neuroprotective activity of SEP co-treatment (1 µM SF, 2.5 µM EGCG, and 0.5 µM PB) compared to the single treatments of 1 µM SF, 2.5, µM EGCG, or 0.5 µM PB, we investigated the ability of SEP co-treatment to modulate the cellular redox state by evaluating GSH levels with an MCB assay. The effect of the different treatments after 24 h on GSH levels is reported in Figure 5. All the treatments were able to significantly increase GSH levels in respect to control cells. In agreement with the viability data, we observed the most effective increase of GSH levels after SEP co-treatment (1 µM SF, 2.5 µM EGCG, and 0.5 µM PB) in comparison to the single treatment of 1 µM SF, 2.5 µM EGCG, or 0.5 µM PB.

3.4. SEP Co-Treatment Modulates Genes Involved in Oxidative Stress Control

As the previous data showed that SEP co-treatment was significantly more effective compared to the single treatments, we decided to study its ability to modulate cellular antioxidant status. Real-time PCR analysis was employed to investigate the ability of SEP co-treatment to modulate the mRNA level of different antioxidant enzymes. The cDNA was obtained from 3D SH-SY5Y cultures that were co-treated (1 µM SF, 2.5 µM EGCG, and 0.5 µM PB) for 6 h. The 3D cultures were then exposed to 700 µM H2O2 for 1 h prior to lysis (Figure 6). Importantly, SEP co-treatment induced a significant and marked upregulation of heme oxygenase 1 (HO1), NADPH: quinone oxidoreductase 1 (NQO1), glutathione reductase (GR), and thioredoxin reductase (TR) in 3D cultures although with different levels of upregulation (Figure 6). Moreover, SEP co-treatment in the presence of oxidative stress induced a significant upregulation of all tested genes in respect to H2O2-treated cells.
NADPH oxidase (NOX) enzymes have been shown to be a major source of ROS in the brain and to be involved in several neurological diseases [35]. On this basis, we studied the modulatory effect of SEP co-treatment on NOX1 and NOX2 expression using real-time PCR analysis (Figure 7). In the absence of oxidative stress, SEP co-treatment had a strong effect on these enzymes as it significantly reduced NOX1 and NOX2 expression compared to untreated cells. In the presence of oxidative stress (700 µM H2O2), SEP co-treatment significantly reduced NOX1 and NOX2 expression compared to H2O2-treated cells. Of note, SEP co-treatment before peroxide exposure maintained NOX1 levels at a value comparable to control cells.

3.5. SEP Co-Treatment is able to Modulate Insulin-Degrading Enzyme (IDE) Gene Expression

To investigate if SEP co-treatment had other neuroprotective activities besides the antioxidant one, we studied its effect on insulin-degrading enzyme (IDE) expression. IDE plays a significant role in Aβ degradation [36], which is one of the main hallmarks of Alzheimer’s disease. Moreover, recent studies have demonstrated that increasing Aβ degradation as opposed to inhibiting synthesis is a more effective strategy for preventing Aβ build-up [37]. In our 3D SH-SY5Y cultures, IDE mRNA levels were downregulated by oxidative stress, but, interestingly, SEP co-treatment (1 μM SF, 2.5 μM EGCG, and 0.5 μM PB) was able to upregulate its expression at levels comparable to untreated cells (Figure 8).

4. Discussion

The prevalence of neurodegenerative disorders is growing [2,38] in parallel to the urgency to find new compounds for the treatment of such diseases, in which oxidative stress is a common hallmark and has been suggested to play a causative role [39,40]. Unfortunately, the screening of drug leads and natural compounds to counteract neurodegeneration using 2D cell cultures often results in the unsuccessful translation of data to clinics. Neurons are strongly influenced by their immediate extracellular environment, and there is a great need to develop new culture systems that more faithfully reproduce the complexity of this milieu in vivo. Human 3D cell culture models are a good alternative to animal models [41,42]. In contrast to 2D cell cultures, 3D cell cultures do not overlook the physical interactions existing between cell–cell and cell–matrix and have a higher resemblance to the in vivo phenotype. Ideal scaffolds for neuronal tissue or disease modelling should exhibit suitable 3D architecture for in vitro manipulation, should facilitate cell adhesion while promoting neurites outgrowth, and have high biocompatibility [43]. Collagen type I is highly used as scaffold because of its abundance and ubiquity in most of the hard and soft tissues in the human body [44]. Porous collagen sponges have been used to grow various cell types in vitro [45] and collagen derived scaffolds have been widely used in neural tissue engineering for drug delivery [46]. Furthermore, the extracellular matrix (ECM) in nerves is mainly composed of type I collagen [47] and is a commonly used material in nerve tissue engineering [47] and for peripheral nerve regeneration [48]. ECM geometry and composition are well known to influence cell morphology and gene expression. It has been shown that SH-SY5Y cells extended longer neurites in 3D collagen I hydrogel cultures than in 2D cultures [26]. On this basis, we used equine native collagen, commercially available for clinical application, as scaffold to support 3D cultures of differentiated SH-SY5Y cells.
Our aim was to study the neuroprotective activity of a combination of SF, EGCG, and PB in counteracting peroxide-induced damage in 3D cultures of differentiated SH-SY5Y cells.
Taking into account previous studies showing the protective effects of these compounds against oxidative stress [49,50], we decided to treat SH-SY5Y cells with specific concentrations of SF, EGCG, and PB to better mimic concentrations that could be measured in plasma after oral intake of the three compounds [51]. We selected a porous instead of a hydrogel scaffold because it easily permits the removal of apoptotic blebs and dead cells by washing during medium exchange. The used collagenous scaffold was found to be highly biocompatible since it supported the adhesion and proliferation of SH-SY5Y cells in the 3D environment.
Our data demonstrated that SEP co-treatment was significantly more effective against oxidative stress than the single treatments of PB, EGCG, or SF, suggesting a synergistic protective mechanism of the co-treatment. In particular, SEP was more effective in limiting cell injury induced by H2O2 exposure. These data were also demonstrated in our 2D cell model, and we confirmed the superior efficacy in enhancing GSH levels by SEP co-treatment compared the single treatments both in 2D and 3D models (Figure S3). Although different reports have discussed the neuroprotective effect of PB, EGCG, and SF against brain-induced toxicity [52,53,54], there is no documented work on the effect of their combination. Our results are in agreement with other papers demonstrating the synergistic protective effect of different combinations of natural compounds against neurodegeneration [55,56,57]. In general, the superior protection of co-treatments compared to the single treatments could be probably ascribed to the concurrent modulation of different molecular targets involved in the pathogenesis and progression of these multi-factorial diseases.
To better elucidate the mechanisms behind SEP protection against H2O2 in SH-SY5Y cells, we investigated the effect of the co-treatment on the expression of different antioxidant enzymes: heme oxygenase 1 (HO1), NADPH: quinone oxidoreductase 1 (NQO1), glutathione reductase (GR) and thioredoxin reductase (TR).
The enzyme HO1 converts heme to three end products, namely biliverdin, CO, and ferrous ion [58], then biliverdin reductase activity produces the antioxidant bilirubin. NQO1 is a highly inducible detoxifying flavoenzyme. It catalyzes the reduction of quinones generating stable hydroquinones and possesses superoxide scavenging activity [59]. GR is responsible for maintaining a storage amount of reduced glutathione [60]. The thioredoxin (Trx) system, composed of Trx, TR, and NADPH as a cofactor, is a cellular defense system that is ubiquitously involved in converting ROS to nontoxic metabolites [61]. In such a system, the Trx in reduced status can be oxidized into oxidized Trx during the degradation of H2O2 and then reduced by TR [62].
SF is known to upregulate antioxidant defense through the induction of HO1, NQO1, and GR in SH-SY5Y cells [15,63], while GR, TR, and NQO1 have been observed to be upregulated in cortical neurons [64]. EGCG induced HO1 expression in rat-cultured neurons [65] and increased protein levels in treated rats following focal cerebral ischemia [66]. PB treatment led to increased levels of HO1, NQO1, and TR in SH-SY5Y cells [17]. Interestingly, our data showed that SEP co-treatment, in the absence of oxidative stress, strongly upregulated these enzymes compared to control cells (the same results were also obtained in the 2D model (Figure S3)), and, in the presence of oxidative stress, it was able to significantly increase the expression of these enzymes compared to H2O2 exposed cells. In agreement with our data that showed the enhanced effect of a combination of different compounds compared to treatment with the single compounds, in a previous work, we observed that a combination of EGCG and SF counteracts in vitro oxidative stress and delays stemness loss of amniotic fluid stem cells [67]. Moreover, a combination of berberine with resveratrol had enhanced hypolipidemic effects in high fat diet-induced mice and was able to decrease the lipid accumulation in adipocytes to a level significantly lower than that of the treatment with the single compounds [68].
Recently, it has been suggested that inhibition of the generation, rather than the scavenging, of ROS may be a more successful strategy to counteract oxidative stress-induced neurodegeneration [69]. ROS can be produced by many enzymes in the cells such as mitochondria respiratory complexes, NADPH oxidase, nitric oxide synthase, cytochrome 450, cyclooxygenase, lipoxygenase, and xanthine oxidase [14,70]. Interestingly, all these enzymes except NADPH oxidase produce ROS as a byproduct, while NOX enzymes generate ROS as a principal aim [71,72,73]. Moreover, different studies have shown the involvement of NADPH oxidase family members in brain injury and neurodegenerative disorders (reviewed in [69]). Our data demonstrated that SEP co-treatment was effective in reducing NOX1 and NOX2 expression compared to control cells and was also able to counteract the increase of NOX1 and NOX2 expression induced by H2O2. This means that SEP not only potentiates the antioxidant defense system upregulating fundamental enzymes, but also reduces the intracellular production of ROS.
The last aim of this paper was to investigate if SEP could modulate other hallmarks of neurodegeneration in addition to its ability to counteract oxidative stress. We decided to focus our attention on IDE, the main protease responsible for amyloid β clearance [74,75,76]. A reduction of IDE activity in the brain with age and during the early stages of Alzheimer’s disease (AD) has been observed [74], suggesting that IDE downregulation may be among the triggers of AD. Of note, SEP counteracted the strong downregulation of IDE induced by oxidative stress, maintaining IDE expression at a level comparable to control cells, suggesting a potential role of SEP in counteracting AD.
In conclusion, we highlighted that an appropriate synergistic combination of natural antioxidants such as SF, EGCG, and PB can help to rescue neuronal cells from oxidative stress cell death. The protective effect of the co-treatment was observed in a novel 3D model of SH-SY5Y cells that we developed. In agreement with other authors [77,78,79], we suggest that a 3D culture system better mimics cell–cell interactions and cell–ECM interactions compared to the traditional 2D monolayer. In particular, our 3D model would be useful for future investigations of the neuroprotective activity of natural compounds [80]. In the present study, we observed the protective effect of an “acute” co-treatment with SF, EGCG, and PB but, taking into account the nature of neurodegeneration, a subchronic/chronic administration should be even more effective. For this reason, future studies will have to be carried out to investigate the effect of chronic SEP treatment against oxidative stress in neurodegeneration. The present findings underscore the importance of a combinatorial approach for effective treatments against oxidative damage in neurodegeneration. Moreover, 3D SH-SY5Y cell culture systems appear to be the ideal environment for in vitro assays regarding the effects of phytochemicals on cell viability.

Supplementary Materials

The following are available online at https://www.mdpi.com/2076-3921/8/10/420/s1. Figure S1: Visual explanation of MTT assay as used in this study, Figure S2: Cell viability of SH-SY5Y incubated with H2O2, Figure S3: Results obtained with SEP co-treatement in SH-SY5Y 2D model. Figure S4: Images of SH-SY5Y 3D model.

Author Contributions

Conceptualization, P.M. and C.A.; methodology, P.M. and C.A.; data curation, P.M. and C.A.; writing—original draft preparation, P.M.; writing—review and editing, C.A. and S.H.; funding acquisition, S.H.

Funding

This work was supported by MIUR-PRIN 2015 (N. 20152HKF3Z) to S.H.

Conflicts of Interest

The authors declare that there is no conflict of interest regarding the publication of this paper.

Abbreviations

2DTwo-dimensional
3DThree-dimensional
BDNFBrain-derived neurotrophic factor
DCFH-DA2,7-dichlorodihydrofluorescein diacetate
DMEMDulbecco’s Modified Eagle’s medium
DMSODimethyl sulfoxide
ECMExtra cellular matrix
EGCGEpigallocatechin gallate
GRGlutathione reductase
GSHReduced glutathione
H2O2Hydrogen peroxide
HO1Heme oxygenase 1
IDEInsulin-degrading enzyme
MAP2Microtubule-associated protein 2
MCBMonochlorobimane
MTT3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide)
NOX1NADPH oxidase 1
NOX2NADPH oxidase 2
NQO1NAD(P)H: quinone oxidoreductase 1
PBPlumbagin
PBSPhosphate buffered saline
PCRPolymerase chain reaction
RAAll-trans retinoic acid
ROSReactive oxygen species
RPS18Ribosomal protein S18
SEPSulforaphane, Epigallocatechin gallate, Plumbagin
SFSulforaphane
TRThioredoxin reductase 1

References

  1. Barnham, K.J.; Masters, C.L.; Bush, A.I. Neurodegenerative diseases and oxidative stress. Nat. Rev. Drug Discov. 2004, 3, 205–214. [Google Scholar] [CrossRef]
  2. Gammon, K. Neurodegenerative disease: Brain windfall. Nature 2014, 515, 299–300. [Google Scholar] [CrossRef] [PubMed]
  3. Tarozzi, A.; Angeloni, C.; Malaguti, M.; Morroni, F.; Hrelia, S.; Hrelia, P. Sulforaphane as a Potential Protective Phytochemical against Neurodegenerative Diseases. Oxid. Med. Cell. Longev. 2013, 2013, 415078. [Google Scholar] [CrossRef] [PubMed]
  4. Angeloni, C.; Malaguti, M.; Hrelia, S. Antiglycative activity of sulforaphane: A new avenue to counteract neurodegeneration? Neural Regen. Res. 2015, 10, 1750. [Google Scholar] [CrossRef] [PubMed]
  5. Lenzi, M.; Fimognari, C.; Hrelia, P. Sulforaphane as a Promising Molecule for Fighting Cancer. In Advances in Nutrition and Cancer; Cancer Treatment and Research; Springer: Berlin/Heidelberg, Germany, 2014; Volume 159, pp. 207–223. [Google Scholar]
  6. Bordoni, A.; Hrelia, S.; Angeloni, C.; Giordano, E.; Guarnieri, C.; Caldarera, C.M.; Biagi, P.L. Green tea protection of hypoxia/reoxygenation injury in cultured cardiac cells. J. Nutr. Biochem. 2002, 13, 103–111. [Google Scholar] [CrossRef]
  7. Singh, B.N.; Shankar, S.; Srivastava, R.K. Green tea catechin, epigallocatechin-3-gallate (EGCG): Mechanisms, perspectives and clinical applications. Biochem. Pharmacol. 2011, 82, 1807–1821. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  8. Singh, N.A.; Mandal, A.K.A.; Khan, Z.A. Potential neuroprotective properties of epigallocatechin-3-gallate (EGCG). Nutr. J. 2016, 15, 60. [Google Scholar] [CrossRef]
  9. Chen, X.-J.; Zhang, J.-G.; Wu, L. Plumbagin inhibits neuronal apoptosis, intimal hyperplasia and also suppresses TNF-α/NF-κB pathway induced inflammation and matrix metalloproteinase-2/9 expression in rat cerebral ischemia. Saudi J. Biol. Sci. 2017, 25, 1033–1039. [Google Scholar] [CrossRef]
  10. Yuan, J.-H.; Pan, F.; Chen, J.; Chen, C.-E.; Xie, D.-P.; Jiang, X.-Z.; Guo, S.-J.; Zhou, J. Neuroprotection by plumbagin involves BDNF-TrkB-PI3K/Akt and ERK1/2/JNK pathways in isoflurane-induced neonatal rats. J. Pharm. Pharmacol. 2017, 69, 896–906. [Google Scholar] [CrossRef]
  11. Luo, P.; Wong, Y.F.; Ge, L.; Zhang, Z.F.; Liu, Y.; Liu, L.; Zhou, H. Anti-inflammatory and analgesic effect of plumbagin through inhibition of nuclear factor-κB activation. J. Pharmacol. Exp. Ther. 2010, 335, 735–742. [Google Scholar] [CrossRef]
  12. Padhye, S.; Dandawate, P.; Yusufi, M.; Ahmad, A.; Sarkar, F.H. Perspectives on medicinal properties of plumbagin and its analogs. Med. Res. Rev. 2012, 32, 1131–1158. [Google Scholar] [CrossRef] [PubMed]
  13. Arruri, V.; Komirishetty, P.; Areti, A.; Dungavath, S.K.N.; Kumar, A. Nrf2 and NF-κB modulation by Plumbagin attenuates functional, behavioural and biochemical deficits in rat model of neuropathic pain. Pharmacol. Rep. 2017, 69, 625–632. [Google Scholar] [CrossRef] [PubMed]
  14. Maraldi, T. Natural compounds as modulators of NADPH oxidases. Oxid. Med. Cell. Longev. 2013, 2013, 271602. [Google Scholar] [CrossRef] [PubMed]
  15. Tarozzi, A.; Morroni, F.; Merlicco, A.; Hrelia, S.; Angeloni, C.; Cantelli-Forti, G.; Hrelia, P. Sulforaphane as an inducer of glutathione prevents oxidative stress-induced cell death in a dopaminergic-like neuroblastoma cell line. J. Neurochem. 2009, 111, 1161–1171. [Google Scholar] [CrossRef] [PubMed]
  16. Jeong, J.H.; Kim, H.J.; Lee, T.J.; Kim, M.K.; Park, E.S.; Choi, B.S. Epigallocatechin 3-gallate attenuates neuronal damage induced by 3-hydroxykynurenine. Toxicology 2004, 195, 53–60. [Google Scholar] [CrossRef] [PubMed]
  17. Son, T.G.; Camandola, S.; Arumugam, T.V.; Cutler, R.G.; Telljohann, R.S.; Mughal, M.R.; Moore, T.A.; Luo, W.; Yu, Q.-S.; Johnson, D.A.; et al. Plumbagin, a novel Nrf2/ARE activator, protects against cerebral ischemia. J. Neurochem. 2010, 112, 1316–1326. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  18. Holmes, A.M.; Charlton, A.; Derby, B.; Ewart, L.; Scott, A.; Shu, W. Rising to the challenge: Applying biofabrication approaches for better drug and chemical product development. Biofabrication 2017, 9, 033001. [Google Scholar] [CrossRef] [PubMed]
  19. Papadimitriou, C.; Celikkaya, H.; Cosacak, M.I.; Mashkaryan, V.; Bray, L.; Bhattarai, P.; Brandt, K.; Hollak, H.; Chen, X.; He, S.; et al. 3D Culture Method for Alzheimer’s Disease Modeling Reveals Interleukin-4 Rescues Aβ42-Induced Loss of Human Neural Stem Cell Plasticity. Dev. Cell 2018, 46, 85–101. [Google Scholar] [CrossRef]
  20. Zhang, D.; Pekkanen-Mattila, M.; Shahsavani, M.; Falk, A.; Teixeira, A.I.; Herland, A. A 3D Alzheimer’s disease culture model and the induction of P21-activated kinase mediated sensing in iPSC derived neurons. Biomaterials 2014, 35, 1420–1428. [Google Scholar] [CrossRef]
  21. Xicoy, H.; Wieringa, B.; Martens, G.J.M. The SH-SY5Y cell line in Parkinson’s disease research: A systematic review. Mol. Neurodegener. 2017, 12, 10. [Google Scholar] [CrossRef]
  22. Lázaro, D.F.; Angeliki, M.; Pavlou, S.; Outeiro, T.F. Cellular models as tools for the study of the role of alpha-synuclein in Parkinson’s disease. Exp. Neurol. 2017, 298, 162–171. [Google Scholar] [CrossRef] [PubMed]
  23. Morabito, C.; Steimberg, N.; Mazzoleni, G.; Guarnieri, S.; Fanò-Illic, G.; Mariggiò, M.A.; Mariggi, M.A. RCCS Bioreactor-Based Modelled Microgravity Induces Significant Changes on In Vitro 3D Neuroglial Cell Cultures. BioMed Res. Int. 2015, 2015, 754283. [Google Scholar] [CrossRef] [PubMed]
  24. Seidel, D.; Krinke, D.; Jahnke, H.G.; Hirche, A.; Kloß, D.; Mack, T.G.A.; Striggow, F.; Robitzki, A. Induced Tauopathy in a Novel 3D-Culture Model Mediates Neurodegenerative Processes: A Real-Time Study on Biochips. PLoS ONE 2012, 7, e49150. [Google Scholar] [CrossRef] [PubMed]
  25. De Simone, U.; Roccio, M.; Gribaldo, L.; Spinillo, A.; Caloni, F.; Coccini, T. Human 3D Cultures as Models for Evaluating Magnetic Nanoparticle CNS Cytotoxicity after Short-and Repeated Long-Term Exposure. Int. J. Mol. Sci. 2018, 19, 1993. [Google Scholar] [CrossRef] [PubMed]
  26. Li, G.N.; Livi, L.L.; Gourd, C.M.; Deweerd, E.S.; Hoffman-Kim, D. Genomic and Morphological Changes of Neuroblastoma Cells in Response to Three-Dimensional Matrices. Tissue Eng. 2007, 13, 1035–1047. [Google Scholar] [CrossRef] [PubMed]
  27. Innala, M.; Riebe, I.; Kuzmenko, V.; Sundberg, J.; Gatenholm, P.; Hanse, E.; Johannesson, S. 3D Culturing and differentiation of SH-SY5Y neuroblastoma cells on bacterial nanocellulose scaffolds. Artif. Cells Nanomed. Biotechnol. 2014, 42, 302–308. [Google Scholar] [CrossRef] [PubMed]
  28. Tunesi, M.; Fusco, F.; Fiordaliso, F.; Corbelli, A.; Biella, G.; Raimondi, M.T. Optimization of a 3D Dynamic Culturing System for In Vitro Modeling of Frontotemporal Neurodegeneration-Relevant Pathologic Features. Front. Aging Neurosci. 2016, 8, 146. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  29. Desai, A.; Kisaalita, W.S.; Keith, C.; Wu, Z.-Z. Human neuroblastoma (SH-SY5Y) cell culture and differentiation in 3-D collagen hydrogels for cell-based biosensing. Biosens. Bioelectron. 2006, 21, 1483–1492. [Google Scholar] [CrossRef] [PubMed]
  30. Lv, D.; Yu, S.-C.; Ping, Y.-F.; Wu, H.; Zhao, X.; Zhang, H.; Cui, Y.; Chen, B.; Zhang, X.; Dai, J.; et al. A three-dimensional collagen scaffold cell culture system for screening anti-glioma therapeutics. Oncotarget 2016, 7, 56904–56914. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  31. Angeloni, C.; Teti, G.; Barbalace, M.C.; Malaguti, M.; Falconi, M.; Hrelia, S. 17β-Estradiol enhances sulforaphane cardioprotection against oxidative stress. J. Nutr. Biochem. 2017, 42, 26–36. [Google Scholar] [CrossRef] [PubMed]
  32. Lopes, F.M.; Schroder, R.; da Frota Junior, M.L.C.; Zanotto-Filho, A.; Muller, C.B.; Pires, A.S.; Meurer, R.T.; Colpo, G.D.; Gelain, D.P.; Kapczinski, F.; et al. Comparison between proliferative and neuron-like SH-SY5Y cells as an in vitro model for Parkinson disease studies. Brain Res. 2010, 1337, 85–94. [Google Scholar] [CrossRef] [PubMed]
  33. Giusti, L.; Angeloni, C.; Barbalace, M.; Lacerenza, S.; Ciregia, F.; Ronci, M.; Urbani, A.; Manera, C.; Digiacomo, M.; Macchia, M.; et al. A Proteomic Approach to Uncover Neuroprotective Mechanisms of Oleocanthal against Oxidative Stress. Int. J. Mol. Sci. 2018, 19, 2329. [Google Scholar] [CrossRef] [PubMed]
  34. Angeloni, C.; Malaguti, M.; Rizzo, B.; Barbalace, M.C.; Fabbri, D.; Hrelia, S. Neuroprotective Effect of Sulforaphane against Methylglyoxal Cytotoxicity. Chem. Res. Toxicol. 2015, 28, 1234–1245. [Google Scholar] [CrossRef] [PubMed]
  35. Angeloni, C.; Prata, C.; Vieceli Dalla Sega, F.; Piperno, R.; Hrelia, S. Traumatic Brain Injury and NADPH Oxidase: A Deep Relationship. Oxid. Med. Cell. Longev. 2015, 2015, 370312. [Google Scholar] [CrossRef] [PubMed]
  36. Kurochkin, I.V.; Guarnera, E.; Berezovsky, I.N. Insulin-Degrading Enzyme in the Fight against Alzheimer’s Disease. Trends Pharmacol. Sci. 2018, 39, 49–58. [Google Scholar] [CrossRef] [PubMed]
  37. Sikanyika, N.L.; Parkington, H.C.; Smith, A.I.; Kuruppu, S. Powering Amyloid Beta Degrading Enzymes: A Possible Therapy for Alzheimer’s Disease. Neurochem. Res. 2019, 44, 1289–1296. [Google Scholar] [CrossRef] [PubMed]
  38. Heemels, M.-T. Neurodegenerative diseases. Nature 2016, 539, 179. [Google Scholar] [CrossRef] [PubMed]
  39. Chen, X.; Guo, C.; Kong, J. Oxidative stress in neurodegenerative diseases. Neural Regen. Res. 2012, 7, 376–385. [Google Scholar] [CrossRef] [PubMed]
  40. Uttara, B.; Singh, A.V.; Zamboni, P.; Mahajan, R.T. Oxidative stress and neurodegenerative diseases: A review of upstream and downstream antioxidant therapeutic options. Curr. Neuropharmacol. 2009, 7, 65–74. [Google Scholar] [CrossRef]
  41. Mazzoleni, G.; Di Lorenzo, D.; Steimberg, N. Modelling tissues in 3D: The next future of pharmaco-toxicology and food research? Genes Nutr. 2009, 4, 13–22. [Google Scholar] [CrossRef]
  42. Marrazzo, P.; Maccari, S.; Taddei, A.; Bevan, L.; Telford, J.; Soriani, M.; Pezzicoli, A. 3D Reconstruction of the Human Airway Mucosa In Vitro as an Experimental Model to Study NTHi Infections. PLoS ONE 2016, 11, e0153985. [Google Scholar] [CrossRef] [PubMed]
  43. Brännvall, K.; Bergman, K.; Wallenquist, U.; Svahn, S.; Bowden, T.; Hilborn, J.; Forsberg-Nilsson, K. Enhanced neuronal differentiation in a three-dimensional collagen-hyaluronan matrix. J. Neurosci. Res. 2007, 85, 2138–2146. [Google Scholar] [CrossRef] [PubMed]
  44. Dong, C.; Lv, Y. Application of Collagen Scaffold in Tissue Engineering: Recent Advances and New Perspectives. Polymers 2016, 8, 42. [Google Scholar] [CrossRef] [PubMed]
  45. Glowacki, J.; Mizuno, S. Collagen scaffolds for tissue engineering. Biopolymers 2008, 89, 338–344. [Google Scholar] [CrossRef] [PubMed]
  46. Willerth, S.M.; Sakiyama-Elbert, S.E. Approaches to neural tissue engineering using scaffolds for drug delivery. Adv. Drug Deliv. Rev. 2007, 59, 325–338. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  47. Gao, X.; Wang, Y.; Chen, J.; Peng, J. The role of peripheral nerve ECM components in the tissue engineering nerve construction. Rev. Neurosci. 2013, 24, 443–453. [Google Scholar] [CrossRef]
  48. Gonzalez-Perez, F.; Udina, E.; Navarro, X. Extracellular Matrix Components in Peripheral Nerve Regeneration. Int. Rev. Neurobiol. 2013, 108, 257–275. [Google Scholar] [CrossRef]
  49. Kelsey, N.A.; Wilkins, H.M.; Linseman, D.A. Nutraceutical antioxidants as novel neuroprotective agents. Molecules 2010, 15, 7792–7814. [Google Scholar] [CrossRef] [PubMed]
  50. Tilak, J.C.; Adhikari, S.; Devasagayam, T.P.A. Antioxidant properties of Plumbago zeylanica, an Indian medicinal plant and its active ingredient, plumbagin. Redox Rep. 2004, 9, 219–227. [Google Scholar] [CrossRef]
  51. Vashist, A.; Kaushik, A.; Vashist, A.; Bala, J.; Nikkhah-Moshaie, R.; Sagar, V.; Nair, M. Nanogels as potential drug nanocarriers for CNS drug delivery. Drug Discov. Today 2018, 23, 1436–1443. [Google Scholar] [CrossRef]
  52. Wang, K.-H.; Li, B.-Z. Plumbagin protects against hydrogen peroxide-induced neurotoxicity by modulating NF-κB and Nrf-2. Arch. Med. Sci. 2018, 14, 1112–1118. [Google Scholar] [CrossRef]
  53. Wang, S.; Zhang, Z.; Zhao, S. Plumbagin inhibits amyloid-β-induced neurotoxicity. Neuroreport 2018, 29, 1269–1274. [Google Scholar] [CrossRef] [PubMed]
  54. Sun, Y.; Yang, T.; Leak, R.K.; Chen, J.; Zhang, F. Preventive and Protective Roles of Dietary Nrf2 Activators Against Central Nervous System Diseases. CNS Neurol. Disord. Drug Targets 2017, 16, 326–338. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Khan, M.B.; Hoda, M.N.; Ishrat, T.; Ahmad, S.; Moshahid Khan, M.; Ahmad, A.; Yusuf, S.; Islam, F. Neuroprotective efficacy of Nardostachys jatamansi and crocetin in conjunction with selenium in cognitive impairment. Neurol. Sci. 2012, 33, 1011–1020. [Google Scholar] [CrossRef] [PubMed]
  56. Zaky, A.; Bassiouny, A.; Farghaly, M.; El-Sabaa, B.M. A Combination of Resveratrol and Curcumin is Effective Against Aluminum Chloride-Induced Neuroinflammation in Rats. J. Alzheimer’s Dis. 2017, 60, S221–S235. [Google Scholar] [CrossRef] [PubMed]
  57. Dhitavat, S.; Ortiz, D.; Rogers, E.; Rivera, E.; Shea, T.B. Folate, vitamin E, and acetyl-l-carnitine provide synergistic protection against oxidative stress resulting from exposure of human neuroblastoma cells to amyloid-beta. Brain Res. 2005, 1061, 114–117. [Google Scholar] [CrossRef]
  58. Cheng, Y.; Rong, J. Therapeutic Potential of Heme Oxygenase-1/carbon Monoxide System Against Ischemia-Reperfusion Injury. Curr. Pharm. Des. 2017, 23. [Google Scholar] [CrossRef]
  59. Ross, D.; Siegel, D. Functions of NQO1 in Cellular Protection and CoQ10 Metabolism and its Potential Role as a Redox Sensitive Molecular Switch. Front. Physiol. 2017, 8, 595. [Google Scholar] [CrossRef]
  60. Couto, N.; Wood, J.; Barber, J. The role of glutathione reductase and related enzymes on cellular redox homoeostasis network. Free Radic. Biol. Med. 2016, 95, 27–42. [Google Scholar] [CrossRef]
  61. Lu, J.; Holmgren, A. The thioredoxin antioxidant system. Free Radic. Biol. Med. 2014, 66, 75–87. [Google Scholar] [CrossRef]
  62. Li, J.; Li, W.; Jiang, Z.G.; Ghanbari, H. Oxidative stress and neurodegenerative disorders. Int. J. Mol. Sci. 2013, 14, 24438–24475. [Google Scholar] [CrossRef] [PubMed]
  63. De Oliveira, M.R.; Brasil, F.B.; Fürstenau, C.R. Sulforaphane Attenuated the Pro-Inflammatory State Induced by Hydrogen Peroxide in SH-SY5Y Cells Through the Nrf2/HO-1 Signaling Pathway. Neurotox. Res. 2018, 34, 241–249. [Google Scholar] [CrossRef]
  64. Vauzour, D.; Buonfiglio, M.; Corona, G.; Chirafisi, J.; Vafeiadou, K.; Angeloni, C.; Hrelia, S.; Hrelia, P.; Spencer, J.P.E. Sulforaphane protects cortical neurons against 5- S -cysteinyl-dopamine-induced toxicity through the activation of ERK1/2, Nrf-2 and the upregulation of detoxification enzymes. Mol. Nutr. Food Res. 2010, 54, 532–542. [Google Scholar] [CrossRef] [PubMed]
  65. Romeo, L.; Intrieri, M.; D’Agata, V.; Mangano, N.G.; Oriani, G.; Ontario, M.L.; Scapagnini, G. The major green tea polyphenol, (-)-epigallocatechin-3-gallate, induces heme oxygenase in rat neurons and acts as an effective neuroprotective agent against oxidative stress. J. Am. Coll. Nutr. 2009, 28, S492–S499. [Google Scholar] [CrossRef] [PubMed]
  66. Han, J.; Wang, M.; Jing, X.; Shi, H.; Ren, M.; Lou, H. (−)-Epigallocatechin Gallate Protects Against Cerebral Ischemia-Induced Oxidative Stress via Nrf2/ARE Signaling. Neurochem. Res. 2014, 39, 1292–1299. [Google Scholar] [CrossRef] [PubMed]
  67. Marrazzo, P.; Angeloni, C.; Freschi, M.; Lorenzini, A.; Prata, C.; Maraldi, T.; Hrelia, S. Combination of epigallocatechin gallate and sulforaphane counteracts in vitro oxidative stress and delays stemness loss of amniotic fluid stem cells. Oxid. Med. Cell. Longev. 2018, 2018, 5263985. [Google Scholar] [CrossRef] [PubMed]
  68. Zhu, X.; Yang, J.; Zhu, W.; Yin, X.; Yang, B.; Wei, Y.; Guo, X. Combination of Berberine with Resveratrol Improves the Lipid-Lowering Efficacy. Int. J. Mol. Sci. 2018, 19, 3903. [Google Scholar] [CrossRef] [PubMed]
  69. Ma, M.W.; Wang, J.; Zhang, Q.; Wang, R.; Dhandapani, K.M.; Vadlamudi, R.K.; Brann, D.W. NADPH oxidase in brain injury and neurodegenerative disorders. Mol. Neurodegener. 2017, 12, 7. [Google Scholar] [CrossRef] [PubMed]
  70. Shyu, K.-G.; Chang, C.-C.; Yeh, Y.-C.; Sheu, J.-R.; Chou, D.-S. Mechanisms of Ascorbyl Radical Formation in Human Platelet-Rich Plasma. Biomed Res. Int. 2014, 2014, 614506. [Google Scholar] [CrossRef]
  71. Coso, S.; Harrison, I.; Harrison, C.B.; Vinh, A.; Sobey, C.G.; Drummond, G.R.; Williams, E.D.; Selemidis, S. NADPH Oxidases as Regulators of Tumor Angiogenesis: Current and Emerging Concepts. Antioxid. Redox Signal. 2012, 16, 1229–1247. [Google Scholar] [CrossRef] [Green Version]
  72. Selemidis, S.; Sobey, C.G.; Wingler, K.; Schmidt, H.H.H.W.; Drummond, G.R. NADPH oxidases in the vasculature: Molecular features, roles in disease and pharmacological inhibition. Pharmacol. Ther. 2008, 120, 254–291. [Google Scholar] [CrossRef] [PubMed]
  73. Armitage, M.E.; Wingler, K.; Schmidt, H.H.H.W.; La, M. Translating the oxidative stress hypothesis into the clinic: NOX versus NOS. J. Mol. Med. 2009, 87, 1071–1076. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  74. Stargardt, A.; Gillis, J.; Kamphuis, W.; Wiemhoefer, A.; Kooijman, L.; Raspe, M.; Benckhuijsen, W.; Drijfhout, J.W.; Reits, E. Reduced amyloid-β degradation in early Alzheimer’s disease but not in the APPswePS1dE9 and 3xTg-AD mouse models. Aging Cell 2013, 12, 499–507. [Google Scholar] [CrossRef] [PubMed]
  75. Portelius, E.; Mattsson, N.; Pannee, J.; Zetterberg, H.; Gisslén, M.; Vanderstichele, H.; Gkanatsiou, E.; Crespi, G.A.N.; Parker, M.W.; Miles, L.A.; et al. Ex vivo 18O-labeling mass spectrometry identifies a peripheral amyloid β clearance pathway. Mol. Neurodegener. 2017, 12, 18. [Google Scholar] [CrossRef] [PubMed]
  76. Farris, W.; Mansourian, S.; Chang, Y.; Lindsley, L.; Eckman, E.A.; Frosch, M.P.; Eckman, C.B.; Tanzi, R.E.; Selkoe, D.J.; Guenette, S. Insulin-degrading enzyme regulates the levels of insulin, amyloid beta-protein, and the beta-amyloid precursor protein intracellular domain in vivo. Proc. Natl. Acad. Sci. USA 2003, 100, 4162–4167. [Google Scholar] [CrossRef] [PubMed]
  77. Langhans, S.A. Three-Dimensional in Vitro Cell Culture Models in Drug Discovery and Drug Repositioning. Front. Pharmacol. 2018, 9, 6. [Google Scholar] [CrossRef]
  78. Fang, Y.; Eglen, R.M. Three-Dimensional Cell Cultures in Drug Discovery and Development. SLAS Discov. Adv. Life Sci. R D 2017, 22, 456–472. [Google Scholar] [CrossRef] [Green Version]
  79. Ko, K.R.; Frampton, J.P. Developments in 3D neural cell culture models: The future of neurotherapeutics testing? Expert Rev. Neurother. 2016, 16, 739–741. [Google Scholar] [CrossRef]
  80. Maraldi, T.; Prata, C.; Marrazzo, P.; Hrelia, S.; Angeloni, C. Natural compounds as a strategy to optimize “in vitro” expansion of stem cells. Rejuvenation Res. 2019. [Google Scholar] [CrossRef]
Figure 1. Chemical structures of the natural compounds used in this study. (a) Sulforaphane (SF), (b) epigallocatechin gallate (EGCG), (c) plumbagin (PB).
Figure 1. Chemical structures of the natural compounds used in this study. (a) Sulforaphane (SF), (b) epigallocatechin gallate (EGCG), (c) plumbagin (PB).
Antioxidants 08 00420 g001
Figure 2. Characterization of the 3D SH-SY5Y model. (a) Cellular adhesion to the scaffold was evaluated 24 h after cell seeding by MTT assay as reported in Materials and Methods. Data are expressed as a percentage of total viable cells and represent the mean of three independent experiments. (b) Metabolic activity of the 3D model was evaluated after 1 and 6 days from cell seeding by a Prestoblue assay as reported in Materials and Methods. Each bar represents the mean ± SEM of three independent experiments. Data were analyzed with a two-way ANOVA followed by the Fisher’s test. * p < 0.05. (c) Real time-PCR was performed in the 3D culture for neuronal markers. Each bar represents the mean ± SEM of three independent experiments, which were analyzed with an unpaired T-test. * p < 0.05.
Figure 2. Characterization of the 3D SH-SY5Y model. (a) Cellular adhesion to the scaffold was evaluated 24 h after cell seeding by MTT assay as reported in Materials and Methods. Data are expressed as a percentage of total viable cells and represent the mean of three independent experiments. (b) Metabolic activity of the 3D model was evaluated after 1 and 6 days from cell seeding by a Prestoblue assay as reported in Materials and Methods. Each bar represents the mean ± SEM of three independent experiments. Data were analyzed with a two-way ANOVA followed by the Fisher’s test. * p < 0.05. (c) Real time-PCR was performed in the 3D culture for neuronal markers. Each bar represents the mean ± SEM of three independent experiments, which were analyzed with an unpaired T-test. * p < 0.05.
Antioxidants 08 00420 g002
Figure 3. Potential cytotoxicity of sulforaphane (SF), epigallocatechin gallate (EGCG), and plumbagin (PB) on SH-SY5Y cells. Cells were treated with 1 µM SF, 2.5, µM EGCG, and 0.5 µM PB, and after 24 h, viability was evaluated by a Prestoblue assay as reported in Materials and Methods. Results are expressed as a percentage of untreated cells. Each bar represents the mean ± SEM of three independent experiments, which were analyzed with a one-way ANOVA followed by the Fisher’s test.
Figure 3. Potential cytotoxicity of sulforaphane (SF), epigallocatechin gallate (EGCG), and plumbagin (PB) on SH-SY5Y cells. Cells were treated with 1 µM SF, 2.5, µM EGCG, and 0.5 µM PB, and after 24 h, viability was evaluated by a Prestoblue assay as reported in Materials and Methods. Results are expressed as a percentage of untreated cells. Each bar represents the mean ± SEM of three independent experiments, which were analyzed with a one-way ANOVA followed by the Fisher’s test.
Antioxidants 08 00420 g003
Figure 4. Neuroprotective activity of SF, EGCG, and PB compounds against H2O2-induced damage. Cells were treated with 1 µM SF, 2.5 µM EGCG, and 0.5 µM PB, and after 24 h, were exposed to 700 µM H2O2 to induce oxidative stress. Cell viability in 3D cultures was measured by a Prestoblue assay as reported in Materials and Methods. Data are expressed as a percentage of untreated cells. Each bar represents mean ± SEM of three independent experiments. Data were analyzed with a one-way ANOVA followed by the Fisher’s test. * p < 0.05 vs. H2O2 treated cells; § p < 0.05 vs. sulforaphane, epigallocatechin gallate, and plumbagin (SEP) co-treatment.
Figure 4. Neuroprotective activity of SF, EGCG, and PB compounds against H2O2-induced damage. Cells were treated with 1 µM SF, 2.5 µM EGCG, and 0.5 µM PB, and after 24 h, were exposed to 700 µM H2O2 to induce oxidative stress. Cell viability in 3D cultures was measured by a Prestoblue assay as reported in Materials and Methods. Data are expressed as a percentage of untreated cells. Each bar represents mean ± SEM of three independent experiments. Data were analyzed with a one-way ANOVA followed by the Fisher’s test. * p < 0.05 vs. H2O2 treated cells; § p < 0.05 vs. sulforaphane, epigallocatechin gallate, and plumbagin (SEP) co-treatment.
Antioxidants 08 00420 g004
Figure 5. Antioxidant activity of SF, EGCG, and PB compounds on SH-SY5Y cells. Cells were treated with 1 µM SF, 2.5 µM EGCG, and 0.5 µM PB, and after 24 h GSH levels were evaluated with an monochlorobimane (MCB) assay as reported in Materials and Methods. Data are expressed as a percentage of untreated cells (CTRL). Each bar represents mean ± SEM of three independent experiments. Data were analyzed with a one-way ANOVA followed by the Fisher’s test. * p < 0.05 vs. untreated cells; § p < 0.05 vs. SEP co-treatment.
Figure 5. Antioxidant activity of SF, EGCG, and PB compounds on SH-SY5Y cells. Cells were treated with 1 µM SF, 2.5 µM EGCG, and 0.5 µM PB, and after 24 h GSH levels were evaluated with an monochlorobimane (MCB) assay as reported in Materials and Methods. Data are expressed as a percentage of untreated cells (CTRL). Each bar represents mean ± SEM of three independent experiments. Data were analyzed with a one-way ANOVA followed by the Fisher’s test. * p < 0.05 vs. untreated cells; § p < 0.05 vs. SEP co-treatment.
Antioxidants 08 00420 g005
Figure 6. Effect of SEP co-treatment on antioxidant enzyme expression. Cells were co-treated with 1 µM SF, 2.5 µM EGCG, and 0.5 µM PB for 6 h. Oxidative stress was induced with 700 µM H2O2 for 1 h prior to lysis. Real time-PCR was performed to detect heme oxygenase 1 (HO1), NADPH: quinone oxidoreductase 1 (NQO1), glutathione reductase (GR), and thioredoxin reductase (TR) mRNA levels. Data are expressed as relative abundance compared to untreated cells. Each bar represents mean ± SEM of three independent experiments. Data were analyzed with a one-way ANOVA followed by the Fisher’s test. * p < 0.05 vs. untreated cells, ° p < 0.05 vs. H2O2.
Figure 6. Effect of SEP co-treatment on antioxidant enzyme expression. Cells were co-treated with 1 µM SF, 2.5 µM EGCG, and 0.5 µM PB for 6 h. Oxidative stress was induced with 700 µM H2O2 for 1 h prior to lysis. Real time-PCR was performed to detect heme oxygenase 1 (HO1), NADPH: quinone oxidoreductase 1 (NQO1), glutathione reductase (GR), and thioredoxin reductase (TR) mRNA levels. Data are expressed as relative abundance compared to untreated cells. Each bar represents mean ± SEM of three independent experiments. Data were analyzed with a one-way ANOVA followed by the Fisher’s test. * p < 0.05 vs. untreated cells, ° p < 0.05 vs. H2O2.
Antioxidants 08 00420 g006
Figure 7. Effect of SEP co-treatment on NADPH oxidase 1 (NOX1) and NADPH oxidase 2 (NOX2). Cells were co-treated with 1 μM SF, 2.5 μM EGCG, and 0.5 μM PB for 6 h. Oxidative stress was induced with 700 µM H2O2 for 1 h prior to lysis. Real time-PCR was performed to detect NOX1 and NOX2 mRNA levels. Data are expressed as relative abundance compared to untreated cells. Each bar represents mean ± SEM of three independent experiments. Data were analyzed using a one-way ANOVA followed by the Fisher’s test. * p < 0.05 vs. untreated cells, ° p < 0.05 vs. H2O2.
Figure 7. Effect of SEP co-treatment on NADPH oxidase 1 (NOX1) and NADPH oxidase 2 (NOX2). Cells were co-treated with 1 μM SF, 2.5 μM EGCG, and 0.5 μM PB for 6 h. Oxidative stress was induced with 700 µM H2O2 for 1 h prior to lysis. Real time-PCR was performed to detect NOX1 and NOX2 mRNA levels. Data are expressed as relative abundance compared to untreated cells. Each bar represents mean ± SEM of three independent experiments. Data were analyzed using a one-way ANOVA followed by the Fisher’s test. * p < 0.05 vs. untreated cells, ° p < 0.05 vs. H2O2.
Antioxidants 08 00420 g007
Figure 8. Effect of SEP co-treatment on insulin-degrading enzyme (IDE). Cells were co-treated with 1 μM SF, 2.5 μM EGCG, and 0.5 μM PB for 6 h. Oxidative stress was induced with 700 µM H2O2 for 1 h prior to lysis. Real time-PCR was performed to detect IDE mRNA levels. Data are expressed as relative abundance compared to untreated cells. Each bar represents mean ± SEM of three independent experiments. Data were analyzed with a one-way ANOVA followed by the Fisher’s test. * p < 0.05 vs. untreated cells, ° p < 0.05 vs. H2O2.
Figure 8. Effect of SEP co-treatment on insulin-degrading enzyme (IDE). Cells were co-treated with 1 μM SF, 2.5 μM EGCG, and 0.5 μM PB for 6 h. Oxidative stress was induced with 700 µM H2O2 for 1 h prior to lysis. Real time-PCR was performed to detect IDE mRNA levels. Data are expressed as relative abundance compared to untreated cells. Each bar represents mean ± SEM of three independent experiments. Data were analyzed with a one-way ANOVA followed by the Fisher’s test. * p < 0.05 vs. untreated cells, ° p < 0.05 vs. H2O2.
Antioxidants 08 00420 g008
Table 1. Primer sequences.
Table 1. Primer sequences.
GeneSequenceRefSeq Accession n.
RPS18 *Fw CAGAAGGATGTAAAGGATGGNM_022551
Rv TATTTCTTCTTGGACACACC
MAP2Fw GAAGATTTACTTACAGCCTCGNM_002374
Rv GGTAAGTTTTAGTTGTCTCTGG
BDNFFw CAAAAGTGGAGAACATTTGCNM_001143811
Rv AACTCCAGTCAATAGGTCAG
HMOX1(HO1)Fw CAACAAAGTGCAAGATTCTGNM_002133.2
Rv TGCATTCACATGGCATAAAG
IDEFw CAACCTGAAGTGATTCAGAACNM_001165946
Rv AATATGTGGTTTCACAAGGG
NOX1Fw CCGGTCATTCTTTATATCTGTGNM_007052
Rv CAACCTTGGTAATCACAACC
NOX2Fw AAGATCTACTTCTACTGGCTGNM_000397
Rv AGATGTTGTAGCTGAGGAAG
NQO1Fw AGTATCCACAATAGCTGACGNM_000903
Rv TTTGTGGGTCTGTAGAAATG
GSR (GR)Fw GACCTATTCAACGAGCTTTACNM_000637
Rv CAACCACCTTTTCTTCCTTG
TXNRD1 (TR)Fw AGACAGTTAAGCATGATTGGNM_001093771
Rv AATTGCCCATAAGCATTCTC
* reference gene.

Share and Cite

MDPI and ACS Style

Marrazzo, P.; Angeloni, C.; Hrelia, S. Combined Treatment with Three Natural Antioxidants Enhances Neuroprotection in a SH-SY5Y 3D Culture Model. Antioxidants 2019, 8, 420. https://doi.org/10.3390/antiox8100420

AMA Style

Marrazzo P, Angeloni C, Hrelia S. Combined Treatment with Three Natural Antioxidants Enhances Neuroprotection in a SH-SY5Y 3D Culture Model. Antioxidants. 2019; 8(10):420. https://doi.org/10.3390/antiox8100420

Chicago/Turabian Style

Marrazzo, Pasquale, Cristina Angeloni, and Silvana Hrelia. 2019. "Combined Treatment with Three Natural Antioxidants Enhances Neuroprotection in a SH-SY5Y 3D Culture Model" Antioxidants 8, no. 10: 420. https://doi.org/10.3390/antiox8100420

APA Style

Marrazzo, P., Angeloni, C., & Hrelia, S. (2019). Combined Treatment with Three Natural Antioxidants Enhances Neuroprotection in a SH-SY5Y 3D Culture Model. Antioxidants, 8(10), 420. https://doi.org/10.3390/antiox8100420

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop