Epidemiological and Molecular Approaches for a Fatal Feline Panleukopenia Virus Infection of Captive Siberian Tigers (Panthera tigris altaica) in the Republic of Korea
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Clinical and Epidemiological Data Collection
2.2. Sample Collection
2.3. Molecular Assays for Screening of Viral Pathogens
2.4. VP2 Gene Sequencing
2.5. Sequence and Phylogenetic Analyses
3. Results
3.1. Clinical and Epidemiological Features of the Infected Tigers
3.2. Detection of Viral Pathogens
3.3. Analysis of VP2 Gene Sequence of the KTPV-2305 Strain
3.4. Phylogenetic Analysis Based on VP2 Sequences of FPVs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Truyen, U.; Addie, D.; Belák, S.; Boucraut-Baralon, C.; Egberink, H.; Frymus, T.; Gruffydd-Jones, T.; Hartmann, K.; Hosie, M.J.; Lloret, A.; et al. Feline panleukopenia. ABCD guidelines on prevention and management. J. Feline Med. Surg. 2009, 11, 538–546. [Google Scholar] [CrossRef] [PubMed]
- Cotmore, S.F.; Agbandje-McKenna, M.; Canuti, M.; Chiorini, J.A.; Eis-Hubinger, A.M.; Hughes, J.; Mietzsch, M.; Modha, S.; Ogliastro, M.; Pénzes, J.J.; et al. ICTV Virus Taxonomy Profile: Parvoviridae. J. Gen. Virol. 2019, 100, 367–368. [Google Scholar] [CrossRef] [PubMed]
- Decaro, N.; Desario, C.; Miccolupo, A.; Campolo, M.; Parisi, A.; Martella, V.; Amorisco, F.; Lucente, M.S.; Lavazza, A.; Buonavoglia, C. Genetic analysis of feline panleukopenia viruses from cats with gastroenteritis. J. Gen. Virol. 2008, 89, 2290–2298. [Google Scholar] [CrossRef]
- Steinel, A.; Munson, L.; van Vuuren, M.; Truyen, U. Genetic characterization of feline parvovirus sequences from various carnivores. J. Gen. Virol. 2000, 81, 345–350. [Google Scholar] [CrossRef]
- Stuetzer, B.; Hartmann, K. Feline parvovirus infection and associated diseases. Vet. J. 2014, 201, 150–155. [Google Scholar] [CrossRef]
- Day, M.J.; Horzinek, M.C.; Schultz, R.D.; Squires, R.A. WSAVA Guidelines for the vaccination of dogs and cats. J. Small Anim. Pract. 2016, 57, E1–E45. [Google Scholar] [CrossRef]
- Gore, T.C.; Lakshmanan, N.; Williams, J.R.; Jirjis, F.F.; Chester, S.T.; Duncan, K.L.; Coyne, M.J.; Lum, M.A.; Sterner, F.J. Three-year duration of immunity in cats following vaccination against feline rhinotracheitis virus, feline calicivirus, and feline panleukopenia virus. Vet. Ther. 2006, 7, 213–222. [Google Scholar]
- Duarte, M.D.; Barros, S.C.; Henriques, M.; Fernandes, T.L.; Bernardino, R.; Monteiro, M.; Fevereiro, M. Fatal infection with feline panleukopenia virus in two captive wild carnivores (Panthera tigris and Panthera leo). J. Zoo Wildl. Med. 2009, 40, 354–359. [Google Scholar] [CrossRef]
- Tian, Y.; Wu, J.; Smith, A.T.; Wang, T.; Kou, X.; Ge, J. Population viability of the Siberian tiger in a changing landscape: Going, going and gone? Ecol. Model. 2011, 222, 3166–3180. [Google Scholar] [CrossRef]
- Wang, K.; Du, S.; Wang, Y.; Wang, S.; Luo, X.; Zhang, Y.; Liu, C.; Wang, H.; Pei, Z.; Hu, G. Isolation and identification of tiger parvovirus in captive Siberian tigers and phylogenetic analysis of VP2 gene. Infect. Genet. Evol. 2019, 75, 103957. [Google Scholar] [CrossRef]
- Huang, S.; Li, X.; Xie, W.; Guo, L.; You, D.; Xu, H.; Liu, D.; Wang, Y.; Hou, Z.; Zeng, X.; et al. Molecular detection of parvovirus in captive Siberian tigers and lions in Northeastern China from 2019 to 2021. Front. Microbiol. 2022, 13, 898184. [Google Scholar] [CrossRef] [PubMed]
- Jung, I.; Kim, Y.S.; Jee, H.; Sohn, S.Y.; Yoo, H.S.; Kim, D.T.; Youn, H.Y.; Shin, N.S. Feline panleukopenia virus infection in a Siberian tiger (Panthera tigris altaica). J. Vet. Clin. 2009, 26, 504–507. [Google Scholar]
- Cao, N.; Tang, Z.; Zhang, X.; Li, W.; Li, B.; Tian, Y.; Xu, D. Development and application of a triplex TaqMan quantitative real-time PCR assay for simultaneous detection of feline calicivirus, feline parvovirus, and feline herpesvirus 1. Front. Vet. Sci. 2022, 8, 792322. [Google Scholar] [CrossRef] [PubMed]
- Baek, J.S.; Kim, J.M.; Kim, H.R.; Shin, Y.K.; Kwon, O.K.; Kang, H.E.; Park, C.K. Prevalence of feline calicivirus in Korean cats determined by an improved real-time RT-PCR assay. Korean J. Vet. Serv. 2023, 46, 123–135. [Google Scholar] [CrossRef]
- Gut, M.; Leutenegger, C.M.; Huder, J.B.; Pedersen, N.C.; Lutz, H. One-tube fluorogenic reverse transcription-polymerase chain reaction for the quantitation of feline coronaviruses. J. Virol. Methods 1999, 77, 37–46. [Google Scholar] [CrossRef] [PubMed]
- Halecker, S.; Bock, S.; Beer, M.; Hoffmann, B. A new molecular detection system for canine distemper virus based on a double-check strategy. Viruses 2021, 13, 1632. [Google Scholar] [CrossRef] [PubMed]
- Tandon, R.; Cattori, V.; Gomes-Keller, M.A.; Meli, M.L.; Golder, M.C.; Lutz, H.; Hofmann-Lehmann, R. Quantitation of feline leukaemia virus viral and proviral loads by TaqMan real-time polymerase chain reaction. J. Virol. Methods 2005, 130, 124–132. [Google Scholar] [CrossRef] [PubMed]
- An, D.J.; Jeong, W.; Jeoung, H.Y.; Yoon, S.H.; Kim, H.J.; Park, J.Y.; Park, B.K. Phylogenetic analysis of feline panleukopenia virus (FPLV) strains in Korean cats. Res. Vet. Sci. 2011, 90, 163–167. [Google Scholar] [CrossRef] [PubMed]
- Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [PubMed]
- Minh, B.Q.; Schmidt, H.A.; Chernomor, O.; Schrempf, D.; Woodhams, M.D.; Von Haeseler, A.; Lanfear, R. IQ-TREE 2: New models and efficient methods for phylogenetic inference in the genomic era. Mol. Biol. Evol. 2020, 37, 1530–1534. [Google Scholar] [CrossRef]
- Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.; Von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef] [PubMed]
- Hoang, D.T.; Chernomor, O.; Von Haeseler, A.; Minh, B.Q.; Vinh, L.S. UFBoot2: Improving the ultrafast bootstrap approximation. Mol. Biol. Evol. 2018, 35, 518–522. [Google Scholar] [CrossRef] [PubMed]
- Letunic, I.; Bork, P. Interactive Tree of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef]
- Proverbio, D.; Perego, R.; Baggiani, L.; Ravasio, G.; Giambellini, D.; Spada, E. Hematological and biochemical reference values in healthy captive tigers (Panthera tigris). Animals 2021, 11, 3440. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Li, T.; Liu, H.; Du, J.; Zhou, F.; Dong, Y.; He, X.; Li, Y.; Wang, C. Recombinant feline parvovirus infection of immunized tigers in central China. Emerg. Microbes Infect. 2017, 6, 1–3. [Google Scholar] [CrossRef]
- Nur-Farahiyah, A.N.; Kumar, K.; Yasmin, A.R.; Omar, A.R.; Camalxaman, S.N. Isolation and genetic characterization of canine parvovirus in a Malayan tiger. Front. Vet. Sci. 2021, 8, 660046. [Google Scholar] [CrossRef]
- Yang, D.K.; Park, Y.R.; Park, Y.; An, S.; Choi, S.S.; Park, J.; Hyun, B.H. Isolation and molecular characterization of feline panleukopenia viruses from Korean cats. Korean J. Vet. Res. 2022, 62, e10. [Google Scholar] [CrossRef]
- Shetty, B.D.; Zachariah, A.; Farver, T.B.; Smith, B.; Goldstein, T.; Mazet, J.A.K. Carnivore protoparvovirus 1 (Parvoviruses) at the domestic-wild carnivore interface in India. J. Zoo Wildl. Med. 2020, 50, 1016–1020. [Google Scholar] [CrossRef]
- Lyoo, Y.S.; Chang, C.H.; Park, J.H.; Lee, J.C. Isolation and identification of parvovirus from tiger with severe bloody diarrhea. J. Korean Soc. Radiol. 1990, 20, 1–5. [Google Scholar]
- Shin, N.S.; Kwon, S.W.; Lee, G.H.; Kim, D.Y.; Lee, J.K.; Kim, B.H. Feline panleukopenia virus infection in a Bengal tiger (Panthera tigris tigris). Korean J. Vet. Pathol. 2000, 4, 59–60. [Google Scholar]
- Yang, D.K.; Park, Y.R.; Kim, E.J.; Lee, H.J.; Shin, K.S.; Kim, J.H.; Lee, K.H.; Hyun, B.H. Incidence and sero-surveillance of feline viruses in Korean cats residing in Gyeonggi-do. Korean J. Vet. Res. 2022, 62, e24. [Google Scholar] [CrossRef]
- Tang, Y.; Tang, N.; Zhu, J.; Wang, M.; Liu, Y.; Lyu, Y. Molecular characteristics and genetic evolutionary analyses of circulating parvoviruses derived from cats in Beijing. BMC Vet. Res. 2022, 8, 195. [Google Scholar] [CrossRef] [PubMed]
- Inthong, N.; Kaewmongkol, S.; Meekhanon, N.; Sirinarumitr, K.; Sirinarumitr, T. Dynamic evolution of canine parvovirus in Thailand. Vet. World 2020, 13, 245–255. [Google Scholar] [CrossRef] [PubMed]
- Diakoudi, G.; Desario, C.; Lanave, G.; Salucci, S.; Ndiana, L.A.; Zarea, A.A.K.; Fouad, E.A.; Lorusso, A.; Alfano, F.; Cavalli, A.; et al. Feline panleukopenia virus in dogs from Italy and Egypt. Emerg. Infect. Dis. 2022, 28, 1933–1935. [Google Scholar] [CrossRef]
- Hoang, M.; Wu, C.N.; Lin, C.F.; Nguyen, H.T.T.; Le, V.P.; Chiou, M.T.; Lin, C.N. Genetic characterization of feline panleukopenia virus from dogs in Vietnam reveals a unique Thr101 mutation in VP2. PeerJ 2020, 8, e9752. [Google Scholar] [CrossRef]
- Yi, S.; Liu, S.; Meng, X.; Huang, P.; Cao, Z.; Jin, H.; Wang, J.; Hu, G.; Lan, J.; Zhang, D.; et al. Feline panleukopenia virus with G299E substitution in the VP2 protein first identified from a captive giant panda in China. Front. Cell. Infect. Microbiol. 2022, 11, 820144. [Google Scholar] [CrossRef]
- Fei-Fei, D.; Yong-Feng, Z.; Jian-Li, W.; Xue-Hua, W.; Kai, C.; Chuan-Yi, L.; Shou-Yu, G.; Jiang, S.; Zhi-Jing, X. Molecular characterization of feline panleukopenia virus isolated from mink and its pathogenesis in mink. Vet. Microbiol. 2017, 205, 92–98. [Google Scholar] [CrossRef]
- Govindasamy, L.; Hueffer, K.; Parrish, C.R.; Agbandje-McKenna, M. Structures of host range-controlling regions of the capsids of canine and feline parvoviruses and mutants. J. Virol. 2003, 77, 12211–12221. [Google Scholar] [CrossRef]
- Palermo, L.M.; Hueffer, K.; Parrish, C.R. Residues in the apical domain of the feline and canine transferrin receptors control host-specific binding and cell infection of canine and feline parvoviruses. J. Virol. 2003, 77, 8915–8923. [Google Scholar] [CrossRef]
- Truyen, U.; Parrish, C.R. Feline panleukopenia virus: Its interesting evolution and current problems in immunoprophylaxis against a serious pathogen. Vet. Microbiol. 2013, 165, 29–32. [Google Scholar] [CrossRef]
- Callaway, H.M.; Welsch, K.; Weichert, W.; Allison, A.B.; Hafenstein, S.L.; Huang, K.; Iketani, S.; Parrish, C.R. Complex and dynamic interactions between parvovirus capsids, transferrin receptors, and antibodies control cell infection and host range. J. Virol. 2018, 92, e00460-18. [Google Scholar] [CrossRef]
- Stone, A.E.; Brummet, G.O.; Carozza, E.M.; Kass, P.H.; Petersen, E.P.; Sykes, J.; Westman, M.E. AAHA/AAFP Feline vaccination guidelines. J. Feline Med. Surg. 2020, 22, 813–830. [Google Scholar] [CrossRef] [PubMed]
- Lamberski, N. Updated vaccination recommendations for carnivores. Fowler’s Zoo Wild Anim. Med. 2012, 2012, 442–450. [Google Scholar]
- Hartmann, K.; Möstl, K.; Lloret, A.; Thiry, E.; Addie, D.D.; Belák, S.; Boucraut-Baralon, C.; Egberink, H.; Frymus, T.; Hofmann-Lehmann, R.; et al. Vaccination of Immunocompromised Cats. Viruses 2022, 14, 923. [Google Scholar] [CrossRef]
- Decaro, N.; Buonavoglia, C.; Barrs, V.R. Canine parvovirus vaccination and immunization failures: Are we far from disease eradication? Vet. Microbiol. 2020, 247, 108760. [Google Scholar] [CrossRef]
- Digangi, B.A.; Levy, J.K.; Griffin, B.; Reese, M.J.; Dingman, P.A.; Tucker, S.J.; Dubovi, E.J. Effects of maternally-derived antibodies on serologic responses to vaccination in kittens. J. Feline Med. Surg. 2012, 14, 118–123. [Google Scholar] [CrossRef] [PubMed]
- Jakel, V.; Cussler, K.; Hanschmann, K.M.; Truyen, U.; König, M.; Kamphuis, E.; Duchow, K. Vaccination against feline panleukopenia: Implications from a field study in kittens. BMC Vet. Res. 2012, 8, 62. [Google Scholar] [CrossRef] [PubMed]
- Shams, F.; Pourtaghi, H.; Abdolmaleki, Z. The first evaluation of the effectiveness of canine vaccination schedule by two commercial vaccines in Iran. BMC Vet. Res. 2022, 18, 119. [Google Scholar] [CrossRef]
Pathogen | Target Gene | Primers and Probe (5′-3′) a | Amplicon Size (bp) | References |
---|---|---|---|---|
FPV/CPV | VP2 | F: CGGGGGTGGTGGTGGTT R: GCTTGAGTTTGCTGTGATTTCC P: FAM-CTGGGGGTGTGGGGATTTCTACG-BHQ1 | 112 | Cao et al. (2022) [13] |
FCoV | 7b | F: GATTTGATTTGGCAATGCTAGATTT R: AACAATCACTAGATCCAGACGTTAGCT P: FAM-TCCATTGTTGGCTCGTCATAGCGGA-BHQ1 | 102 | Gut et al. (1999) [15] |
FCV | P30 | F: GCCAATCAACATGTGGTAAC R: CACATCATATGCGGCTCTG P: FAM-TGTTTGATTTGGCCTGGGCTCTTCG-BHQ1 | 111 | Baek et al. (2023) [14] |
CDV | P | F: CTGTCRGTAATCGAGRATTCGA R: GCCGAAAGAATATCCCCAGTTAG P: FAM-ATCTTCGCCAGARTCYTCAGTGCT-BHQ1 | 116 | Halecker et al. (2021) [16] |
FeLV | LTR | F: AACAGCAGAAGTTTCAAGGCC R. TTATAGCAGAAAGCGCGCG P: FAM-CCAGCAGTCTCCAGGCTCCCCA-BHQ1 | 131 | Tandon et al. (2005) [17] |
No. | Name a | Age (year) | Clinical Signs | WBC (103/µL) | Virus Detection by Molecular Assays b | ||||
---|---|---|---|---|---|---|---|---|---|
FPV | FCoV | FCV | CDV | FeLV | |||||
1 | Penza | 13 | Mild | NT | + | − | − | − | − |
2 | Haerang | 1 | Severe | 4.89 | + | − | − | − | − |
3 | Sarang | 1 | Severe | 3.08 | + | − | − | − | − |
4 | Parang c | 1 | Death | 0.66 | NT | NT | NT | NT | NT |
5 | Miho | 10 | Healthy | NT | − | − | − | − | − |
6 | Kumkang | 5 | Healthy | NT | − | − | − | − | − |
Virus Type | Strain | GenBank Number | Host (Year) | Homology of VP2 Gene with the KTPV-2305 Strain (%) | ||
---|---|---|---|---|---|---|
Nucleotide | Amino Acid | |||||
CPV-2 Reference strains | CPV-2 | Pfizer/vaccine/06 | EU914139 | Dog | 98.6 | 97.8 |
CPV-2 | Intervet/vaccine/06 | FJ011098 | Dog | 98.6 | 97.9 | |
CPV-2a | PVFCAPC | M24003 | Dog | 98.9 | 98.1 | |
CPV-2b | PVCVP1VP2A/39 | M74849 | Dog | 98.8 | 98.1 | |
CPV-2c | 67/06 | FJ005214 | Dog | 98.6 | 97.9 | |
FPV Reference strains | FPV | Philips Roxane | M24002 | Cat | 99.5 | 99.5 |
FPV | Purevax | EU498680 | Cat | 99.5 | 99.5 | |
FPV | Felocell | EU498681 | Cat | 99.5 | 99.7 | |
Korean FPV strains | FPV | KF001 | EU252145 | Cat (2007) | 99.4 | 99.8 |
FPV | KF002 | EU252146 | Cat (2007) | 99.7 | 99.8 | |
FPV | KF003 | EU252147 | Cat (2007) | 99.7 | 99.8 | |
FPV | K2 | HQ184189 | Cat (2008) | 99.9 | 99.8 | |
FPV | K3 | HQ184190 | Cat (2008) | 99.9 | 100.0 | |
FPV | K4 | HQ184191 | Cat (2008) | 100.0 | 100.0 | |
FPV | K7 | HQ184192 | Cat (2008) | 99.5 | 99.8 | |
FPV | K22 | HQ184193 | Cat (2008) | 99.4 | 99.8 | |
FPV | K23 | HQ184194 | Cat (2008) | 99.7 | 99.8 | |
FPV | K49 | HQ184195 | Cat (2008) | 99.7 | 99.7 | |
FPV | K50 | HQ184196 | Cat (2008) | 99.7 | 99.1 | |
FPV | KS2 | HQ184204 | Cat (2008) | 99.4 | 99.3 | |
FPV | KS11 | HQ184197 | Cat (2008) | 99.4 | 99.8 | |
FPV | KS18 | HQ184198 | Cat (2008) | 99.4 | 99.1 | |
FPV | KS23 | HQ184199 | Cat (2008) | 99.6 | 99.7 | |
FPV | KS42 | HQ184200 | Cat (2008) | 99.8 | 99.8 | |
FPV | KS45 | HQ184201 | Cat (2008) | 99.5 | 99.1 | |
FPV | KS47 | HQ184202 | Cat (2008) | 99.6 | 99.5 | |
FPV | KS58 | HQ184203 | Cat (2008) | 99.7 | 99.8 | |
FPV | Gigucheon | MN400978 | Cat (2017) | 99.3 | 99.1 | |
FPV | Jun | MN400979 | Cat (2017) | 99.0 | 99.0 | |
FPV | Rara | MN400980 | Cat (2017) | 98.2 | 95.9 | |
FPV | 17D01 | OP153925 | Cat (2017) | 99.8 | 100.0 | |
FPV | 17D02 | OP153926 | Cat (2017) | 99.8 | 100.0 | |
FPV | Fe-P2 | MN683826 | Cat (2017) | 99.0 | 99.0 | |
FPV | 18D01 | OP153927 | Cat (2018) | 99.5 | 99.8 | |
FPV | 18Q234-1 | MW035310 | Dog (2018) | 99.5 | 99.8 | |
FPV | 19D01 | OP153928 | Cat (2019) | 99.8 | 100.0 | |
FPV | 19D02 | OP153929 | Cat (2019) | 99.8 | 100.0 | |
FPV | 19D03 | OP153930 | Cat (2019) | 99.7 | 100.0 | |
FPV | 19D04 | OP153931 | Cat (2019) | 99.8 | 100.0 | |
FPV | 19D05 | OP153932 | Cat (2019) | 98.5 | 99.8 | |
FPV | 19SP_CK-8 | MW035309 | Dog (2019) | 99.8 | 100.0 |
Virus Type | Strain | Variation in Amino Acid Residues at Positions in the VP2 Protein | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
80 | 87 | 93 | 101 | 103 | 232 | 300 | 305 | 323 | 426 | 562 | 564 | 568 | ||
In this study | KTPV-2305 | K | M | K | T | V | V | A | D | D | N | V | N | A |
FPV reference strains | FPV Philips Roxane | K | M | K | I | V | I | A | D | D | N | L | N | A |
FPV Purevax | K | M | K | I | V | I | A | D | D | N | L | N | A | |
FPV Felocell | K | M | K | T | V | I | A | D | D | N | L | N | A | |
CPV-2 reference strains | CPV-2|Pfizer/vaccine/06 | R | M | N | I | A | I | A | D | N | N | V | S | G |
CPV-2|Intervet/vaccine/06 | R | M | N | I | A | I | A | D | N | N | V | S | G | |
CPV-2a|PVFCAPC | R | L | N | T | A | I | G | Y | N | N | V | S | G | |
CPV-2b|PVCVP1VP2A/39 | R | L | N | T | A | I | G | Y | N | D | V | S | G | |
CPV-2c|67/06 | R | L | N | T | A | I | G | Y | N | E | V | S | G | |
Korean FPV strains | KF001 | K | M | K | T | V | V | A | D | D | N | V | N | A |
KF002 | K | M | K | T | V | V | A | D | D | N | V | N | A | |
KF003 | K | M | K | T | V | V | A | D | D | N | V | N | A | |
K2 | K | M | K | T | V | V | A | D | D | N | V | N | A | |
K3 | K | M | K | T | V | V | A | D | D | N | V | N | A | |
K4 | K | M | K | T | V | V | A | D | D | N | V | N | A | |
K7 | K | M | K | T | V | V | A | D | D | N | V | N | A | |
K22 | K | M | K | T | V | V | A | D | D | N | V | N | A | |
K23 | K | M | K | T | V | V | A | D | D | N | V | N | A | |
K49 | K | M | K | T | V | V | A | D | D | N | V | N | A | |
K50 | Q | M | K | T | V | V | A | D | D | N | V | N | A | |
KS2 | K | M | K | T | V | I | A | D | D | N | V | N | A | |
KS11 | K | M | K | T | V | V | A | D | D | N | V | N | A | |
KS18 | K | M | K | T | V | V | A | D | D | N | V | N | A | |
KS23 | K | M | K | T | V | V | A | D | D | N | V | N | A | |
KS42 | K | M | K | T | V | V | A | D | D | N | V | N | A | |
KS45 | K | M | K | T | V | V | A | N | D | N | V | N | A | |
KS47 | K | M | K | T | V | I | A | D | D | N | V | N | A | |
KS58 | K | M | K | T | V | V | A | D | D | N | V | N | A | |
Gigucheon | K | M | K | T | V | V | A | D | D | N | V | N | A | |
Jun | K | M | K | T | V | V | A | D | D | N | V | N | A | |
Rara | K | M | K | T | V | V | A | D | D | N | V | N | A | |
17D01 | K | M | K | T | V | V | A | D | D | N | V | N | A | |
17D02 | K | M | K | T | V | V | A | D | D | N | V | N | A | |
Fe-P2 | K | M | K | T | V | V | A | D | D | N | V | N | A | |
18D01 | K | M | K | T | V | V | A | D | D | N | V | N | A | |
18Q234-1 | K | M | K | T | V | V | A | D | D | N | V | N | A | |
19D01 | K | M | K | T | V | V | A | D | D | N | V | N | A | |
19D02 | K | M | K | T | V | V | A | D | D | N | V | N | A | |
19D03 | K | M | K | T | V | V | A | D | D | N | V | N | A | |
19D04 | K | M | K | T | V | V | A | D | D | N | V | N | A | |
19D05 | K | M | K | T | V | V | A | D | D | N | L | N | A | |
19SP_CK-8 | K | M | K | T | V | V | A | D | D | N | V | N | A |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yeo, Y.-G.; Kim, H.-R.; Park, J.; Kim, J.-M.; Shin, Y.-K.; Lee, K.-K.; Kwon, O.-K.; Jeoung, H.-Y.; Kang, H.-E.; Ku, B.-K.; et al. Epidemiological and Molecular Approaches for a Fatal Feline Panleukopenia Virus Infection of Captive Siberian Tigers (Panthera tigris altaica) in the Republic of Korea. Animals 2023, 13, 2991. https://doi.org/10.3390/ani13182991
Yeo Y-G, Kim H-R, Park J, Kim J-M, Shin Y-K, Lee K-K, Kwon O-K, Jeoung H-Y, Kang H-E, Ku B-K, et al. Epidemiological and Molecular Approaches for a Fatal Feline Panleukopenia Virus Infection of Captive Siberian Tigers (Panthera tigris altaica) in the Republic of Korea. Animals. 2023; 13(18):2991. https://doi.org/10.3390/ani13182991
Chicago/Turabian StyleYeo, Yong-Gu, Hye-Ryung Kim, Jonghyun Park, Jong-Min Kim, Yeun-Kyung Shin, Kyoung-Ki Lee, Oh-Kyu Kwon, Hye-Young Jeoung, Hae-Eun Kang, Bok-Kyung Ku, and et al. 2023. "Epidemiological and Molecular Approaches for a Fatal Feline Panleukopenia Virus Infection of Captive Siberian Tigers (Panthera tigris altaica) in the Republic of Korea" Animals 13, no. 18: 2991. https://doi.org/10.3390/ani13182991