Effects of Replacing Soybean Meal Protein with Chlorella vulgaris Powder on the Growth and Intestinal Health of Grass Carp (Ctenopharyngodon idella)
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Feed
2.2. Fish Experimental Design
2.3. Sample Collection and Preservation
2.4. Sample Analyses
2.4.1. Growth Index
2.4.2. Intestinal Histopathological Examination
2.4.3. Intestinal Immunity, Antioxidant Indices and mRNA Level Genes
2.4.4. 16S rRNA Sequencing and Intestinal Microbiota Analysis
2.4.5. Prediction of Intestinal Microbial Function
2.5. Statistical Analysis
3. Results
3.1. Feed Utilization, Indices, Growth and Biometric Parameters
3.2. Intestinal Morphology and Digestive Enzyme Activities
3.3. Intestine Antioxidant Indices
3.4. Intestine Immune Responses and Inflammation
3.5. Intestinal Microbiota
3.5.1. Comparison of Abundance and Diversity
3.5.2. Comparison of the Microbial Community Structure
3.5.3. Functional Predictions of Intestinal Microbiota
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wang, C.; Zhu, X.; Han, D.; Jin, J.; Yang, Y.; Xie, S. Responses to fishmeal and soybean meal-based diets by three kinds of larval carps of different food habits. Aquac. Nutr. 2015, 21, 552–568. [Google Scholar] [CrossRef]
- Koprucu, K.; Sertel, E. The effects of less-expensive plant protein sources replaced with soybean meal in the juvenile diet of grass carp (Ctenopharyngodon idella): Growth, nutrient utilization and body composition. Aquac. Int. 2012, 20, 399–412. [Google Scholar] [CrossRef]
- Gatlin, D.M., III; Barrows, F.T.; Brown, P.; Dabrowski, K.; Gaylord, T.G.; Hardy, R.W.; Herman, E.; Hu, G.; Krogdahl, A.; Nelson, R.; et al. Expanding the utilization of sustainable plant products in aquafeeds: A review. Aquac. Res. 2007, 38, 551–579. [Google Scholar] [CrossRef]
- Wu, X.T. The influence of the trade war between China and the United States on China’s soybean industry and countermeasures. Foreign Econ. Relat. Trade 2019, 11, 6–11. [Google Scholar]
- Cai, M.; Hui, W.; Deng, X.; Wang, A.; Hu, Y.; Liu, B.; Chen, K.; Liu, F.; Tian, H.; Gu, X.; et al. Dietary Haematococcus pluvialis promotes growth of red swamp crayfish Procambarus clarkii (Girard, 1852) via positive regulation of the gut microbial co-occurrence network. Aquaculture 2022, 551, 737900. [Google Scholar] [CrossRef]
- Xu, Z.; Li, X.Q.; Yang, H.; Poolsawat, L.; Wang, P.; Leng, X.J. Dietary rutin promoted the growth, serum antioxidant response and flesh collagen, free amino acids contents of grass carp (Ctenopharyngodon idella). Aquac. Nutr. 2020, 27, 544–555. [Google Scholar] [CrossRef]
- Phong, W.N.; Show, P.L.; Ling, T.C.; Juan, J.C.; Ng, E.P.; Chang, J.S. Mild cell disruption methods for bio-functional proteins recovery from microalgae—Recent developments and future perspectives. Algal Res. 2017, 31, 506–516. [Google Scholar] [CrossRef]
- Safi, C.; Zebib, B.; Merah, O.; Pontalier, P.Y.; Vaca-Garcia, C. Morphology, composition, production, processing and applications of Chlorella vulgaris: A review. Renew. Sustain. Energy Rev. 2014, 35, 265–278. [Google Scholar] [CrossRef] [Green Version]
- Kholif, A.E.; Olafadehan, O.A. Chlorella vulgaris microalgae in ruminant nutrition: A review of the chemical composition and nutritive value. Ann. Anim. Sci. 2021, 21, 789–806. [Google Scholar] [CrossRef]
- Raji, A.A.; Junaid, O.Q.; Milow, P.; Taufek, N.M.; Fada, A.M.; Kolawole, A.A.; Alias, Z.; Razak, S.A. Partial replacement of fishmeal with Spirulina platensis and Chlorella vulgaris and its effect on growth and body composition of African catfish Clarias gariepinus (Burchell 1822). Indian J. Fish. 2019, 66, 100–111. [Google Scholar] [CrossRef]
- Grammes, F.; Reveco, F.E.; Romarheim, O.H.; Landsverk, T.; Mydland, L.T.; Overland, M. Candida utilis and Chlorella vulgaris Counteract Intestinal Inflammation in Atlantic Salmon (Salmo salar L.). PLoS ONE 2013, 8, e83213. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hussein, E.E.S.; Dabrowski, K.; El-Saidy, D.M.; Lee, B.J. Enhancing the growth of Nile tilapia larvae/juveniles by replacing plant (gluten) protein with algae protein. Aquac. Res. 2013, 44, 937–949. [Google Scholar] [CrossRef]
- Zhao, Y.; Zhang, L.; Wang, C.; Xie, C. Biology and ecology of grass carp in China: A review and synthesis. N. Am. J. Fish. Manag. 2020, 40, 1379–1399. [Google Scholar] [CrossRef]
- Shen, Y.; Li, X.; Bao, Y.; Zhu, T.; Wu, Z.; Yang, B.; Jiao, L.; Zhou, Q.; Jin, M. Differential regulatory effects of optimal or excessive dietary lipid levels on growth, lipid metabolism and physiological response in black seabream (Acanthopagrus schlegelii). Aquaculture 2022, 560, 738532. [Google Scholar] [CrossRef]
- Liu, Y.; Huang, H.; Fan, J.; Zhou, H.; Zhang, Y.; Cao, Y.; Jiang, W.; Zhang, W.; Deng, J.; Tan, B. Effects of dietary non-starch polysaccharides level on the growth, intestinal flora and intestinal health of juvenile largemouth bass Micropterus salmoides. Aquaculture 2022, 557, 738343. [Google Scholar] [CrossRef]
- Badwy, T.M.; Ibrahim, E.M.; Zeinhom, M.M. Partial replacement of fishmeal with dried microalga (Chlorella spp. and Scenedesmus spp.) in nile tilapia (Oreochromis niloticus) diets. In Proceedings of the 8th International Symposium on Tilapia in Aquaculture 2008, Cairo, Egypt, 12–14 October 2008; pp. 801–811. [Google Scholar]
- Tang, Y.; Cheng, Z.Y.; Qiao, X.T.; Fu, Z.R.; Bai, M. Effect of glycine on the growth, digestive enzymes and antioxidant capacity of Penaeus vannamei. Feed Res. 2021, 44, 58–61. [Google Scholar] [CrossRef]
- Wei, Z.; Deng, K.; Zhang, W.; Mai, K. Interactions of dietary vitamin C and proline on growth performance, anti-oxidative capacity and muscle quality of large yellow croaker Larimichthys crocea. Aquaculture 2020, 528, 735558. [Google Scholar] [CrossRef]
- Ru, I.T.K.; Sung, Y.Y.; Jusoh, M.; Wahid, M.E.A.; Nagappan, T. Chlorella vulgaris: A perspective on its potential for combining high biomass with high value bioproducts. Appl. Phycol. 2020, 1, 2–11. [Google Scholar] [CrossRef] [Green Version]
- Shi, X.; Luo, Z.; Huang, C.; Zhu, X.M.; Liu, X. Effect of substituting Chlorella sp. for regular fishmeal on growth, body composition, hepatic lipid metabolism and histology in crucian carp (Carassius auratus). Acta Hydrobiol. Sin. 2015, 39, 498–506. [Google Scholar] [CrossRef]
- Jiang, M.; Zhao, H.H.; Zai, S.W.; Shepherd, B.; Wen, H.; Deng, D.F. A defatted microalgae meal (Haematococcus pluvialis) as a partial protein source to replace fishmeal for feeding juvenile yellow perch Perca flavescens. J. Appl. Phycol. 2019, 31, 1197–1205. [Google Scholar] [CrossRef]
- Ci, L.N. Effect of the Diets Replacing Different Proportions of Fishmeal with Aglgae Powder on the Growth Performance, Nutrients Digestbility and Immunity of Bluntnose Black Bream (Megalobrama Amblycephala). Master’s Thesis, Nanjing Agricultural University, Nanjing, China, 2011; pp. 60–63. Available online: https://kns.cnki.net/KCMS/detail/detail.aspx?dbname=CMFD201401&filename=1013285901.nh (accessed on 5 June 2022).
- Liu, S.; Yu, H.; Li, P.; Wang, C.; Liu, G.; Zhang, X.; Zhang, C.; Qi, M.; Ji, H. Dietary nano-selenium alleviated intestinal damage of juvenile grass carp (Ctenopharyngodon idella) induced by high-fat diet: Insight from intestinal morphology, tight junction, inflammation, anti-oxidization and intestinal microbiota. Anim. Nutr. 2022, 8, 235–248. [Google Scholar] [CrossRef] [PubMed]
- Hussein, E.E.S.; Dabrowski, K.; El-Saidy, D.M.S.D.; Lee, B.J. Effect of dietary phosphorus supplementation on utilization of algae in the grow-out diet of Nile tilapia O reochromis niloticus. Aquac. Res. 2014, 45, 1533–1544. [Google Scholar] [CrossRef]
- Ogello, E.O.; Kembenya, E.M.; Githukia, C.M.; Aera, C.N.; Munguti, J.M.; Nyamweya, C.S. Substitution of fishmeal with sunflower seed meal in diets for Nile tilapia (Oreochromis niloticus L.) reared in earthen ponds. J. Appl. Aquac. 2017, 29, 81–99. [Google Scholar] [CrossRef]
- Pirarat, N.; Pinpimai, K.; Endo, M.; Katagiri, T.; Ponpornpisit, A.; Chansue, N.; Maita, M. Modulation of intestinal morphology and immunity in nile tilapia (Oreochromis niloticus) by Lactobacillus rhamnosus GG. Res. Vet. Sci. 2011, 91, e92–e97. [Google Scholar] [CrossRef] [PubMed]
- He, Y.; Liang, J.; Dong, X.; Liu, H.; Yang, Q.; Zhang, S.; Chi, S.; Tan, B. Soybean β-conglycinin and glycinin reduced growth performance and the intestinal immune defense and altered microbiome in juvenile pearl gentian groupers Epinephelus fuscoguttatus♀× Epinephelus lanceolatus♂. Anim. Nutr. 2022, 9, 193–203. [Google Scholar] [CrossRef]
- Joya, M.; Ashayerizadeh, O.; Dastar, B. Effects of Spirulina (Arthrospira) platensis and Bacillus subtilis PB6 on growth performance, intestinal microbiota and morphology, and serum parameters in broiler chickens. Anim. Prod. Sci. 2021, 61, 390–398. [Google Scholar] [CrossRef]
- Kang, H.K.; Park, S.B.; Kim, C.H. Effects of dietary supplementation with a Chlorella by-product on the growth performance, immune response, intestinal microflora and intestinal mucosal morphology in broiler chickens. J. Anim. Physiol. Anim. Nutr. 2017, 101, 208–214. [Google Scholar] [CrossRef] [PubMed]
- Gillingham, M.A.; Borghesi, F.; Montero, B.K.; Migani, F.; Béchet, A.; Rendón-Martos, M.; Amat, J.A.; Dinelli, E.; Sommer, S. Bioaccumulation of trace elements affects chick body condition and gut microbiome in greater flamingos. Sci. Total Environ. 2021, 761, 143250. [Google Scholar] [CrossRef]
- Assan, D.; Kuebutornye, F.K.A.; Hlordzi, V.; Chen, H.; Mraz, J.; Mustapha, U.F.; Abarike, E.D. Effects of probiotics on digestive enzymes of fish (finfish and shellfish); status and prospects: A mini review. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2022, 257, 110653. [Google Scholar] [CrossRef]
- Radhakrishnan, S.; Bhavan, P.S.; Seenivasan, C.; Shanthim, R.; Poongodi, R. Influence of medicinal herbs (Alteranthera sessilis, Eclipta alba and Cissus qudrangularis) on growth and biochemical parameters of the freshwater prawn Macrobrachium rosenbergii. Aquac. Int. 2015, 22, 551–572. [Google Scholar] [CrossRef]
- Akbary, P.; Raeisi, M.E. Effect of dietary supplementation of Chlorella vulgaris on several physiological parameters of grey mullet, Mugil cephalus. Iran. J. Fish. Sci. 2020, 19, 1130–1139. [Google Scholar] [CrossRef]
- Xv, Z.; Zhong, Y.; Wei, Y.; Zhang, T.; Zhou, W.; Jiang, Y.; Chen, Y.; Lin, S. Yeast culture supplementation alters the performance and health status of juvenile largemouth bass (Micropterus salmoides) fed a high-plant protein diet. Aquac. Nutr. 2021, 27, 2637–2650. [Google Scholar] [CrossRef]
- Gonzalez-Mariscal, L.; Miranda, J.; Raya-Sandino, A.; Dominguez-Calderon, A.; Cuellar-Perez, F. ZO-2, a tight junction protein involved in gene expression, proliferation, apoptosis, and cell size regulation. Ann. N. Y. Acad. Sci. 2017, 1397, 35–53. [Google Scholar] [CrossRef]
- Guo, W.; Zeng, M.; Zhu, S.; Li, S.; Qian, Y.; Wu, H. Phycocyanin ameliorates mouse colitis via phycocyanobilin-dependent antioxidant and anti-inflammatory protection of the intestinal epithelial barrier. Food Funct. 2022, 13, 3294–3307. [Google Scholar] [CrossRef]
- He, P.; Jiang, W.-D.; Liu, X.-A.; Feng, L.; Wu, P.; Liu, Y.; Jiang, J.; Tan, B.-P.; Yang, Q.-H.; Kuang, S.-Y.; et al. Dietary biotin deficiency decreased growth performance and impaired the immune function of the head kidney, spleen and skin in on-growing grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 2020, 97, 216–234. [Google Scholar] [CrossRef] [PubMed]
- Zheng, L.; Xie, S.; Zhuang, Z.; Liu, Y.; Tian, L.; Niu, J. Effects of yeast and yeast extract on growth performance, antioxidant ability and intestinal microbiota of juvenile pacific white shrimp (Litopenaeus vannamei). Aquaculture 2021, 530, 735941. [Google Scholar] [CrossRef]
- Son, Y.A.; Shim, J.A.; Hong, S.; Kim, M.K. Intake of Chlorella vulgaris improves antioxidative capacity in rats oxidatively stressed with dietary cadmium. Ann. Nutr. Metab. 2009, 54, 7–14. [Google Scholar] [CrossRef]
- Chen, Y.; Liu, X.; Wu, L.; Tong, A.; Zhao, L.; Liu, B.; Zhao, C. Physicochemical characterization of polysaccharides from Chlorella pyrenoidosa and its anti-ageing effects in Drosophila melanogaster. Carbohydr. Polym. 2018, 185, 120–126. [Google Scholar] [CrossRef]
- Balasundram, N.; Sundram, K.; Samman, S. Phenolic compounds in plants and agri-industrial by-products: Antioxidant activity, occurrence, and potential uses. Food Chem. 2006, 99, 191–203. [Google Scholar] [CrossRef]
- Shibata, S.; Natori, Y.; Nishihara, T.; Tomisaka, K.; Matsumoto, K.; Sansawa, H.; Nguyen, V.C. Antioxidant and anti-cataract effects of Chlorella on rats with streptozotocin-induced diabetes. J. Nutr. Sci. Vitaminol. 2003, 49, 334–339. [Google Scholar] [CrossRef]
- Yaakob, Z.; Ali, E.; Zainal, A.; Mohamad, M.; Takriff, M.S. An overview: Biomolecules from microalgae for animal feed and aquaculture. J. Biol. Res. -Thessalon. 2014, 21, 1–10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sørensen, M.; Gong, Y.; Bjarnason, F.; Vasanth, G.K.; Dahle, D.; Huntley, M.; Kiron, V. Nannochloropsis oceania-derived defatted meal as an alternative to fishmeal in atlantic salmon feeds. PLoS ONE 2017, 12, e0179907. [Google Scholar] [CrossRef] [Green Version]
- Qiao, H.; Hu, D.; Ma, J.; Wang, X.; Wu, H.; Wang, J. Feeding effects of the microalga Nannochloropsis sp. on juvenile turbot (Scophthalmus maximus L.). Algal Res. 2019, 41, 101540. [Google Scholar] [CrossRef]
- Tkachev, V.O.; Menshchikova, E.B.; Zenkov, N.K. Mechanism of the Nrf2/Keap1/ARE signaling system. Biochem. -Mosc. 2011, 76, 407–422. [Google Scholar] [CrossRef] [PubMed]
- Choi, J.W.; Lee, M.K.; Choi, Y.H.; Nam, T.J. Protective effects of Hizikia fusiforme and Chlorella sp. extracts against lead acetate-induced hepatotoxicity in rats. Fish. Aquat. Sci. 2019, 22, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Lee, S.; Nambi, R.W.; Won, S.; Katya, K.; Bai, S.C. Dietary selenium requirement and toxicity levels in juvenile Nile tilapia, Oreochromis niloticus. Aquaculture 2016, 464, 153–158. [Google Scholar] [CrossRef]
- Peng, K.; Chen, X.; Wei, D.; Zhao, L.; Chen, B.; Mo, W.; Zheng, C.; Sun, Y. Inclusion of Chlorella water extract in Oreochromis niloticus fingerling diets: Effects on growth performance, body composition, digestive enzyme activity, antioxidant and immune capacity, intestine and hepatic histomorphology and sodium nitrite stress resistance. Aquac. Rep. 2020, 18, 100547. [Google Scholar] [CrossRef]
- Chen, W.; Luo, L.; Han, D.; Long, F.; Chi, Q.; Hu, Q. Effect of dietary supplementation with Chlorella sorokiniana meal on the growth performance, antioxidant status, and immune response of rainbow trout (Oncorhynchus mykiss). J. Appl. Phycol. 2021, 33, 3113–3122. [Google Scholar] [CrossRef]
- Xu, W.; Gao, Z.; Qi, Z.; Qiu, Z.; Peng, J.Q.; Shao, R. Effect of dietary chlorella on the growth performance and physiological parameters of gibel carp, Carassius auratus gibelio. Turk. J. Fish. Aquat. Sci. 2014, 14, 53–57. [Google Scholar] [CrossRef]
- Kotrbacek, V.; Doubek, J.; Doucha, J. The chlorococcalean alga Chlorella in animal nutrition: A review. J. Appl. Phycol. 2015, 27, 2173–2180. [Google Scholar] [CrossRef]
- Wang, X.-Z.; Jiang, W.-D.; Feng, L.; Wu, P.; Liu, Y.; Zeng, Y.-Y.; Jiang, J.; Kuang, S.-Y.; Tang, L.; Tang, W.-N.; et al. Low or excess levels of dietary cholesterol impaired immunity and aggravated inflammation response in young grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 2018, 78, 202–221. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Miao, G.; Cao, J.M.; Zhou, H.T.; Niu, Y.L.; Zhang, Y.; Ren, Y.; Bao, X.Y.; Xing, Y.W. Effects of aerobic exercise combined with chlorella pyrenoidos of disintegrated cell wall on some indicators of lipid metabolism in rats with high-fat diet. Chin. J. Appl. Physiol. 2018, 34, 445–449. [Google Scholar] [CrossRef]
- Guo, W.; Zhu, S.; Feng, G.; Wu, L.; Feng, Y.; Guo, T.; Yang, Y.; Wu, H.; Zeng, M. Microalgae aqueous extracts exert intestinal protective effects in Caco-2 cells and dextran sodium sulphate-induced mouse colitis. Food Funct. 2020, 11, 1098–1109. [Google Scholar] [CrossRef] [PubMed]
- Eom, S.H.; Lee, J.H.; Lee, S.H.; Choe, I.H.; Kwon, H.J. Anti-neuroinflammatory Effects of Glycolytic Enzyme Extract of Microalgae Residues in LPS-stimulated BV-2 Microglia. J. Chitin Chitosan 2015, 20, 10–19. [Google Scholar] [CrossRef]
- Lim, K.H.; Staudt, L.M. Toll-like receptor signaling. Cold Spring Harb. Perspect. Biol. 2013, 5, a011247. [Google Scholar] [CrossRef] [Green Version]
- Xu, W.; Li, H.; Wu, L.; Jin, J.; Zhu, X.; Han, D.; Liu, H.; Yang, Y.; Xu, X.; Xie, S. Dietary Scenedesmus ovalternus improves disease resistance of overwintering gibel carp (Carassius gibelio) by alleviating toll-like receptor signaling activation. Fish Shellfish Immunol. 2020, 97, 351–358. [Google Scholar] [CrossRef]
- Sagaram, U.S.; Gaikwad, M.S.; Nandru, R.; Dasgupta, S. Microalgae as feed ingredients: Recent developments on their role in immunomodulation and gut microbiota of aquaculture species. FEMS Microbiol. Lett. 2021, 368, fnab071. [Google Scholar] [CrossRef]
- Fan, L.; Li, Q.X. Characteristics of intestinal microbiota in the Pacific white shrimp Litopenaeus vannamei differing growth performances in the marine cultured environment. Aquaculture 2019, 505, 450–461. [Google Scholar] [CrossRef]
- Van der Linde, C.; Barone, M.; Turroni, S.; Brigidi, P.; Keleszade, E.; Swann, J.R.; Costabile, A. An in vitro pilot fermentation study on the impact of Chlorella pyrenoidosa on gut microbiome composition and metabolites in healthy and ccoeliac subjects. Molecules 2021, 26, 2330. [Google Scholar] [CrossRef]
- Looft, T.; Levine, U.; Stanton, T. Cloacibacillus porcorum sp. nov.; a mucindegrading bacterium from the swine intestinal tract and emended description of the genus Cloacibacillus. Int. J. Syst. Evol. Microbiol. 2013, 63, 1960–1966. [Google Scholar] [CrossRef]
- Khan, I.; Huang, Z.; Liang, L.; Li, N.; Ali, Z.; Ding, L.; Hong, M.; Shi, H. Ammonia stress influences intestinal histomorphology, immune status and microbiota of Chinese striped-neck turtle (Mauremys sinensis). Ecotoxicol. Environ. Saf. 2021, 222, 112471. [Google Scholar] [CrossRef] [PubMed]
- Brennan, C.A.; Garrett, W.S. Fusobacterium nucleatum-symbiont, opportunist and oncobacterium. Nat. Rev. Microbiol. 2019, 17, 156–166. [Google Scholar] [CrossRef] [PubMed]
- Qi, M.; Cao, Z.; Shang, P.; Zhang, H.; Hussain, R.; Mehmood, K.; Chang, Z.; Wu, Q.; Dong, H. Comparative analysis of fecal microbiota composition diversity in Tibetan piglets suffering from diarrheagenic Escherichia coli (DEC). Microb. Pathog. 2021, 158, 105106. [Google Scholar] [CrossRef] [PubMed]
- Chiu, K.H.; Liu, W.S. Dietary administration of the extract of Rhodobacter sphaeroides WL-APD911 enhances the growth performance and innate immune responses of seawater red tilapia (Oreochromis mossambicus × Oreochromis niloticus). Aquaculture 2014, 418, 32–38. [Google Scholar] [CrossRef]
- Liao, Z.; Gong, Y.; Zhao, W.; He, X.; Wei, D.; Niu, J. Comparison effect of Rhodobacter sphaeroides protein replace fishmeal on growth performance, intestinal morphology, hepatic antioxidant capacity and immune gene expression of Litopenaeus vannamei under low salt stress. Aquaculture 2022, 547, 737488. [Google Scholar] [CrossRef]
Ingredients | SM | X25 | X50 | X75 | X100 |
---|---|---|---|---|---|
Fish meal | 40.0 | 40.0 | 40.0 | 40.0 | 40.0 |
Distiller dried grains with solubles | 90.0 | 90.0 | 90.0 | 90.0 | 90.0 |
Soybean meal 1 | 300.0 | 225.0 | 150.0 | 75.0 | 0.0 |
C. vulgaris powder 2 | 0.0 | 60.1 | 120.1 | 180.2 | 240.3 |
Rapeseed meal | 200.0 | 200.0 | 200.0 | 200.0 | 200.0 |
Rice bran | 100.0 | 100.0 | 100.0 | 100.0 | 100.0 |
Wheat flour | 220.0 | 220.0 | 220.0 | 220.0 | 220.0 |
Soybean oil | 21.4 | 16.0 | 10.7 | 5.3 | 0.0 |
Bentonite | 1.2 | 21.5 | 41.8 | 62.1 | 82.3 |
Choline chloride | 2.0 | 2.0 | 2.0 | 2.0 | 2.0 |
Ca(H2PO4)2 | 15.0 | 15.0 | 15.0 | 15.0 | 15.0 |
Premix 3 | 10.0 | 10.0 | 10.0 | 10.0 | 10.0 |
Antioxidant | 0.1 | 0.1 | 0.1 | 0.1 | 0.1 |
Anti-mildew agent | 0.3 | 0.3 | 0.3 | 0.3 | 0.3 |
Total | 1000.0 | 1000.0 | 1000.0 | 1000.0 | 1000.0 |
Proximate analysis | |||||
Crude protein | 304.6 | 306.9 | 305.9 | 306.7 | 307.8 |
Crude fat | 55.4 | 56.6 | 56.8 | 57.2 | 57.8 |
Crude ash | 102.9 | 99.4 | 101.3 | 100.5 | 102.8 |
Amino Acids | C. vulgaris | Soybean Meal |
---|---|---|
Ala | 38.0 | 20.4 |
Arg Δ | 27.1 | 34.6 |
Asp | 42.2 | 54.0 |
Cys | 2.4 | 6.8 |
Glu | 69.6 | 83.0 |
Gly | 24.2 | 19.7 |
His Δ | 10.4 | 12.5 |
Ile Δ | 15.0 | 20.4 |
Leu Δ | 36.6 | 34.7 |
Lys Δ | 27.6 | 24.7 |
Met Δ | 6.1 | 6.1 |
Phe Δ | 22.1 | 23.4 |
Pro | 33.1 | 23.5 |
Ser | 20.6 | 24.2 |
Thr Δ | 23.3 | 18.3 |
Trp | / | 6.5 |
Tyr | 14.6 | / |
Val Δ | 26.0 | 22.8 |
Gene | Forward (5′-3′) | Reverse (5′-3′) | Accession No. |
---|---|---|---|
β-actin | GATGATGAAATTGCCGCACTG | ACCGACCATGACGCCCTGATGT | M25013 |
cat | GAAGTTCTACACCGATGAGG | CCAGAAATCCCAAACCAT | FJ560431 |
cuznsod | CGCACTTCAACCCTTACA | ACTTTCCTCATTGCCTCC | GU901214 |
mnsod | ACGACCCAAGTCTCCCTA | ACCCTGTGGTTCTCCTCC | GU218534 |
nrf2 | CTGGACGAGGAGACTGGA | ATCTGTGGTAGGTGGAAC | KF733814 |
keap1 | TTCCACGCCCTCCTCAA | TGTACCCTCCCGCTATG | KF811013 |
il-1β | AGAGTTTGGTGAAGAAGAGG | TTATTGTGGTTACGCTGGA | JQ692172 |
il-6 | CAGCAGAATGGGGGAGTTATC | CTCGCAGAGTCTTGACATCCTT | KC535507.1 |
tlr-4 | TTCCACCTATTCATCTTTGC | ACTTTACGGCTGCCCATT | EU699768.1 |
tlr-7 | GAGCATACAGTTGAGTAAACGCAC | TCTCCAAGAATATCAGGACGATAA | JN867639.1 |
tlr-8 | TCACATCGCTTCCAGGTCTC | ACGGTGAAATAATGGGGGTT | HQ638214.1 |
occludin | TATCTGTATCACTACTGCGTCG | CATTCACCCAATCCTCCA | KF193855.1 |
claudin12 | CCCTGAAGTGCCCACAA | GCGTATGTCACGGGAGAA | KF998571 |
zo-1 | CGGTGTCTTCGTAGTCGG | CAGTTGGTTTGGGTTTCAG | KF193852.1 |
zo-2 | TACAGCGGGACTCTAAAATGG | TCACACGGTCGTTCTCAAAG | KM112095 |
Items | SM | X25 | X50 | X75 | X100 |
---|---|---|---|---|---|
IW 1 | 20.28 ± 0.18 | 20.04 ± 0.13 | 20.11 ± 0.13 | 20.16 ± 0.10 | 20.08 ± 0.18 |
FW 2 | 60.11 ± 1.13 a | 57.87 ± 3.96 a | 67.25 ± 0.49 b | 61.57 ± 0.48 ab | 59.43 ± 1.10 a |
WGR 3 | 200.56 ± 1.15 a | 189.34 ± 19.78 a | 232.92 ± 2.67 b | 207.83 ± 2.38 ab | 197.16 ± 5.49 a |
FCR 4 | 1.71 ± 0.04 bc | 1.64 ± 0.05 b | 1.45 ± 0.03 a | 1.58 ± 0.03 b | 1.79 ± 0.04 c |
SR 5 | 87.33 ± 0.67 | 87.33 ± 1.76 | 87.33 ± 2.91 | 86.00 ± 2.00 | 89.33 ± 2.40 |
PER 6 | 168.89 ± 4.11 b | 159.56 ± 7.03 b | 208.58 ± 1.98 c | 174.27 ± 3.41 b | 142.23 ± 5.09 a |
CF 7 | 2.18 ± 0.05 b | 1.99 ± 0.04 ab | 2.06 ± 0.05 ab | 2.06 ± 0.04 ab | 1.92 ± 0.12 a |
HIS 8 | 3.45 ± 0.12 | 3.69 ± 0.23 | 3.59 ± 0.34 | 3.45 ± 0.26 | 3.84 ± 0.48 |
VSI 9 | 20.63 ± 0.62 | 19.17 ± 0.41 | 21.68 ± 0.68 | 18.32 ± 3.71 | 19.27 ± 1.74 |
Items | SM | X25 | X50 | X75 | X100 |
---|---|---|---|---|---|
Crude protein | 17.63 ± 0.41 a | 19.34 ± 0.30 b | 20.62 ± 0.31 c | 19.61 ± 0.54 bc | 20.76 ± 0.31 c |
Crude lipid | 8.27 ± 0.50 | 7.38 ± 0.51 | 7.23 ± 0.15 | 7.13 ± 0.55 | 7.33 ± 0.60 |
Moisture | 68.61 ± 0.16 a | 68.96 ± 0.58 a | 70.56 ± 0.30 b | 69.75 ± 0.66 ab | 70.48 ± 0.28 b |
Ash | 3.95 ± 0.26 | 3.09 ± 0.80 | 1.65 ± 0.58 | 3.49 ± 1.11 | 1.64 ± 0.46 |
Items | SM | X25 | X50 | X75 | X100 |
---|---|---|---|---|---|
Villus height (μm) | 510.03 ± 24.41 a | 586.43 ± 28.20 ab | 601.27 ± 23.30 b | 605.60 ± 30.50 b | 604.90 ± 18.36 b |
Muscle thickness (μm) | 206.60 ± 13.61 | 207.81 ± 12.11 | 199.87 ± 5.34 | 198.34 ± 13.08 | 195.06 ± 7.72 |
Goblet cell (A/root) | 43.00 ± 3.21 b | 51.00 ± 3.21 bc | 53.33 ± 4.81 c | 31.67 ± 0.88 a | 31.67 ± 1.45 a |
Items | SM | X25 | X50 | X75 | X100 |
---|---|---|---|---|---|
Amylase (U/mg prot) | 8.50 ± 0.30 a | 8.16 ± 0.67 a | 12.00 ± 0.79 b | 9.31 ± 0.42 a | 8.75 ± 1.42 a |
Lipases (U/g prot) | 6.96 ± 0.40 | 5.89 ± 0.60 | 6.03 ± 0.85 | 5.10 ± 0.63 | 5.25 ± 0.60 |
Trypsin (U/mg prot) | 573.80 ± 20.07 b | 543.33 ± 17.92 ab | 656.80 ± 13.66 c | 522.86 ± 15.79 ab | 490.80 ± 14.17 a |
Items | SM | X25 | X50 | X75 | X100 |
---|---|---|---|---|---|
SOD 1 | 87.56 ± 4.52 a | 104.61 ± 5.22 ab | 112.79 ± 4.31 b | 96.05 ± 6.79 ab | 93.64 ± 6.56 a |
CAT 2 | 21.46 ± 14.32 b | 22.80 ± 20.62 b | 24.80 ± 21.86 b | 15.87 ± 13.60 a | 16.83 ± 11.50 a |
MDA 3 | 5.32 ± 0.08 c | 3.21 ± 0.48 b | 2.36 ± 0.05 a | 3.79 ± 0.09 b | 5.00 ± 0.08 c |
Items | SM | X25 | X50 | X75 | X100 |
---|---|---|---|---|---|
AKP 1 | 259.10 ± 13.57 c | 230.77 ± 2.85 bc | 206.83 ± 17.91 b | 112.45 ± 2.74 a | 112.67 ± 4.91 a |
ACP 2 | 224.92 ± 6.10 ab | 253.60 ± 19.89 b | 302.61 ± 4.57 c | 193.77 ± 12.77 a | 195.80 ± 14.52 a |
LZM 3 | 31.82 ± 2.62 ab | 43.94 ± 4.01 c | 53.41 ± 0.66 d | 34.09 ± 0.58 b | 26.14 ± 0.66 a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, L.; Cai, M.; Zhong, L.; Shi, Y.; Xie, S.; Hu, Y.; Zhang, J. Effects of Replacing Soybean Meal Protein with Chlorella vulgaris Powder on the Growth and Intestinal Health of Grass Carp (Ctenopharyngodon idella). Animals 2023, 13, 2274. https://doi.org/10.3390/ani13142274
Yang L, Cai M, Zhong L, Shi Y, Xie S, Hu Y, Zhang J. Effects of Replacing Soybean Meal Protein with Chlorella vulgaris Powder on the Growth and Intestinal Health of Grass Carp (Ctenopharyngodon idella). Animals. 2023; 13(14):2274. https://doi.org/10.3390/ani13142274
Chicago/Turabian StyleYang, Linlin, Minglang Cai, Lei Zhong, Yong Shi, Shouqi Xie, Yi Hu, and Junzhi Zhang. 2023. "Effects of Replacing Soybean Meal Protein with Chlorella vulgaris Powder on the Growth and Intestinal Health of Grass Carp (Ctenopharyngodon idella)" Animals 13, no. 14: 2274. https://doi.org/10.3390/ani13142274
APA StyleYang, L., Cai, M., Zhong, L., Shi, Y., Xie, S., Hu, Y., & Zhang, J. (2023). Effects of Replacing Soybean Meal Protein with Chlorella vulgaris Powder on the Growth and Intestinal Health of Grass Carp (Ctenopharyngodon idella). Animals, 13(14), 2274. https://doi.org/10.3390/ani13142274