CdsH Contributes to the Replication of Salmonella Typhimurium inside Epithelial Cells in a Cysteine-Supplemented Medium
Abstract
1. Introduction
2. Materials and Methods
3. Results
3.1. The cdsH and ybaO Genes Participate in the Response of S. Typhimurium against High Concentrations of Cysteine in Minimal Medium
3.2. The Expression of the cdsH Gene is Induced in the Presence of Cysteine
3.3. Cysteine Promotes Replication of S. Typhimurium inside Epithelial Cells in a cdsH-Dependent Manner
4. Discussion
4.1. Cysteine Susceptibility Occurs only in Minimal Medium
4.2. CdsH Contributes to the Replication of S. Typhimurium in the HT-29 Line, against the Addition of Exogenous Cysteine
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- World Health Organization. Salmonella (non-typhoidal), who.int. 2018. Available online: https://www.who.int/news-room/fact-sheets/detail/salmonella-(non-typhoidal) (accessed on 12 November 2020).
- Haraga, A.; Ohlson, M.B.; Miller, S.I. Salmonellae interplay with host cells. Nat. Rev. Microbiol. 2008, 6, 53–66. [Google Scholar] [CrossRef] [Scilit]
- LaRock, D.L.; Chaudhary, A.; Miller, S.I. Salmonellae interactions with host processes. Nat. Rev. Microbiol. 2015, 13, 191–205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Snoeck, V.; Goddeeris, B.; Cox, E. The role of enterocytes in the intestinal barrier function and antigen uptake. Microbes Infect. 2005, 7, 997–1004. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tortora, G.J.; Derrickson, B. Principles of Anatomy and Physiology, 12th ed.; Wiley: Hoboken, NJ, USA, 2008. [Google Scholar]
- Muthayya, N.M. Human Physiology, 3rd ed.; Jaypee Brothers Medical Publishers: Delhi, India, 2002. [Google Scholar]
- Bröer, S. Amino Acid Transport Across Mammalian Intestinal and Renal Epithelia. Physiol. Rev. 2008, 88, 249–286. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kwaik, Y.A.; Bumann, D. Microbial quest for food in vivo: “Nutritional virulence” as an emerging paradigm. Cell. Microbiol. 2013, 15, 882–890. [Google Scholar] [CrossRef] [Scilit]
- Adibi, S.A.; Mercer, D.W. Protein digestion in human intestine as reflected in luminal, mucosal, and plasma amino acid concentrations after meals. J. Clin. Investig. 1973, 52, 1586–1594. [Google Scholar] [CrossRef] [Scilit]
- Nelson, D.L.; Cox, M.M. Lehninger Principios de Bioquímica, 5th ed.; Omega: Barcelona, Spain, 2009. [Google Scholar]
- Oguri, T.; Schneider, B.; Reitzer, L. Cysteine catabolism and cysteine desulfhydrase (CdsH/STM0458) in Salmonella enterica serovar typhimurium. J. Bacteriol. 2012, 194, 4366–4376. [Google Scholar] [CrossRef] [Scilit]
- Park, S.; Imlay, J.A. High levels of intracellular cysteine promote oxidative DNA damage by driving the fenton reaction. J. Bacteriol. 2003, 185, 1942–1950. [Google Scholar] [CrossRef] [Scilit]
- Farr, S.B.; Kogoma, T. Oxidative stress responses in Escherichia coli and Salmonella typhimurium. Microbiol. Rev. 1991, 55, 561–585. [Google Scholar] [CrossRef]
- Alvarez, R.; Neumann, G.; Fravega, J.; Díaz, F.; Tejías, C.; Fuentes, J.A.; Paredes-Sabja, D.; Calderón, I.L.; Gil, F. Biochemical and Biophysical Research Communications CysB-dependent upregulation of the Salmonella typhimurium cysJIH operon in response to antimicrobial compounds that induce oxidative stress. Biochem. Biophys. Res. Commun. 2015, 1–6. [Google Scholar] [CrossRef] [Scilit]
- Allen, H.; Hussey, G. Inhibition of the growth of Helminthospovium cavbonum by Lcysteine. Can. J. Microbiol. 1971, 17, 101–103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cowman, R.A.; Baron, S.S.; Fitzgerald, R.J. Cysteine toxicity for oral streptococci and effect of branched-chain amino acids. Infect. Immun. 1983, 39, 1107–1113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gomez, R.F.; Montville, T.; Blais, K. Toxic effect of cysteine against Salmonella typhimurium. Appl. Environ. Microbiol. 1980, 39, 1081–1083. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Collins, J.M.; Wallenstein, A.; Monty, K.J. Regulatory Features of the Cysteine Desulfhydrase of Salmonella Typhimurium. Growth (Lakel.) 1973, 313, 156–162. [Google Scholar] [CrossRef] [Scilit]
- Harris, C.L.; Lui, L. Cysteine and growth inhibition of Escherichia coli: Derepression of the ilvGEDA operon. Biochem. Biophys. Res. Commun. 1981, 101, 1145–1151. [Google Scholar] [CrossRef] [Scilit]
- Kari, C.; Nagy, Z.; Kovacs, P.; Hernadi, F. Mechanism of the growth inhibitory effect of cysteine on Escherichia coli. J. Gen. Microbiol. 1971, 68, 349–356. [Google Scholar] [CrossRef] [Scilit]
- Fiorucci, S.; Distrutti, E.; Cirino, G.; Wallace, J.L. The Emerging Roles of Hydrogen Sulfide in the Gastrointestinal Tract and Liver. Gastroenterology 2006, 131, 259–271. [Google Scholar] [CrossRef] [Scilit]
- Kovács, P.; Kari, C.; Nagy, Z.; Hernádi, F.; Kovacs, P.; Hernadi, F. Possible Explanation for the Metabolic Radioprotective Effect of Cysteine on Escherichia coli B. Radiat. Res. 1968, 36, 217. [Google Scholar] [CrossRef] [Scilit]
- Sorensen, M.A.; Pedersen, S. Cysteine, even in low concentrations, induces transient amino acid starvation in Escherichia coli. J. Bacteriol. 1991, 173, 5244–5246. [Google Scholar] [CrossRef] [Scilit]
- Hautefort, I.; Thompson, A.; Eriksson-Ygberg, S.; Parker, M.L.; Lucchini, S.; Danino, V.; Bongaerts, R.J.M.; Ahmad, N.; Rhen, M.; Hinton, J.C.D. During infection of epithelial cells Salmonella enterica serovar Typhimurium undergoes a time-dependent transcriptional adaptation that results in simultaneous expression of three type 3 secretion systems. Cell. Microbiol. 2008, 10, 958–984. [Google Scholar] [CrossRef] [Scilit]
- Datsenko, K.A.; Wanner, B.L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 2000, 97, 6640–6645. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Uzzau, S.; Figueroa-Bossi, N.; Rubino, S.; Bossi, L. Epitope tagging of chromosomal genes in Salmonella. Proc. Natl. Acad. Sci. USA 2001, 98, 15264–15269. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nevermann, J.; Silva, A.; Otero, C.; Oyarzún, D.P.; Barrera, B.; Gil, F.; Calderón, I.L.; Fuentes, J.A. Identification of Genes Involved in Biogenesis of Outer Membrane Vesicles (OMVs) in Salmonella enterica Serovar Typhi. Front. Microbiol. 2019, 10, 104. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bradford, M.M. A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Jofré, M.R.; Rodríguez, L.M.; Villagra, N.A.; Hidalgo, A.A.; Mora, G.C.; Fuentes, J.A. RpoS integrates CRP, Fis, and PhoP signaling pathways to control Salmonella Typhi hlyE expression. BMC Microbiol. 2014, 14, 139. [Google Scholar] [CrossRef] [Scilit]
- Ortega, A.P.; Villagra, N.A.; Urrutia, I.M.; Valenzuela, L.M.; Talamilla-Espinoza, A.; Hidalgo, A.A.; Rodas, P.I.; Gil, F.; Calderón, I.L.; Paredes-Sabja, D.; et al. Lose to win: MarT pseudogenization in Salmonella enterica serovar Typhi contributed to the surV -dependent survival to H2O2, and inside human macrophage-like cells. Infect. Genet. Evol. 2016, 45, 111–121. [Google Scholar] [CrossRef] [Scilit]
- Repetto, G.; Del Peso, A.; Zurita, J.L. Neutral red uptake assay for the estimation of cell viability/cytotoxicity. Nat. Protoc. 2008, 3, 125. [Google Scholar] [CrossRef] [Scilit]
- Fuentes, J.A.; Villagra, N.; Castillo-Ruiz, M.; Mora, G.C. The Salmonella Typhi hlyE gene plays a role in invasion of cultured epithelial cells and its functional transfer to S. Typhimurium promotes deep organ infection in mice. Res. Microbiol. 2008, 159, 279–287. [Google Scholar] [CrossRef] [Scilit]
- Wang, Q.; Wu, J.; Friedberg, D.; Plakto, J.; Calvo, J.M. Regulation of the Escherichia coli lrp gene. J. Bacteriol. 1994, 176, 1831–1839. [Google Scholar] [CrossRef] [Scilit]
- Leung, K.Y.; Finlay, B.B. Intracellular replication is essential for the virulence of Salmonella typhimurium. Proc. Natl. Acad. Sci. USA 1991, 88, 11470–11474. [Google Scholar] [CrossRef] [Scilit]
- Tao, H.A.N.; Bausch, C.; Richmond, C.; Blattner, F.R.; Conway, T.; Acteriol, J.B. Functional Genomics: Expression Analysis of Escherichia coli Growing on Minimal and Rich Media. J. Bacteriol. 1999, 181, 6425–6440. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Imlay, K.R.C.; Korshunov, S.; Imlay, J.A. The physiological roles and adverse effects of the two cystine importers of Escherichia coli. J. Bacteriol. 2015, 197, 3629–3644. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carter, P.B.; Collins, F.M. The route of enteric infection in normal mice. J. Exp. Med. 1974, 139, 1189–1203. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, C.A.; Falkow, S. The ability of Salmonella to enter mammalian cells is affected by bacterial growth state. Proc. Natl. Acad. Sci. USA 1990, 87, 4304–4308. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ernst, R.K.; Dombroski, D.M.; Merrick, J.M. Anaerobiosis, type 1 fimbriae, and growth phase are factors that affect invasion of HEp-2 cells by Salmonella typhimurium. Infect. Immun. 1990, 58, 2014–2016. [Google Scholar] [CrossRef] [Scilit]
- Raffatellu, M.; Wilson, R.P.; Chessa, D.; Andrews-Polymenis, H.; Tran, Q.T.; Lawhon, S.; Khare, S.; Adams, L.G.; Bäumler, A.J. SipA, SopA, SopB, SopD, and SopE2 Contribute to Salmonella enterica Serotype Typhimurium Invasion of Epithelial Cells. IAI 2005, 73, 146–154. [Google Scholar] [CrossRef] [Scilit]
- Gahring, L.C.; Heffron, F.; Finlay, B.B.; Falkow, S. Invasion and replication of Salmonella typhimurium in animal cells. Infect. Immun. 1990, 58, 443–448. [Google Scholar] [CrossRef] [Scilit]
- Knodler, L.A.; Steele-Mortimer, O. Taking possession: Biogenesis of the Salmonella-containing vacuole. Traffic 2003, 4, 587–599. [Google Scholar] [CrossRef] [Scilit]
- Hensel, M.; Bakteriologie, L.; Von Pettenkofer-Institut, M. Salmonella pathogenicity island 2. Mol. Microbiol. 2000, 36, 1015–1023. [Google Scholar] [CrossRef] [Scilit]
- Steele-Mortimer, O.; Brumell, J.H.; Knodler, L.A.; Méresse, S.; Lopez, A.; Finlay, B.B. The invasion-associated type III secretion system of Salmonella enterica serovar Typhimurium is necessary for intracellular proliferation and vacuole biogenesis in epithelial cells. Cell. Microbiol. 2002, 4, 43–54. [Google Scholar] [CrossRef] [Scilit]
- Contreras, I.; Toro, C.S.; Troncoso, G.; Mora, G.C. Salmonella typhi mutants defective in anaerobic respiration are impaired in their ability to replicate within epithelial cells. Microbiology 1997, 143, 2665–2672. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bjur, E.; Eriksson-Ygberg, S.; Åslund, F.; Rhen, M. Thioredoxin 1 Promotes Intracellular Replication and Virulence of Salmonella enterica Serovar typhimurium. IAI 2006, 74, 5140–5151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bucarey, S.A.; Martinic, M.P.; Trombert, A.N.; Santiviago, C.A.; Maule, N.P.; Mora, G.C. The Salmonella enterica Serovar Typhi tsx Gene, Encoding a Nucleoside-Specific Porin, Is Essential for Prototrophic Growth in the Absence of Nucleosides. Infect. Immun. 2005, 73, 6210–6219. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Collins, J.M.; Monty, K.J. The cysteine Desulfhydrase of Salmonella typhimurium. J. Biol. Chem. 1972, 248, 5943–5949. [Google Scholar]
- Kredich, N.M.; Keenan, B.S.; Foote, L.J. The Purification and Subunit Structure of Cysteine Desulfhydrase from Salmonella typhimurium. J. Biol. Chem. 1972, 247, 7157–7163. [Google Scholar] [PubMed]
- Baptist, E.W.; Kredich, N.M. Regulation of L-cystine transport in Salmonella typhimurium. J. Bacteriol. 1977, 131, 111–118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Palmer, L.D.; Leung, M.H.; Downs, D.M. The Cysteine Desulfhydrase CdsH Is Conditionally Required for Sulfur Mobilization to the Thiamine Thiazole in Salmonella enterica. J. Bacteriol. 2014, 196, 3964–3970. [Google Scholar] [CrossRef] [Scilit]
- Schauer, K.; Stolz, J.; Scherer, S.; Fuchs, T.M. Both Thiamine Uptake and Biosynthesis of Thiamine Precursors Are Required for Intracellular Replication of Listeria monocytogenes. J. Bacteriol. 2009, 191, 2218–2227. [Google Scholar] [CrossRef] [Scilit]
- Rhen, M. Salmonella and Reactive Oxygen Species: A Love-Hate Relationship. J. Innate Immun. 2019, 11, 216–226. [Google Scholar] [CrossRef] [Scilit]



| Primers | Comment | Sequence (5′-3′) |
|---|---|---|
| cdsHwannerF | Generation of ΔcdsH | GGCACAAAATGATAAATGGATATTAATGATGAGTAGCAATGTAGGCTGGAGCTGCTTCGA |
| cdsHwannerR | Generation of ΔcdsH | ATTCAGTCTGGCTTTTTTTTGGTTTCTAGTCGCCGGTAAGATATGAATATCCTCCTTAG |
| ybaOwannerF | Generation of ΔybaO | GAAAAATATTCTCTATGGAGTGGGTATGTTAGATAAAATTGTAGGCTGGAGCTGCTTCGA |
| ybaOwannerR | Generation of ΔybaO | ATTTCCGGCAATACCGGGAGAATTATTCAATGGGCAGAGACATATGAATATCCTCCTTAG |
| cdsHextF | Test the generation of ΔcdsH | AATAAGCAAAGCAGCTTACGGTCAA |
| cdsHextR | Test the generation of ΔcdsH | CACACCTTTCGGTTATCGGACATTG |
| ybaOextF | Test the generation of ΔybaO | ATCCATTTATCATTTTGTGCCAAGA |
| ybaOextR | Test the generation of ΔybaO | GCCAAGATAGCGACGCCATT |
| cdsH3×FLAGF | Generation of cdsH-3×FLAG | GCCGTGGTCAGCGGCCATCGCAAAATTACTTACCGGCGACGACTACAAAGACCATGACGG GACTACAAAGACCATGACGG |
| cdsH3×FLAGR | Generation of cdsH-3×FLAG | ATTGGCTGGACAATCCGCATCTACCTTATTCCCCCGAATGCATATGAATATCCTCCTTAG |
| ybaO3×FLAGF | Generation of ybaO-3×FLAG | GATGGAACAGATTAAGTACACCACCTCTCTGCCCATTGAAGACTACAAAGACCATGACGG |
| ybaO3×FLAGR | Generation of ybaO-3×FLAG | CGACGCCATTCCCGGCGAAAGTACCAGCTTAATTGAGCAACATATGAATATCCTCCTTAG |
| cdsHpMCL210F | Cloning of cdsH | GAATTCTCAGATTAACGGCATCCGCC |
| cdsHpMCL210R | Cloning of cdsH | AAGCTTCTAGTCGCCGGTAAGTAATTTTGC |
| ybaOpMCL210F | Cloning of ybaO | GAATTCAGGGGCAAACGAATAAGATGCG |
| ybaOpMCL210R | Cloning of ybaO | AAGCTTTTATTCAATGGGCAGAGAGGTGG |
| cdsHRTF | RT–PCR | CGGCTGGCGCATGAACTGAA |
| cdsHRTR | RT–PCR | TTCCGGCGCTCATGACGATAA |
| ybaORTF | RT–PCR | TGGAAGATGACGGTATCCTGCTTGG |
| ybaORTR | RT–PCR | CCAAGCACTTCCGGCATCTCAGAG |
| 16SF | RT–PCR | GTAGAATTCCAGGTGTAGCG |
| 16SR | RT–PCR | TTATCACTGGCAGTCTCCTT |
| Genotype | Antibiotic Resistance | Source |
|---|---|---|
| S. Typhimurium LT2 | - | ATCC®700720 |
| S. Typhimurium LT2 ΔcdsH::FRT * | - | This study |
| S. Typhimurium LT2 ΔcdsH::FRT/pACYC | CamR | This study |
| S. Typhimurium LT2 ΔcdsH::FRT/pACYC::cdsH ** | CamR | This study |
| S. Typhimurium LT2 ΔybaO::FRT *** | - | This study |
| S. Typhimurium LT2 ΔybaO::FRT/pMCL210 | CamR | This study |
| S. Typhimurium LT2 ΔybaO::FRT/pMCL210::ybaO **** | CamR | This study |
| S. Typhimurium LT2 cdsH-3×FLAG | KanR | This study |
| S. Typhimurium LT2 ybaO-3×FLAG | KanR | This study |
| Strain | MIC (mM) |
|---|---|
| S. Typhimurium LT2 | 6.4 |
| S. Typhimurium LT2 ΔcdsH | 0.4 |
| S. Typhimurium LT2 ΔcdsH/pACYC | 0.4 |
| S. Typhimurium LT2 ΔcdsH/pCdsH | >12.8 |
| S. Typhimurium LT2 ΔybaO | 0.4 |
| S. Typhimurium LT2 ΔybaO/pMCL210 | 0.4 |
| S. Typhimurium LT2 ΔybaO/pYbaO | 12.8 |
| Strain | Generation Time without Cysteine (h) | Generation Time with 0.2 mM Cysteine (h) |
|---|---|---|
| S. Typhimurium LT2 | 12.64 | 10.01 |
| S. Typhimurium LT2 ΔcdsH | 16.90 | 28.46 |
| S. Typhimurium LT2 ΔcdsH/pCdsH | 16.84 | 16.56 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Díaz-Yáñez, F.; Álvarez, R.; Calderón, I.L.; Fuentes, J.A.; Gil, F. CdsH Contributes to the Replication of Salmonella Typhimurium inside Epithelial Cells in a Cysteine-Supplemented Medium. Microorganisms 2020, 8, 2019. https://doi.org/10.3390/microorganisms8122019
Díaz-Yáñez F, Álvarez R, Calderón IL, Fuentes JA, Gil F. CdsH Contributes to the Replication of Salmonella Typhimurium inside Epithelial Cells in a Cysteine-Supplemented Medium. Microorganisms. 2020; 8(12):2019. https://doi.org/10.3390/microorganisms8122019
Chicago/Turabian StyleDíaz-Yáñez, Fernando, Ricardo Álvarez, Iván L. Calderón, Juan A. Fuentes, and Fernando Gil. 2020. "CdsH Contributes to the Replication of Salmonella Typhimurium inside Epithelial Cells in a Cysteine-Supplemented Medium" Microorganisms 8, no. 12: 2019. https://doi.org/10.3390/microorganisms8122019
APA StyleDíaz-Yáñez, F., Álvarez, R., Calderón, I. L., Fuentes, J. A., & Gil, F. (2020). CdsH Contributes to the Replication of Salmonella Typhimurium inside Epithelial Cells in a Cysteine-Supplemented Medium. Microorganisms, 8(12), 2019. https://doi.org/10.3390/microorganisms8122019

